ID: 1159484539

View in Genome Browser
Species Human (GRCh38)
Location 18:69037882-69037904
Sequence TTTACCTCAAAGACCTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159484539_1159484543 16 Left 1159484539 18:69037882-69037904 CCCACCTAGGTCTTTGAGGTAAA 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1159484543 18:69037921-69037943 AAAAGCCTTGATCACACCTCAGG 0: 1
1: 0
2: 1
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159484539 Original CRISPR TTTACCTCAAAGACCTAGGT GGG (reversed) Intronic
905562936 1:38941678-38941700 TTACCCTGAAAGACCAAGGTAGG + Intronic
906843720 1:49167506-49167528 TAGAGCTCAAAGACCTAGGCAGG - Intronic
909817258 1:80011421-80011443 TTTCCTTCAAAGACGTAGGTTGG + Intergenic
910209083 1:84775460-84775482 GTTAGCTCAAAGAGCCAGGTGGG - Intergenic
910297878 1:85669835-85669857 TAGCCCTCAAAGAGCTAGGTGGG - Intronic
917299326 1:173556470-173556492 TTTACATTAAAGATCTAGTTAGG - Intronic
918663870 1:187123649-187123671 TTCACCTTAAAGACCCAGGCTGG - Intergenic
921681845 1:218042956-218042978 TTTAACTCAAAGTTCTAGGAAGG + Intergenic
922239097 1:223743873-223743895 TTTCCCTCAAAATACTAGGTTGG + Intronic
1071816888 10:89241222-89241244 CTTATCTCATAGACCCAGGTTGG - Intronic
1080333479 11:31169854-31169876 TGTCTCTCCAAGACCTAGGTTGG - Intronic
1080830490 11:35889378-35889400 TTCACCTCAAACACCCAGCTCGG + Intergenic
1085213894 11:74810393-74810415 TGGACCTGAAAGACCTATGTTGG + Intronic
1086374541 11:86186931-86186953 TTTACCTAGAAGTCCAAGGTTGG - Intergenic
1093819776 12:23599579-23599601 TTTCCGTCAAACACCAAGGTAGG + Intronic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1094422553 12:30286559-30286581 TTTACCTAAAAGATTTTGGTTGG + Intergenic
1095641440 12:44489928-44489950 TTTACCTCAAATTTTTAGGTTGG + Intergenic
1099370550 12:81824773-81824795 GCTACTTAAAAGACCTAGGTTGG + Intergenic
1106985750 13:35347060-35347082 CTCACCTCAAAGACATATGTAGG + Intronic
1110814566 13:79846999-79847021 TTTACAACAAAGACCTAGTCAGG + Intergenic
1113114732 13:106863270-106863292 TTTACCTAAATTACCTAAGTGGG - Intergenic
1118825556 14:69377255-69377277 TTAACCTCAAAGACCTTGAAGGG - Intergenic
1120532463 14:85648653-85648675 TTTTCCCTAAATACCTAGGTAGG + Exonic
1120691655 14:87599801-87599823 TTAACCTCAAAGACATATTTTGG + Intergenic
1120820339 14:88906295-88906317 TTTGCCTCACAGTACTAGGTAGG + Intergenic
1121981658 14:98459857-98459879 TTTTCATCCAAGACCTTGGTGGG + Intergenic
1128503557 15:68248349-68248371 CTTACATCTAAGACCTAGGCCGG + Intronic
1128998820 15:72316558-72316580 CCTACCTCAAAGCCCTAGGAGGG - Intronic
1131931721 15:97449821-97449843 TCTACTTCAAAGACCTAGGCAGG - Intergenic
1134397853 16:13881953-13881975 TCTTCCCCAAAGTCCTAGGTGGG + Intergenic
1135055183 16:19226254-19226276 ATTTCCTCAAACACCCAGGTAGG + Intronic
1137273428 16:46918040-46918062 TTAACCTCAAAGGCCAGGGTGGG + Intronic
1137930076 16:52578706-52578728 TTTCCCGCAAACACCTAAGTAGG - Intergenic
1138852786 16:60650137-60650159 TTTACATCAAAGCCCAAGATAGG + Intergenic
1139326079 16:66153532-66153554 TTTCTATCAATGACCTAGGTTGG - Intergenic
1141839584 16:86566247-86566269 TTTACCTCTAAAACCTCGATAGG + Intergenic
1203061216 16_KI270728v1_random:973519-973541 ATTACTTGAAAGACCTAGTTAGG + Intergenic
1149442590 17:56687343-56687365 TTTACCTCAAAGACATTTCTAGG + Intergenic
1153498399 18:5722811-5722833 TTTGCCTGAAAGTCCAAGGTGGG + Intergenic
1159484539 18:69037882-69037904 TTTACCTCAAAGACCTAGGTGGG - Intronic
1165535144 19:36438127-36438149 TTTACTTAAAAGACAAAGGTGGG + Intergenic
1166287831 19:41843241-41843263 TTGGCCTCAGAGACCCAGGTTGG + Intronic
925655518 2:6143962-6143984 TTCAAGTCAAAGACCTAGGCTGG + Intergenic
932614147 2:73221303-73221325 CTCACCTCAAAGCCCTAGCTTGG + Intronic
944857680 2:203784258-203784280 TTTAACCCAAAAAGCTAGGTGGG - Intergenic
946782903 2:223209898-223209920 TATACCTCAAAGAATTAGGAAGG + Intergenic
948223703 2:236292672-236292694 ATTACCTCAAAAACCCAAGTAGG + Intergenic
