ID: 1159506955 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:69351062-69351084 |
| Sequence | TTATTGGCTGACTGAATTGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1159506953_1159506955 | 6 | Left | 1159506953 | 18:69351033-69351055 | CCTGGAAAATAGTGGGTGCTCAA | No data | ||
| Right | 1159506955 | 18:69351062-69351084 | TTATTGGCTGACTGAATTGAAGG | No data | ||||
| 1159506952_1159506955 | 7 | Left | 1159506952 | 18:69351032-69351054 | CCCTGGAAAATAGTGGGTGCTCA | No data | ||
| Right | 1159506955 | 18:69351062-69351084 | TTATTGGCTGACTGAATTGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1159506955 | Original CRISPR | TTATTGGCTGACTGAATTGA AGG | Intergenic | ||