ID: 1159479782

View in Genome Browser
Species Human (GRCh38)
Location 18:68974283-68974305
Sequence AACACTGAGCAGAGGAACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159479782 Original CRISPR AACACTGAGCAGAGGAACGC TGG (reversed) Intronic
900591175 1:3460710-3460732 GACACTGACCAGAGTGACGCTGG - Intronic
901197404 1:7447780-7447802 CACACTCAGCACAGGAAGGCAGG - Intronic
901680715 1:10911233-10911255 CACTCAGAGCAGAGGAACACAGG + Intergenic
902048110 1:13541164-13541186 GACACAGAGCAGAGCAATGCTGG + Intergenic
902378404 1:16041277-16041299 AGAAGGGAGCAGAGGAACGCTGG - Intergenic
903041758 1:20536037-20536059 AGCAATGAGCCCAGGAACGCAGG + Intergenic
903187205 1:21635383-21635405 ATGACTGAGCAGAGGAATGAAGG - Intronic
907154884 1:52324457-52324479 AACACTGAGCTGAAGAACGATGG - Intronic
907458678 1:54592527-54592549 AACACTGGGGAGAGGAAAGTAGG - Exonic
908038299 1:60079941-60079963 AACACTCAGCAGAGGCACGTGGG - Intergenic
908952205 1:69574807-69574829 TACACTGATCAGAAGAACACCGG - Intronic
910731813 1:90406033-90406055 AACACACAGCAGAGGTACACTGG + Intergenic
912516888 1:110221968-110221990 AGCACTCGGCAGAGGAACGGCGG - Intronic
914336989 1:146724529-146724551 TTCTCTGAGCAGAGGAACCCAGG - Intergenic
915270849 1:154752383-154752405 AGCACTGAGCAGATGAAGGAAGG + Intronic
916059254 1:161087596-161087618 AACACTGAGCAGAGGTAATCAGG + Intronic
918066910 1:181107649-181107671 AACACTGAGCAGAGGCCAGAGGG + Intergenic
918301921 1:183212474-183212496 AACAATGAGCAATGGAAGGCAGG - Intronic
922018602 1:221679045-221679067 AACACTAACCAAAGGAAAGCTGG - Intergenic
922042019 1:221905950-221905972 AACACTGTGCAGTGTAATGCTGG - Intergenic
923968843 1:239177009-239177031 AACAGAGGTCAGAGGAACGCGGG - Intergenic
924774317 1:247105151-247105173 CACACTGAACAGAGGAAAGCAGG + Intergenic
1062779682 10:190688-190710 AACACTGAGTAGGGAGACGCTGG - Intronic
1066252704 10:33649861-33649883 ACCACTGTGCACAGGAACACTGG + Intergenic
1067296588 10:44978304-44978326 AACACTGGTCAGAGGAAGGCTGG + Intronic
1067320169 10:45211528-45211550 AACACTAAGCAAAAGAAAGCTGG + Intergenic
1067683350 10:48453730-48453752 GACACTGAGAAGGGGAATGCAGG - Intronic
1070071866 10:73097243-73097265 AAAAATGAGAAGAGGAACGTGGG + Intergenic
1070472760 10:76800450-76800472 AAAGCTGAGCAAAGGAACACTGG - Intergenic
1070630729 10:78082613-78082635 AGCACAGAGCAAAGGAAGGCTGG - Intergenic
1071083418 10:81839761-81839783 AAAACTGAGCAGAGGAAGGTGGG + Intergenic
1071943775 10:90617290-90617312 ACAACTGAGCAGAGGAAGTCGGG + Intergenic
1073748138 10:106493436-106493458 AACTCTGACAAGAGGAATGCGGG + Intergenic
1074088814 10:110227613-110227635 AACACTGAGCGGGGGAAAACCGG + Intronic
1074563468 10:114554888-114554910 GACACTGAACAGAGGGACCCTGG + Intronic
1075463451 10:122633676-122633698 AACAGTGAGGTGAGGAAAGCAGG - Intronic
1075638025 10:124043638-124043660 AACAGTGATCTGAGGACCGCAGG + Intronic
1076391093 10:130102868-130102890 AACACTGACCAGAAGAAAGGTGG - Intergenic
1076849306 10:133085426-133085448 AACAGTGAGCAGAGGGCCGGGGG + Intronic
1078410570 11:11113347-11113369 AACACTAATCAAAGGAATGCTGG - Intergenic
1081001657 11:37680802-37680824 AACTCTGGGCAGAAGAAGGCAGG + Intergenic
1085269224 11:75260415-75260437 AACACTGAGCAGAGATGCCCGGG + Intergenic
1085897375 11:80656043-80656065 AACACTGAACATAGGACCACTGG - Intergenic
1091306187 11:134537555-134537577 AAGAATGAGCAAAGGGACGCTGG - Intergenic
1091408630 12:224518-224540 GACAAGGAGCAGAGGAACACGGG + Intronic
1092162549 12:6324059-6324081 AAAACTGAGAAGAGGAAGGGAGG - Intronic
1092879738 12:12878803-12878825 AACACAGGGCAGAGGAAGACAGG - Intergenic
1093334246 12:17881336-17881358 AACACTAATCAAAGGAAAGCTGG + Intergenic
1096534797 12:52264532-52264554 AGAACTGATCAGAGGAACTCTGG + Intronic
1097509387 12:60517859-60517881 TACACTGAGCAGGGGAGGGCAGG - Intergenic
1098780892 12:74685359-74685381 CACACTGAACAAAGGAAAGCAGG + Intergenic
1100676333 12:96872476-96872498 AACACTGAACATAAGAAAGCTGG + Intronic
1101727215 12:107398059-107398081 AAAACAGAGCAGAGGAATGAAGG - Intronic
1101848712 12:108385310-108385332 CACCCTGACCAGAGGAATGCAGG - Intergenic
1107262355 13:38509239-38509261 AACACTGATCAAAAGAAAGCTGG - Intergenic
1108743662 13:53366567-53366589 ATCACTGAGGAGAGGAACGTGGG - Intergenic
1109200243 13:59422757-59422779 ATCCCTGAGAAGAGGAACTCGGG + Intergenic
1109810314 13:67504883-67504905 AACCATGAGCCAAGGAACGCAGG - Intergenic
1111382081 13:87469965-87469987 AAAACTGATCAAAGGAAAGCTGG + Intergenic
1111969458 13:94896253-94896275 ACCACTGAGCCGAGGAAGACAGG + Intergenic
1112207521 13:97339346-97339368 AAGACTGCGGAGAGGAACACGGG + Intronic
1118028252 14:61793166-61793188 AACACTGTCCAGATGAAAGCAGG - Intronic
1118611186 14:67541651-67541673 CACACTGAGCTGAGGAAGGCAGG + Intronic
1120707115 14:87756541-87756563 AAAACTGAGCAGAGGGATCCAGG + Intergenic
1122146882 14:99695937-99695959 AACACTAAGCATAAGAAAGCTGG - Intronic
1129029979 15:72610972-72610994 AACGGTGACCAGAGGAACCCAGG - Intergenic
1130544893 15:84848785-84848807 AACACTAATCAGATGAAAGCTGG + Intronic
1131101924 15:89698272-89698294 AACACTAATCAGAAGAAAGCTGG - Intronic
1132462172 16:61075-61097 AACACCGGGCAGACGAAGGCGGG + Intronic
1133524769 16:6593986-6594008 AACACTGGGCGGAGGGAGGCTGG - Intronic
1133955688 16:10441966-10441988 CACACTGAACAAAGGAAAGCAGG + Intronic
1135671763 16:24381704-24381726 AACACAGAACAGAGGAAAGCAGG + Intergenic
1139997280 16:70992790-70992812 TTCTCTGAGCAGAGGAACCCAGG + Intronic
1144232585 17:13222917-13222939 AACACTGAGAAGAGGGAATCTGG - Intergenic
1144707723 17:17380528-17380550 AACACTGAGCAGAGGTGAACAGG - Intergenic
1144838495 17:18171190-18171212 AACCTTGAGCAGAGGAGTGCTGG - Intronic
1144963118 17:19057715-19057737 AACACTGATCAAAAGAAAGCAGG - Intergenic
1144972041 17:19116810-19116832 AACACTGATCAAAAGAAAGCAGG + Intergenic
1146676520 17:34777097-34777119 TACACTGAGCAGAGAGAGGCAGG - Intergenic
1149586870 17:57795020-57795042 AACACTAAGCAAAAGAAAGCAGG + Intergenic
1150119490 17:62588317-62588339 AACACTGAGGAGTGGAAGCCGGG + Intronic
1150283457 17:63942774-63942796 AGCACTGAGCTGAGGCACTCGGG - Intronic
1150499582 17:65637655-65637677 AACACAGAGGAGGGGACCGCTGG - Intronic
1156051095 18:32935095-32935117 AAAACTGAGCAGAGGAGGTCTGG - Intergenic
1157325053 18:46662975-46662997 AACACTGAGTAGCTGAACCCAGG - Intergenic
1159479782 18:68974283-68974305 AACACTGAGCAGAGGAACGCTGG - Intronic
1159861909 18:73659673-73659695 AACACAGAGCAAAGGAACCAGGG + Intergenic
1160406724 18:78651564-78651586 AACACTGAGGACAGGATTGCAGG + Intergenic
1163476169 19:17527271-17527293 GCCCCTGAGCCGAGGAACGCAGG + Exonic
1164194875 19:22947612-22947634 AAAACTGCTCAGAGGCACGCTGG - Intergenic
1166011634 19:39947120-39947142 AAAACTGAGCAGATGAAGGAGGG - Intergenic
1167567346 19:50264983-50265005 AACACTGACCAAGGGAATGCAGG - Intronic
1167721670 19:51184132-51184154 AGGACTGAGCAGAGGGATGCGGG - Intergenic
1168334735 19:55591410-55591432 AACACTGGGGAGAGGGACGAGGG + Exonic
925430482 2:3787720-3787742 GACTCTGAGCAGAGGAATTCAGG - Intronic
925459248 2:4045441-4045463 ACCACTGAGGAGAGGAGCGAAGG - Intergenic
925589554 2:5495860-5495882 AACACTGAGCTAAGGAATGCTGG - Intergenic
925672100 2:6321696-6321718 AACACTGAACAGAAAAAGGCTGG + Intergenic
927061230 2:19423299-19423321 AATACTGACCAAAGGAAAGCTGG - Intergenic
927447957 2:23182072-23182094 ATCACTGAGCATAAGAACGCTGG + Intergenic
927561355 2:24076545-24076567 GGCCCTGAGCAGAGGAACCCGGG + Intronic
928401607 2:30982986-30983008 AACACTGAGGAGAGCACCCCCGG + Intronic
928873269 2:36006715-36006737 AACCCTGAGCCAAGGAATGCAGG - Intergenic
932097500 2:68864586-68864608 AAGATGGAGCAGAGGAAAGCAGG + Intergenic
935345076 2:102100252-102100274 AGTACAGAGCAGAGGAATGCAGG - Intronic
937850483 2:126628517-126628539 AACACTAATCAAAGGAAAGCTGG + Intergenic
938422883 2:131157790-131157812 ATCCCTGAGCAGAGCAAGGCTGG - Intronic
938773352 2:134519933-134519955 AAGACTGAGCAGATGAATGTGGG + Intronic
938821475 2:134964421-134964443 AAAGCAGAGCAGAGGAAGGCAGG - Intergenic
940056791 2:149521701-149521723 AACACTGATGATAGGAACACAGG + Intergenic
941520230 2:166533218-166533240 AACACTGAGCAGAGGGAGGGAGG - Intergenic
944202498 2:197122462-197122484 TACACTAAGCAGAGGAAAACTGG - Intronic
945621950 2:212150621-212150643 AACAGTGTGCTGAGGAACACAGG + Intronic
945722202 2:213431427-213431449 AACAGAGAGCAGAGGCAAGCAGG + Intronic
948118660 2:235512743-235512765 GCCACTGAGCAGAGGCAGGCAGG - Intronic
1169791009 20:9410681-9410703 ATCCCTGGGCAGAGGAACCCTGG - Intronic
1172267545 20:33629836-33629858 AACACAGAGCTGAGGAAAACGGG + Exonic
1172509387 20:35489790-35489812 AACTCTGAGTAGAGGAGAGCAGG + Intronic
1175000361 20:55621622-55621644 CACACTGAACAAAGGAAAGCAGG + Intergenic