1168878462 20:1186265-1186287 ATCACCTAGAAGACCTAGGTGGG + Intronic
1179468270 21:41592863-41592885 TTGACCTCAAAGGCCTTGGGAGG + Intergenic
1180580465 22:16831344-16831366 TTTGCCTGAAATAACTAGGTGGG + Intergenic
1184627068 22:45743576-45743598 TTTCCCTTAAAGCCCTAGCTGGG - Intronic
954646380 3:52134101-52134123 TTTAGCTCACAGGTCTAGGTAGG - Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
955359467 3:58260671-58260693 TTCACCTCGCAGACCTAGGTGGG + Intronic
956538695 3:70309174-70309196 TGGACCTCAAAGACCGAGGTTGG + Intergenic
959276287 3:104281343-104281365 TTTGCCTTAAAGGCCTAGGAGGG - Intergenic
959753597 3:109868905-109868927 TATAGCTCAAAGACATATGTAGG + Intergenic
960678844 3:120225900-120225922 GTTACATCAAAGAACAAGGTAGG - Intronic
964283049 3:155087793-155087815 TTTGCCTCAGAGATCTAGGCAGG + Intronic
966890455 3:184403937-184403959 TTTACCCCACATACCCAGGTGGG - Intronic
969125060 4:4941218-4941240 TTTTCCTCACACTCCTAGGTTGG + Intergenic
972979763 4:44682150-44682172 TTGACCCCAAAGACATAAGTTGG + Intronic
973225820 4:47783122-47783144 TTTACCCAAAAGATCTTGGTTGG + Intronic
974714209 4:65645660-65645682 ATTACCTCAAAAAACTAGCTTGG + Intronic
978888406 4:113793967-113793989 TGCACCTCAAAGACCTAGAAAGG + Intergenic
979848466 4:125546540-125546562 GTGACCTCAAAGCCCTAGGCGGG + Intergenic
982606561 4:157523666-157523688 TTTCCCTCAGAGACCTATCTAGG + Intergenic
983305891 4:165986107-165986129 TTTACCTCAAAAAACAAAGTTGG - Intronic
985191324 4:187376514-187376536 TTTACTTTAAGAACCTAGGTTGG - Intergenic
988045714 5:25950401-25950423 TTTGCCTTAAACACCTACGTTGG + Intergenic
992051627 5:72946541-72946563 TTTACCTAAAGCACCTAGTTAGG + Intergenic
995159019 5:108953229-108953251 TTTACCTCATAGTCGTGGGTGGG + Intronic
995597582 5:113764363-113764385 TTTACTTCTCAGAACTAGGTAGG - Intergenic
996254593 5:121383771-121383793 TGTATCTCAAAGACTTACGTAGG + Intergenic
997820131 5:137057877-137057899 TTTATCTTTAAGAGCTAGGTTGG + Intronic
1002021485 5:176366548-176366570 TCCACCTCAAAGTCCTTGGTGGG - Exonic
1003179792 6:3781711-3781733 TTTACGGCAAAGACCCACGTTGG - Intergenic
1006956851 6:37881396-37881418 TTTAAATTAAAGACCTAGTTGGG + Intronic
1007913876 6:45542234-45542256 TTTCCCTCATAGACCTTGGGAGG + Intronic
1008375678 6:50788294-50788316 TTTACCTCAAGGATTTAGATGGG - Intergenic
1010451297 6:76006122-76006144 TTTTTCAAAAAGACCTAGGTGGG - Intronic
1017066283 6:150532103-150532125 TTTCCCTCAATGACTTAGATGGG - Intergenic
1022306072 7:29147665-29147687 TTCTCCTTAAAGAGCTAGGTGGG - Intronic
1024014898 7:45304835-45304857 TTTACATTAAATACCTAGATAGG + Intergenic
1025727559 7:64081325-64081347 TTTACCACAAAGGCCAGGGTGGG + Intronic
1025790422 7:64682627-64682649 TTGACCTCACAGTCCTAGGCTGG + Intronic
1026118297 7:67514803-67514825 TCTACCTCTAAGGCCTAGGCAGG + Intergenic
1027566363 7:79799942-79799964 TTGTCCTCAAAGTCCTAGATTGG + Intergenic
1029237641 7:99134503-99134525 TTTACCCCAAAGACCTAAGAGGG + Intronic
1030309412 7:108054348-108054370 TTTCCCTGAACTACCTAGGTGGG + Intronic
1030516258 7:110542242-110542264 TTTATCTAAAAGACCTAAGTAGG - Intergenic
1038120580 8:24609813-24609835 TTTTCCTCACAGACCTTGGAAGG + Intergenic
1039333014 8:36559816-36559838 TTTACCTCAATGACCCCAGTTGG + Intergenic
1040132738 8:43816200-43816222 TTTTCCCCAAAGACCTAAATGGG - Intergenic
1042339019 8:67659412-67659434 TTTAACTCAAATAAATAGGTTGG - Intronic
1047891905 8:129321921-129321943 TTTTCCACAAAGCCCTTGGTTGG - Intergenic
1048347640 8:133589019-133589041 TTTACCTCATAGTCCAAAGTTGG + Intergenic
1053184563 9:36004362-36004384 TTTTCCTGAAAGACCCAGCTGGG - Intergenic
1057688117 9:97254729-97254751 TTAACCTCAAAGACTTACATAGG - Intergenic
1188218006 X:27502423-27502445 TTTACCTGAAAGGCCTTGCTGGG - Intergenic
1191577859 X:62726502-62726524 TTTTCCTCACAGACCTCGATGGG + Intergenic
1197064038 X:122217517-122217539 ATTACCTCAAAGAACTAGGGTGG + Intergenic
1201361506 Y:13155957-13155979 TTTAACTCCAAAACCTATGTAGG + Intergenic