ID: 1159506953 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:69351033-69351055 |
| Sequence | TTGAGCACCCACTATTTTCC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1159506953_1159506955 | 6 | Left | 1159506953 | 18:69351033-69351055 | CCTGGAAAATAGTGGGTGCTCAA | No data | ||
| Right | 1159506955 | 18:69351062-69351084 | TTATTGGCTGACTGAATTGAAGG | 0: 1 1: 0 2: 0 3: 18 4: 221 |
||||
| 1159506953_1159506954 | -10 | Left | 1159506953 | 18:69351033-69351055 | CCTGGAAAATAGTGGGTGCTCAA | No data | ||
| Right | 1159506954 | 18:69351046-69351068 | GGGTGCTCAAAAATATTTATTGG | No data | ||||
| 1159506953_1159506956 | 29 | Left | 1159506953 | 18:69351033-69351055 | CCTGGAAAATAGTGGGTGCTCAA | No data | ||
| Right | 1159506956 | 18:69351085-69351107 | TATTATGAATGATTTACTCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1159506953 | Original CRISPR | TTGAGCACCCACTATTTTCC AGG (reversed) | Intergenic | ||