1175969555 20:62677559-62677581 CCCACTGAGCAGAGGATGGCAGG + Intronic
1178186162 21:30223600-30223622 AACATTCAGCAGAGGTAAGCTGG + Intergenic
1179634130 21:42696583-42696605 GACACTGAGAAGAGGAAGGAAGG + Intronic
1180102237 21:45593953-45593975 AACACCAAGCAGAGGAACCACGG - Intergenic
1182403726 22:30105617-30105639 AACACTGACCAGAGGGACCTAGG + Intronic
1183540838 22:38428453-38428475 AACAGTGAGCATAGGAGGGCCGG - Intronic
1184063905 22:42104579-42104601 CACACTGAACAAAGGAAAGCAGG + Intergenic
1184065305 22:42115541-42115563 CACACTGAACAAAGGAAAGCAGG + Intergenic
1185010241 22:48308916-48308938 GACTCAGAGCAAAGGAACGCAGG + Intergenic
949476795 3:4454272-4454294 AACACTGAGCACAGGATCTGAGG + Intronic
950183259 3:10929579-10929601 CACACTCACCAGGGGAACGCTGG + Intronic
950400002 3:12762665-12762687 ACCACTAAGCAGAGGAAAGGAGG + Intronic
951037382 3:17948809-17948831 AAGAAAGAGCAGAGGAAGGCAGG - Intronic
953343937 3:42159755-42159777 AGCGCTGAGCAGAGGAAGGAAGG - Intronic
954957758 3:54537155-54537177 CACACAGAGCAGAGGATTGCAGG + Intronic
957427284 3:80054086-80054108 GACAAGGAGCAGAGGAAGGCAGG - Intergenic
957689426 3:83548622-83548644 TACCCTCAGCAAAGGAACGCAGG - Intergenic
960543126 3:118882505-118882527 AGTGCTGAGCAGAGGAACCCAGG - Intergenic
960908880 3:122629113-122629135 AACAGTGAGGAGAGGAAGACTGG + Intronic
961000175 3:123368780-123368802 AACAGTGAGCAGAGGAGGCCTGG - Intronic
961587089 3:127939929-127939951 AACACTGATCAAAAGAAAGCTGG + Intronic
961715311 3:128853661-128853683 AACACTGAAAAGAGGAGCTCAGG - Intergenic
962677782 3:137769174-137769196 AACACCCAGCAGAGGAGCGACGG - Intergenic
964699585 3:159550527-159550549 AACACTAAGCAAAAGAAAGCTGG - Intronic
964807641 3:160629171-160629193 AACACTGCGCAGAGGCATTCTGG - Intergenic
966201108 3:177360035-177360057 ATGACTGAGCAGAGGAGCGGGGG - Intergenic
968253995 3:197248581-197248603 CACACTGAACAAAGGAAAGCAGG + Intronic
968797028 4:2713719-2713741 AACACTCAGCAGAGGCAAGCGGG - Intronic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
971224631 4:24739608-24739630 AACACTGAGCAGATGGACAATGG - Intergenic
971545800 4:27884446-27884468 AACACTATGCAGAAGAAAGCTGG - Intergenic
973229769 4:47827989-47828011 AAGACTGATCAGAGGAAAGCTGG - Intronic
974234344 4:59161278-59161300 AACACCTAACAGAGGAATGCGGG + Intergenic
977545510 4:98371804-98371826 AACACTGATCAAAGGAAAACTGG - Intronic
977728751 4:100326892-100326914 ATCACTGGGCAGAGTAACGATGG + Intergenic
980164870 4:129213578-129213600 AAGACTGAGGAAAGGAACGGAGG - Intergenic
982128565 4:152205965-152205987 AAAACAGAGCAGAGGAACCCAGG + Intergenic
985071558 4:186170790-186170812 AACACTGAACAGAGGGACAGAGG + Intronic
988051980 5:26042383-26042405 AACACTGAGGAGAGGATTGAGGG - Intergenic
990051022 5:51501285-51501307 AACACTAAGCAAAAGAAAGCTGG - Intergenic
991309412 5:65219515-65219537 AACACTGATCAGAAGACAGCTGG + Intronic
992241528 5:74774700-74774722 AACCATGAGCAGAGGAAGGGAGG + Intronic
992252343 5:74887859-74887881 AACACTGAGGAGATTAACACTGG + Intergenic
997871362 5:137507997-137508019 AACACTCAGAAGTGGAATGCTGG + Intronic
998593895 5:143507476-143507498 GACACTGAGCATAGGGAGGCAGG - Intergenic
999177009 5:149638870-149638892 AGCACAGAGCAGAGCAAGGCAGG - Intergenic
1001739463 5:174039636-174039658 AACACTGACCAAAAGAAAGCTGG - Intergenic
1003361219 6:5427514-5427536 GAAACTGAGCAGAGGATCTCAGG + Intronic
1003715008 6:8636277-8636299 AACACTGGGCAGAGGAGTGGAGG - Intergenic
1004564361 6:16781669-16781691 AACACTCAGCAGAGAAACCGAGG - Intergenic
1007595736 6:43050211-43050233 AGCTCTGAGCAGAGGAATGGTGG - Intronic
1008886323 6:56434342-56434364 AACACTAACCAAAGGAAAGCTGG - Intergenic
1010001710 6:70955942-70955964 GCCACTGAGCAGCGCAACGCGGG - Exonic
1014964861 6:127735216-127735238 AAGACTGAGCAAATGAATGCGGG + Intronic
1017955184 6:159171175-159171197 ATCACTGTGCTGAGGAATGCTGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018435014 6:163751640-163751662 AACACTGAACAAAGGAAAGGAGG + Intergenic
1018573472 6:165234107-165234129 TAGACTGAGCAGAGGGATGCTGG - Intergenic
1019920746 7:4161759-4161781 AACACACAGGAGAGGAAAGCGGG - Intronic
1022603006 7:31779486-31779508 AACACTGAGTAAGGGAACTCTGG + Intronic
1022838003 7:34135327-34135349 AAGGCTGAGCAGGGGAGCGCAGG + Intronic
1022857342 7:34328304-34328326 AACACTCAGCAGACAAACGGTGG - Intergenic
1026470097 7:70687789-70687811 GGCACTGAGCAGAGGAACTGGGG + Intronic
1028616255 7:92770845-92770867 AACACTGGGTAGAGGAAAGTGGG + Intronic
1032329451 7:130963964-130963986 AACACTGAGCTTAGGAATTCTGG + Intergenic
1032380961 7:131480179-131480201 TTCACTGACCAGAGGAAAGCTGG - Intronic
1033653772 7:143360671-143360693 AACAGTGAGCAGAGAAACCAAGG + Intronic
1036110728 8:5898344-5898366 AACACTGAGTAGAAAAACACAGG + Intergenic
1039839006 8:41280269-41280291 AACAGGATGCAGAGGAACGCTGG + Intronic
1049799267 8:144510258-144510280 AACACTGAGGAGAGCAGGGCAGG + Intronic
1051529328 9:18082711-18082733 AACAGTGAGCAGAGGGACAATGG - Intergenic
1054859443 9:69933724-69933746 CACACTGAACAGAGGAAAGCAGG + Intergenic
1055580220 9:77700747-77700769 AACATTAATCAGAGGAAAGCAGG - Intergenic
1056473795 9:86932724-86932746 AACATTTAGCTGAGGAACCCAGG + Intergenic
1061659434 9:132118975-132118997 AACACTGTACAGAGCAAAGCAGG - Intergenic
1062087482 9:134656244-134656266 AACTCTGAGCAGAGGAGGGTGGG + Intronic
1185762860 X:2701545-2701567 AAGAATGAGCAGAGGAAACCAGG + Intronic
1187493610 X:19775693-19775715 GACACAGAGCAGAGGAGCGGTGG - Intronic
1188632392 X:32381335-32381357 AACACTGAGAACAGGAGCACAGG - Intronic
1193417152 X:81238572-81238594 CACACTGAGGAGAAGAACACAGG + Intronic
1198794975 X:140385057-140385079 ATCACTGAGCCAAGGAAGGCTGG - Intergenic
1200628692 Y:5554569-5554591 AACACTCAGCATGGGAACCCTGG - Intronic
1201191351 Y:11445733-11445755 AACACTGGGCACAGAAACACTGG - Intergenic