ID: 1159477193

View in Genome Browser
Species Human (GRCh38)
Location 18:68937126-68937148
Sequence CCTATGAGTTATAGTGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159477193_1159477197 16 Left 1159477193 18:68937126-68937148 CCAACAACACTATAACTCATAGG 0: 1
1: 0
2: 1
3: 6
4: 161
Right 1159477197 18:68937165-68937187 ACACATGTGTTTTCTCCCTAAGG 0: 1
1: 2
2: 27
3: 103
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159477193 Original CRISPR CCTATGAGTTATAGTGTTGT TGG (reversed) Intronic
902157931 1:14504764-14504786 CCTCTGAGGTAAAGTGCTGTAGG + Intergenic
904987040 1:34560258-34560280 GCCATGAGTTATAGTGCTATCGG + Intergenic
905011920 1:34753302-34753324 GTCATGAGTTATAGTGGTGTTGG + Intronic
907155645 1:52331167-52331189 CCTATAAGCTGTAGTGTTGCAGG - Intronic
908859496 1:68467350-68467372 GGTCTGAGTTATAGTGCTGTTGG - Intergenic
909769753 1:79406355-79406377 GGCATGAGTTATAGTGTGGTTGG + Intergenic
912091667 1:106083829-106083851 CCCATGAATTATAGTGTTGTTGG - Intergenic
915694674 1:157727336-157727358 AGCATGGGTTATAGTGTTGTTGG - Intergenic
916858565 1:168777847-168777869 CCTATGAAATAAAGTATTGTTGG + Intergenic
917399193 1:174627877-174627899 CCTATGAGTTACATTCTTGGTGG + Intronic
918089173 1:181273447-181273469 GGCATGAGTTAGAGTGTTGTTGG + Intergenic
918201103 1:182267764-182267786 GGCATGAGTTATAGTGCTGTTGG - Intergenic
918970752 1:191415135-191415157 GATATGAGTTATAGTGCCGTTGG + Intergenic
919730397 1:200909963-200909985 GGTATGAGTTACAGTGCTGTTGG - Intronic
921659906 1:217789421-217789443 CCTCTGAGTTTTACTGTGGTGGG - Intronic
922251591 1:223854069-223854091 CCTGTGGGTTACAGTATTGTGGG - Intergenic
922650330 1:227332329-227332351 AATATGAGTTTTATTGTTGTTGG - Intergenic
1063512448 10:6659174-6659196 CGTATGAGTTTTTATGTTGTGGG + Intergenic
1064800245 10:19062672-19062694 TCTATGAATTAGAGTATTGTAGG - Intronic
1065269532 10:24013276-24013298 GGCATGAGTTATAGTGTTTTTGG + Intronic
1065837423 10:29671370-29671392 CCTAAGAGATGTAGTGTGGTGGG - Intronic
1066291638 10:34019762-34019784 CCTTAGAGTTACAGGGTTGTGGG - Intergenic
1067168204 10:43882180-43882202 CATATCAGTTAGAGTGTTGGGGG - Intergenic
1068795514 10:61075210-61075232 AACATGAGTTATAGTGCTGTTGG - Intergenic
1068925982 10:62539135-62539157 TCTATGAGTTTTAGTTTTTTAGG - Intronic
1071959895 10:90799831-90799853 CCTCTAAGTTTTAGTGTGGTGGG - Intronic
1072007636 10:91269162-91269184 CCTTTGAGTAATAGTGTTTCAGG + Intronic
1077760063 11:5085457-5085479 AAAATGAGTTATAGTGCTGTTGG + Intergenic
1078112601 11:8410383-8410405 CCTAGTTGTTATAGTATTGTAGG - Intronic
1081191865 11:40114489-40114511 TGTATGAGTTATAGTGATTTAGG + Exonic
1081348831 11:42024006-42024028 CCTATGAGTTGTAGTAGTATTGG + Intergenic
1083496020 11:63054081-63054103 CGTATGAATTATAGGATTGTTGG + Intergenic
1084314311 11:68335618-68335640 GGTATGAGTTATAGCGTAGTTGG - Intronic
1088086610 11:105988084-105988106 ACAATGAGTTATTGTTTTGTTGG - Intergenic
1088518418 11:110665075-110665097 CCTATGGGTTATTGTTTTATGGG - Intronic
1091166871 11:133486046-133486068 AGCATGAGTTATAGTGCTGTTGG + Intronic
1092138338 12:6165441-6165463 GGCATGAGTTATAGTGCTGTTGG - Intergenic
