ID: 1159506953

View in Genome Browser
Species Human (GRCh38)
Location 18:69351033-69351055
Sequence TTGAGCACCCACTATTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159506953_1159506954 -10 Left 1159506953 18:69351033-69351055 CCTGGAAAATAGTGGGTGCTCAA No data
Right 1159506954 18:69351046-69351068 GGGTGCTCAAAAATATTTATTGG No data
1159506953_1159506956 29 Left 1159506953 18:69351033-69351055 CCTGGAAAATAGTGGGTGCTCAA No data
Right 1159506956 18:69351085-69351107 TATTATGAATGATTTACTCAAGG No data
1159506953_1159506955 6 Left 1159506953 18:69351033-69351055 CCTGGAAAATAGTGGGTGCTCAA No data
Right 1159506955 18:69351062-69351084 TTATTGGCTGACTGAATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159506953 Original CRISPR TTGAGCACCCACTATTTTCC AGG (reversed) Intergenic