ID: 1159502126

View in Genome Browser
Species Human (GRCh38)
Location 18:69286788-69286810
Sequence CCCTCCCAGCACTGCCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159502120_1159502126 1 Left 1159502120 18:69286764-69286786 CCCAAATACTTCCCATGAGGCTG No data
Right 1159502126 18:69286788-69286810 CCCTCCCAGCACTGCCATGTTGG No data
1159502116_1159502126 10 Left 1159502116 18:69286755-69286777 CCCCTGTGACCCAAATACTTCCC No data
Right 1159502126 18:69286788-69286810 CCCTCCCAGCACTGCCATGTTGG No data
1159502115_1159502126 13 Left 1159502115 18:69286752-69286774 CCACCCCTGTGACCCAAATACTT No data
Right 1159502126 18:69286788-69286810 CCCTCCCAGCACTGCCATGTTGG No data
1159502121_1159502126 0 Left 1159502121 18:69286765-69286787 CCAAATACTTCCCATGAGGCTGC No data
Right 1159502126 18:69286788-69286810 CCCTCCCAGCACTGCCATGTTGG No data
1159502122_1159502126 -10 Left 1159502122 18:69286775-69286797 CCCATGAGGCTGCCCCTCCCAGC No data
Right 1159502126 18:69286788-69286810 CCCTCCCAGCACTGCCATGTTGG No data
1159502118_1159502126 8 Left 1159502118 18:69286757-69286779 CCTGTGACCCAAATACTTCCCAT No data
Right 1159502126 18:69286788-69286810 CCCTCCCAGCACTGCCATGTTGG No data
1159502117_1159502126 9 Left 1159502117 18:69286756-69286778 CCCTGTGACCCAAATACTTCCCA No data
Right 1159502126 18:69286788-69286810 CCCTCCCAGCACTGCCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159502126 Original CRISPR CCCTCCCAGCACTGCCATGT TGG Intergenic
No off target data available for this crispr