ID: 1159486816

View in Genome Browser
Species Human (GRCh38)
Location 18:69071763-69071785
Sequence CATTTTATGCAGACGCTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159486812_1159486816 20 Left 1159486812 18:69071720-69071742 CCTGCACATGGTCAGCTGAGAAA No data
Right 1159486816 18:69071763-69071785 CATTTTATGCAGACGCTCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159486816 Original CRISPR CATTTTATGCAGACGCTCGG AGG Intergenic
No off target data available for this crispr