ID: 1159474842

View in Genome Browser
Species Human (GRCh38)
Location 18:68907821-68907843
Sequence CGTTAAACAGCAGTAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159474842 Original CRISPR CGTTAAACAGCAGTAATGGA AGG Intronic
901336793 1:8456106-8456128 TGTCAAACAGCAGTATTAGAGGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907976828 1:59439123-59439145 AGCTACACTGCAGTAATGGATGG + Intronic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924184147 1:241469546-241469568 CATAAAACAGCAGTAAATGAGGG + Intergenic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1067805493 10:49389611-49389633 CTTTAAACAGCAGTAGTGATAGG - Intronic
1068252398 10:54459705-54459727 CATAAAATTGCAGTAATGGATGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1070205177 10:74251860-74251882 AGGAAAACAGCAGTAATGAATGG - Intronic
1070940074 10:80336824-80336846 GGTTAGACAGCAGAGATGGAGGG - Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1073313316 10:102559903-102559925 CATTAAACAGCAGCAAGTGAAGG - Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1080183765 11:29454763-29454785 TGTCAAACAGCAGTACTGCAAGG - Intergenic
1080515202 11:33014147-33014169 CCTTAAACAGAAGTAAAGCAGGG + Intergenic
1081272015 11:41096453-41096475 CTTTAATCAGCAGCAATGGATGG + Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085568689 11:77540002-77540024 AGTTACACAGCAGAAGTGGAAGG + Intronic
1086285491 11:85244939-85244961 GGATAAACAGCAGAAATGAATGG - Intronic
1096095646 12:48933921-48933943 CACTAAGCAGCAGCAATGGAAGG + Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1097802271 12:63927629-63927651 TTTTAAACTGCAGAAATGGATGG - Intronic
1100056084 12:90511511-90511533 CTTTAAACTGCAGTTATAGAAGG + Intergenic
1101470240 12:104989557-104989579 CGGTAAAAACCAGTAATGAAGGG - Intronic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110121344 13:71885702-71885724 AGTTTAACAGCAGAGATGGAGGG + Intergenic
1110603749 13:77407297-77407319 CATTAAACGGCAGTATTAGAGGG - Intergenic
1111324650 13:86677718-86677740 AGTTAAACAGCAGTAAGATAGGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1113035481 13:106043182-106043204 TGTTGAACAGCAATAATGGGAGG - Intergenic
1113155834 13:107320597-107320619 CGTTCAATAGTAATAATGGAGGG - Intronic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116805017 14:49485411-49485433 CGTCAAACAGCAGAAATGGATGG + Intergenic
1118372126 14:65146297-65146319 CGTAAAACAGAATCAATGGAGGG + Intergenic
1118629855 14:67692888-67692910 GGTAAAACAGCAGTAATAGGAGG + Intronic
1118657677 14:67969489-67969511 TGCTAAACAGAAGCAATGGAGGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1121877251 14:97464585-97464607 CTTTGAACAGCAGTATTGCATGG - Intergenic
1126561503 15:50048918-50048940 CATTAACCAACAGTAAGGGAGGG + Intronic
1128620340 15:69143753-69143775 AGTTAAATAGCAGTAGAGGAGGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129782633 15:78283682-78283704 AATTAAATAGCAATAATGGAAGG - Intronic
1130554111 15:84910801-84910823 CGTTCAAGTGCAGTAACGGAGGG + Intronic
1131655764 15:94456958-94456980 CATTAAACTGGAGTCATGGATGG - Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1138840656 16:60500290-60500312 CTTTAAAGAGCAGTAAAGGTAGG - Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150327631 17:64269450-64269472 CCTTAAATAGCAGAAGTGGAAGG + Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155617184 18:27735930-27735952 TGTAACACAGCAGGAATGGAGGG + Intergenic
1156544881 18:37954779-37954801 CGTAACTCAGCAATAATGGATGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158267427 18:55675850-55675872 CGTTGAATAGCAGTGATGAAAGG + Intergenic
1159096634 18:63909400-63909422 GGTTAAATATCACTAATGGATGG + Intronic
1159474842 18:68907821-68907843 CGTTAAACAGCAGTAATGGAAGG + Intronic
1159615659 18:70576459-70576481 GGCTTAACAGCAATAATGGAAGG - Intergenic
1160464079 18:79061149-79061171 CATTACAAAGCAGTAATTGAGGG + Intergenic
1164469504 19:28518222-28518244 CTTTAAAAAGCAGAAATGTATGG + Intergenic
1165588960 19:36948812-36948834 TGTTAAAAAGCAGTAATGCGAGG + Intronic
1165823193 19:38690264-38690286 CGGTGAACAGCAGTGAAGGATGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
926047632 2:9721454-9721476 CGCTAAACAAAAGTTATGGAAGG + Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
935736429 2:106110234-106110256 CGATTAACTGCAGTCATGGACGG + Intronic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
942831223 2:180238913-180238935 TGTTGAACAGCAGTGGTGGACGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172269223 20:33644191-33644213 AGTTAAACAGCAGTAGAGGGCGG + Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173186509 20:40844373-40844395 CCTTAAACATCAGTAATTGGGGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177594084 21:23212928-23212950 TGTGAAACAGCTGTAAGGGATGG - Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178199760 21:30390509-30390531 CTTTAAACAGAAGGAAAGGAGGG + Intronic
1179250764 21:39669618-39669640 AGTGAAACAGCAGGTATGGATGG - Exonic
1183755578 22:39759658-39759680 CCTTAAAAATCAGTAATAGAAGG - Intronic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
954890019 3:53917902-53917924 AGTTAAAAATCAATAATGGAAGG - Intergenic
956966849 3:74471379-74471401 TGATAAAATGCAGTAATGGATGG - Intronic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
958637770 3:96766574-96766596 CATTAACCAACAGTAAAGGAGGG - Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
966384494 3:179381437-179381459 TGTTAAACAGCAACAATGGCAGG - Intronic
967276139 3:187776869-187776891 ACTTTAACAGCAGCAATGGAAGG - Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
970078842 4:12256392-12256414 CTTTAAACAGCAGGAAGGAAAGG - Intergenic
971695115 4:29891374-29891396 AGATAAACAGAAGTTATGGAAGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
973824527 4:54691818-54691840 AGTGGAACAGCAGGAATGGAAGG + Intronic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
985829550 5:2218195-2218217 GGTTAAACATGAGTAATGAAAGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
991453011 5:66772674-66772696 CCTAAAACAGCAGTAAAAGATGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993491437 5:88556184-88556206 CTTTAAACATTAGTAATGTATGG - Intergenic
994010156 5:94892625-94892647 AGCTAAACAACAGCAATGGAGGG + Intronic
1003458572 6:6307611-6307633 CGTTTACCAGCACCAATGGAAGG + Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1008513217 6:52296696-52296718 CATTAACCAACAGTAAGGGAGGG - Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008645872 6:53514147-53514169 AGTTAAAAAACAGAAATGGATGG + Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022403996 7:30069484-30069506 TGTTCACCAACAGTAATGGAAGG + Intronic
1024864473 7:53888867-53888889 AGTTAAACAGGAGTTAGGGAGGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028726169 7:94090331-94090353 CCTTAATCAGCAGGAATGGGTGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031337826 7:120558449-120558471 TGTTCACCCGCAGTAATGGAGGG + Intronic
1032658919 7:133961829-133961851 CTTTCAACAGCAGTAATAGTTGG + Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034477025 7:151291183-151291205 AGTTAAAGAGCAGTAATGAAGGG + Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1038220392 8:25601728-25601750 GGATAAACAGCAATAATGAATGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040706018 8:50128219-50128241 TGTTCACCATCAGTAATGGAGGG - Intronic
1044297964 8:90550276-90550298 CGTTAAACATAAGAAATAGAAGG - Intergenic
1044571482 8:93723727-93723749 AGTTAAAAAGCAGTACTTGAGGG + Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046516197 8:115264755-115264777 CATTAAATAGGAGGAATGGAAGG - Intergenic
1046943231 8:119951654-119951676 CCATAAGCAACAGTAATGGAGGG - Intronic
1048317629 8:133374075-133374097 AATTAAACAGCAGTTATTGAAGG + Intergenic
1050321890 9:4460649-4460671 CTTAAAACAGTAGTAATGTAAGG + Intergenic
1053064438 9:35057593-35057615 CAATAAACTGCAGTAATGGGAGG - Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1055864055 9:80791098-80791120 AGTAAAACAGCAATAATAGATGG + Intergenic
1059695946 9:116730645-116730667 CATGAATGAGCAGTAATGGAAGG - Intronic
1186397624 X:9225666-9225688 TGGTTAACAGCAGTTATGGAGGG - Intergenic
1186971932 X:14855465-14855487 CTTTAAACAACATTAAGGGAAGG - Intronic
1187630977 X:21171917-21171939 AGTAAGACAGCAGTAATGGAGGG - Intergenic
1190640681 X:52481117-52481139 CATAAAACAGCAGTTCTGGAAGG - Intergenic
1190646991 X:52531748-52531770 CATAAAACAGCAGTTCTGGAAGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192261807 X:69510219-69510241 CATTGAACAGCAGCACTGGATGG + Intronic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198475307 X:136991167-136991189 CGAAAAACAGGAGTTATGGAAGG - Intergenic
1198839766 X:140843885-140843907 TGTTAAGCAACAGGAATGGAGGG + Intergenic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic