ID: 1159509119

View in Genome Browser
Species Human (GRCh38)
Location 18:69373455-69373477
Sequence AAGGAGATCTTCAGCAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159509114_1159509119 11 Left 1159509114 18:69373421-69373443 CCTTCAGACTGAAGGGAAGCTAT No data
Right 1159509119 18:69373455-69373477 AAGGAGATCTTCAGCAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159509119 Original CRISPR AAGGAGATCTTCAGCAATGG AGG Intergenic
No off target data available for this crispr