1093269714 12:17044970-17044992 CAGGCGAGTTATAGTGTTGTTGG + Intergenic
1093892465 12:24538774-24538796 GTTAAGAGTTTTAGTGTTGTAGG - Intergenic
1094034384 12:26051832-26051854 GGCATGAGTTATAGTGCTGTTGG - Intronic
1100694057 12:97071904-97071926 CCTAATAGTTATAATGTTTTGGG + Intergenic
1101620691 12:106384769-106384791 GGCATGAGTTATAGTGCTGTTGG + Intronic
1102703764 12:114863441-114863463 CAGGTGAGTAATAGTGTTGTGGG + Intergenic
1103068791 12:117923158-117923180 GGAATGAGTTATAGTGCTGTTGG + Intronic
1103585671 12:121953085-121953107 GTCATGAGTTATAGTGCTGTTGG - Intronic
1106326910 13:28700479-28700501 CCTATGAGTGACCGTGTTGACGG + Intronic
1106429058 13:29662116-29662138 GGCATGAGTTATAGTGCTGTTGG - Intergenic
1106749526 13:32746509-32746531 GGTATGAGTTACAGTGCTGTTGG - Intronic
1108468346 13:50741813-50741835 CCAATGAGTTACTGTGTTTTTGG - Intronic
1108945423 13:56017528-56017550 CCTCTGATTTAAAGTGTTGAAGG - Intergenic
1109106343 13:58255770-58255792 ACTAAGAGTTATAGCTTTGTGGG - Intergenic
1109614807 13:64818415-64818437 GGCATGAGTTATAATGTTGTTGG + Intergenic
1111052859 13:82908028-82908050 CCTCTGAGTTATATTTATGTTGG + Intergenic
1113546048 13:111151658-111151680 GGCATGAGTTATAGTGCTGTTGG - Intronic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1116143026 14:41024953-41024975 CCTAGTATTTACAGTGTTGTAGG + Intergenic
1116827993 14:49690612-49690634 GCTATGAGTTATAGGGCTCTTGG - Intergenic
1117018240 14:51541078-51541100 CCTATCAGTTATGTTGATGTGGG + Intronic
1118508071 14:66437692-66437714 GGCATGAGTTACAGTGTTGTTGG - Intergenic
1118561335 14:67086704-67086726 CCTATGAAATATATTGCTGTGGG + Intronic
1119215691 14:72867450-72867472 CCTATGAGCTGTACTGTTGAGGG + Intronic
1120629350 14:86871051-86871073 AGTATGAGTTATAGTGTCATTGG - Intergenic
1121108937 14:91299198-91299220 GGCATGAGTTATAGTGCTGTTGG - Intronic
1126342436 15:47656148-47656170 CATTTGAGTTATAGTGCTGTTGG + Intronic
1126410558 15:48368938-48368960 CCTATGATGTAGAGTGTTTTTGG + Intergenic
1126479839 15:49105851-49105873 GGCATGAGTTATAGTGCTGTTGG + Intergenic
1126553896 15:49965204-49965226 CCCATGGGTTATAGGGGTGTGGG + Intronic
1127448295 15:59088813-59088835 CGCATGAGTTACAGTGTTGTTGG - Intronic
1127607558 15:60603683-60603705 GCCATGAGTTATACTGCTGTTGG - Intronic
1128599594 15:68984646-68984668 ACCATGAGTTGTGGTGTTGTGGG - Intronic
1131247935 15:90812060-90812082 TGTATGATTTATAGTATTGTAGG - Intronic
1140593895 16:76385803-76385825 GTCATGAGTTATAGTGCTGTTGG - Intronic
1147795046 17:43036320-43036342 CCGATGGGTAATAGTGTTGAAGG - Intergenic
1148572277 17:48679624-48679646 CCCATGATTTAGAGGGTTGTAGG - Intergenic
1148743248 17:49904696-49904718 CCTAGCACTTACAGTGTTGTGGG + Intergenic
1156906035 18:42352921-42352943 GCTATGAGTTATGCTGTTTTGGG - Intergenic
1157572110 18:48719891-48719913 GGCATGAGTTATAGTGCTGTTGG + Intronic
1157897703 18:51484557-51484579 CCTATAACTTATCCTGTTGTGGG + Intergenic
1158162530 18:54501710-54501732 GGCATGAGTTATAGTGCTGTTGG + Intergenic
1158241327 18:55381583-55381605 CCTATGAATTTAAGTGTAGTAGG + Intronic
