ID: 1159494593

View in Genome Browser
Species Human (GRCh38)
Location 18:69185748-69185770
Sequence ATATTCCCATTTAAAATATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159494591_1159494593 22 Left 1159494591 18:69185703-69185725 CCATCTTATAATCATCACAACAA No data
Right 1159494593 18:69185748-69185770 ATATTCCCATTTAAAATATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159494593 Original CRISPR ATATTCCCATTTAAAATATA AGG Intergenic
No off target data available for this crispr