ID: 1159506952 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:69351032-69351054 |
Sequence | TGAGCACCCACTATTTTCCA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1159506952_1159506954 | -9 | Left | 1159506952 | 18:69351032-69351054 | CCCTGGAAAATAGTGGGTGCTCA | No data | ||
Right | 1159506954 | 18:69351046-69351068 | GGGTGCTCAAAAATATTTATTGG | No data | ||||
1159506952_1159506955 | 7 | Left | 1159506952 | 18:69351032-69351054 | CCCTGGAAAATAGTGGGTGCTCA | No data | ||
Right | 1159506955 | 18:69351062-69351084 | TTATTGGCTGACTGAATTGAAGG | 0: 1 1: 0 2: 0 3: 18 4: 221 |
||||
1159506952_1159506956 | 30 | Left | 1159506952 | 18:69351032-69351054 | CCCTGGAAAATAGTGGGTGCTCA | No data | ||
Right | 1159506956 | 18:69351085-69351107 | TATTATGAATGATTTACTCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1159506952 | Original CRISPR | TGAGCACCCACTATTTTCCA GGG (reversed) | Intergenic | ||