1159367975 18:67494395-67494417 GGTATGAGTTACAGTGCTGTTGG + Intergenic
1159477193 18:68937126-68937148 CCTATGAGTTATAGTGTTGTTGG - Intronic
1159859768 18:73633452-73633474 TGTATGAGTTATAGTGTCATTGG - Intergenic
1161583217 19:5091869-5091891 CCTCTGATTTATGGCGTTGTGGG + Intronic
1162892644 19:13745052-13745074 CCTCTGAGCTATACTGTTTTGGG - Intronic
1165039129 19:33056448-33056470 CCTGTGAGTTTTAGTACTGTGGG + Intronic
1166062199 19:40333415-40333437 GGAATGAGTTACAGTGTTGTTGG + Intronic
926787243 2:16530486-16530508 CCTAGCAGTTATAGTCTTCTAGG - Intergenic
927011095 2:18905084-18905106 CACATGTGTTATAGTGTTGTAGG - Intergenic
927836777 2:26405205-26405227 CCTATGAGTTGTATTCTTGTTGG + Intronic
931483610 2:62668399-62668421 GGCATGAGTTACAGTGTTGTTGG + Intergenic
933859601 2:86452305-86452327 CGTCTGAGTTATAGTGCTCTTGG + Intronic
936754228 2:115686312-115686334 AGCGTGAGTTATAGTGTTGTTGG + Intronic
937169663 2:119853132-119853154 CCTATTAGTTAATATGTTGTTGG + Intronic
938636777 2:133236147-133236169 GGTATGAGTCATAGTGCTGTTGG + Intronic
938638269 2:133252449-133252471 TCTATGAGTTGTGATGTTGTTGG - Intronic
944726671 2:202478297-202478319 GGCATGAGTTATAGTGCTGTTGG + Intronic
1169731188 20:8787042-8787064 ATTATCAGTTAAAGTGTTGTAGG + Intronic
950882347 3:16333057-16333079 GGCATGAGTTATAGTGCTGTTGG - Intronic
951087907 3:18536466-18536488 GGCATGAGTTATAGTGCTGTTGG + Intergenic
954700643 3:52449085-52449107 CCCATGAGTTACAGTGGTCTGGG - Intergenic
954982429 3:54758646-54758668 CCTATGAGCAATGGTGTTCTTGG - Intronic
955944428 3:64178892-64178914 GGCATGAGTTATAGTGCTGTTGG - Intronic
955944430 3:64178914-64178936 GGCATGAGTTATAGTGCTGTTGG - Intronic
956967248 3:74476100-74476122 GGTATGAGTTATAGTGAGGTTGG + Intronic
957656728 3:83088302-83088324 GGTATGAGTTATAATGGTGTTGG - Intergenic
960621076 3:119637350-119637372 ACAATGAATTATAGTGTTTTGGG - Intronic
962153843 3:132922957-132922979 CATATGAATAATAGTGTTTTTGG + Intergenic
963357223 3:144224057-144224079 CTAATGGGTTATAGTTTTGTGGG - Intergenic
964908050 3:161742979-161743001 CCAAAGAGGTGTAGTGTTGTAGG - Intergenic
964913804 3:161814809-161814831 GACATAAGTTATAGTGTTGTTGG - Intergenic
965253079 3:166368216-166368238 CCCATGGGTTAAAGTGCTGTGGG + Intergenic
965553496 3:169995868-169995890 GGCATGAGTTACAGTGTTGTTGG - Exonic
966394748 3:179491018-179491040 CGTATGTGTTATTCTGTTGTTGG - Intergenic
971522251 4:27568587-27568609 CCTATGTGTTCTAGTTTTCTGGG - Intergenic
971776017 4:30966062-30966084 CTGATGAGTTATAATGTTGATGG - Intronic
973177198 4:47221886-47221908 GGCATGAGTTATAGTGCTGTTGG - Intronic
974672129 4:65045938-65045960 ACTATGAGTGAGAGTGCTGTAGG + Intergenic
974791094 4:66691042-66691064 CCTTTAAGTCTTAGTGTTGTGGG + Intergenic
976835927 4:89373850-89373872 GGTATGAGTTATAGTGCTGTTGG + Intergenic
977113238 4:92987422-92987444 ACTATTATTTATAATGTTGTGGG + Intronic
978058941 4:104311962-104311984 ACTATGGGTTACAGTGTTCTGGG + Intergenic
978922507 4:114201267-114201289 ACTGTGTGTTATAGTGTTCTGGG - Intergenic
979766543 4:124470901-124470923 CCTAAGAGTTTCAGGGTTGTAGG + Intergenic
984292216 4:177809252-177809274 CCTCCAAGTTATAGTGCTGTAGG + Intronic
