ID: 1159506954

View in Genome Browser
Species Human (GRCh38)
Location 18:69351046-69351068
Sequence GGGTGCTCAAAAATATTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159506953_1159506954 -10 Left 1159506953 18:69351033-69351055 CCTGGAAAATAGTGGGTGCTCAA No data
Right 1159506954 18:69351046-69351068 GGGTGCTCAAAAATATTTATTGG No data
1159506952_1159506954 -9 Left 1159506952 18:69351032-69351054 CCCTGGAAAATAGTGGGTGCTCA No data
Right 1159506954 18:69351046-69351068 GGGTGCTCAAAAATATTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159506954 Original CRISPR GGGTGCTCAAAAATATTTAT TGG Intergenic