ID: 1159509933

View in Genome Browser
Species Human (GRCh38)
Location 18:69383603-69383625
Sequence TAAGTATGCAAAAGCACCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159509933_1159509935 24 Left 1159509933 18:69383603-69383625 CCTAAGGTGCTTTTGCATACTTA No data
Right 1159509935 18:69383650-69383672 TTATACAGCTATCTGTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159509933 Original CRISPR TAAGTATGCAAAAGCACCTT AGG (reversed) Intergenic
No off target data available for this crispr