986209596 5:5658470-5658492 CCTCTGAATCACAGTGTTGTTGG + Intergenic
987963586 5:24842896-24842918 GTCATGAGTTATAGTGCTGTTGG - Intergenic
990227867 5:53676481-53676503 GGCATGAGTTATAGTGCTGTTGG - Intronic
990749099 5:58993194-58993216 CCTCTGAGTTTTAGAGTTGCAGG - Intronic
995589792 5:113687327-113687349 CCAATGTGTTATTGAGTTGTTGG - Intergenic
1001917642 5:175575030-175575052 CCGATCAGTTATAGTGGTCTGGG + Intergenic
1001958603 5:175865911-175865933 TCTTTGACATATAGTGTTGTAGG + Intronic
1008293246 6:49744896-49744918 CCAATGAGTTATGGTGTGTTTGG - Intergenic
1009275905 6:61679387-61679409 CCTATTTGTTATATTTTTGTAGG + Intergenic
1011774962 6:90719592-90719614 TCTATGAGTTAAAGTGTTTCTGG + Intergenic
1012536132 6:100299326-100299348 TCTATGAGATATATTGTTGCAGG - Intergenic
1014741161 6:125148846-125148868 TATATGAGTTATAGTGCTATCGG + Intronic
1014741315 6:125150741-125150763 GGTATGAGTTTTAGTGCTGTTGG + Intronic
1015873271 6:137798413-137798435 CACATGAGTTATAGTGTTACTGG - Intergenic
1015940363 6:138444468-138444490 CCCTTTAGTTATAGTCTTGTGGG - Intronic
1021685894 7:23185467-23185489 TCTATGAGTGATAGAATTGTGGG - Intronic
1021784058 7:24135054-24135076 CCTTTGAGTTAAGGTGTGGTTGG + Intergenic
1027559735 7:79713706-79713728 CCTATGAGTTAACGTTTTTTAGG - Intergenic
1027572652 7:79889737-79889759 CCTACTATTTATAGTCTTGTTGG - Intergenic
1028552602 7:92086876-92086898 GGCATGAGTTATAGTGCTGTTGG - Intronic
1029047898 7:97650413-97650435 AGAATGAGTTATAGTGCTGTAGG + Intergenic
1029510083 7:100988798-100988820 CCCATGTGTTGTGGTGTTGTGGG + Intronic
1030262936 7:107585152-107585174 CCTCAGAGTTGTTGTGTTGTTGG + Intronic
1030718345 7:112837907-112837929 GGCATGAGTTATAGTGCTGTTGG - Intronic
1032373177 7:131381091-131381113 GATATGAGTTATAGTACTGTTGG - Intronic
1032479924 7:132238151-132238173 GGTATGTGTTATAGTGCTGTTGG + Intronic
1033251478 7:139764075-139764097 GGCATGAGTTATAGTGCTGTTGG + Intronic
1036409003 8:8480919-8480941 TGCATGAGTTATAGTGTTGTGGG - Intergenic
1041288951 8:56290045-56290067 GGAATGAGTTACAGTGTTGTTGG + Intergenic
1041965929 8:63676435-63676457 CCTATAAGTTATTGTGGGGTAGG - Intergenic
1043062897 8:75527269-75527291 GATATGAGTTATGGTATTGTTGG + Intronic
1048328246 8:133454780-133454802 CCTCTGAGTTGGAGTGTTGAAGG + Intergenic
1050333496 9:4568822-4568844 GGCATGAGTTATAGTGCTGTTGG + Intronic
1052598220 9:30590009-30590031 CCTTTCAATTGTAGTGTTGTTGG + Intergenic
1055851172 9:80631560-80631582 CTTATGAACTATAGTGATGTGGG - Intergenic
1056895483 9:90543961-90543983 CATATGTGTTAATGTGTTGTGGG + Intergenic
1058499832 9:105602064-105602086 ACTATGAATGATATTGTTGTTGG + Intronic
1186310717 X:8315329-8315351 GGCATGAGTTATAGTGCTGTTGG + Intergenic
1186412389 X:9355379-9355401 CGTATGAGTTACAGTGCCGTTGG + Intergenic
1186725159 X:12349457-12349479 CCTAACAGCTATGGTGTTGTGGG + Intronic
1188328616 X:28839172-28839194 CAAATGAGTTATAATGTTTTTGG + Intronic
1189037295 X:37505965-37505987 CCTCTCAGTTTTACTGTTGTTGG + Intronic
1196569090 X:117244756-117244778 CCTATGTGTAAAAGGGTTGTAGG + Intergenic
1196967122 X:121068611-121068633 GGTATGAATTATAGTGCTGTTGG + Intergenic