ID: 1159506952

View in Genome Browser
Species Human (GRCh38)
Location 18:69351032-69351054
Sequence TGAGCACCCACTATTTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159506952_1159506956 30 Left 1159506952 18:69351032-69351054 CCCTGGAAAATAGTGGGTGCTCA No data
Right 1159506956 18:69351085-69351107 TATTATGAATGATTTACTCAAGG No data
1159506952_1159506955 7 Left 1159506952 18:69351032-69351054 CCCTGGAAAATAGTGGGTGCTCA No data
Right 1159506955 18:69351062-69351084 TTATTGGCTGACTGAATTGAAGG No data
1159506952_1159506954 -9 Left 1159506952 18:69351032-69351054 CCCTGGAAAATAGTGGGTGCTCA No data
Right 1159506954 18:69351046-69351068 GGGTGCTCAAAAATATTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159506952 Original CRISPR TGAGCACCCACTATTTTCCA GGG (reversed) Intergenic