ID: 1159496650

View in Genome Browser
Species Human (GRCh38)
Location 18:69216198-69216220
Sequence TTCCATTTCAATAAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159496650_1159496653 16 Left 1159496650 18:69216198-69216220 CCTTCCTTCTTATTGAAATGGAA No data
Right 1159496653 18:69216237-69216259 CTATGGCTAGCGTTTGTTAATGG No data
1159496650_1159496652 -1 Left 1159496650 18:69216198-69216220 CCTTCCTTCTTATTGAAATGGAA No data
Right 1159496652 18:69216220-69216242 AAAGTATTAATATCAAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159496650 Original CRISPR TTCCATTTCAATAAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr