ID: 1159509935

View in Genome Browser
Species Human (GRCh38)
Location 18:69383650-69383672
Sequence TTATACAGCTATCTGTGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159509934_1159509935 -2 Left 1159509934 18:69383629-69383651 CCAATAACTATTTTCATTTCTTT No data
Right 1159509935 18:69383650-69383672 TTATACAGCTATCTGTGTTCAGG No data
1159509932_1159509935 25 Left 1159509932 18:69383602-69383624 CCCTAAGGTGCTTTTGCATACTT No data
Right 1159509935 18:69383650-69383672 TTATACAGCTATCTGTGTTCAGG No data
1159509933_1159509935 24 Left 1159509933 18:69383603-69383625 CCTAAGGTGCTTTTGCATACTTA No data
Right 1159509935 18:69383650-69383672 TTATACAGCTATCTGTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159509935 Original CRISPR TTATACAGCTATCTGTGTTC AGG Intergenic
No off target data available for this crispr