ID: 1159497655

View in Genome Browser
Species Human (GRCh38)
Location 18:69226467-69226489
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159497652_1159497655 7 Left 1159497652 18:69226437-69226459 CCTAATTTCATATCTAACACAAA No data
Right 1159497655 18:69226467-69226489 AGCCACTGGAAGATTGGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159497655 Original CRISPR AGCCACTGGAAGATTGGTGA TGG Intergenic