ID: 1159518360

View in Genome Browser
Species Human (GRCh38)
Location 18:69487426-69487448
Sequence AAATCTGCCCCCAGTGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159518360 Original CRISPR AAATCTGCCCCCAGTGTGTG AGG Intronic
901765181 1:11495492-11495514 AAAACTGCCCCCAGAATCTGGGG + Intronic
902598686 1:17526295-17526317 AAACCTGCCCCTAGTCTGTGTGG + Intergenic
903605735 1:24573897-24573919 AGATCCGCTCCCAGTGTGGGCGG + Intronic
904279207 1:29406950-29406972 AAATCTACGCCCAGTGCCTGAGG + Intergenic
904461773 1:30684997-30685019 AATTGAGCACCCAGTGTGTGTGG - Intergenic
905631914 1:39523518-39523540 ATATGTGCGCACAGTGTGTGGGG + Intronic
907936513 1:59046823-59046845 AAATCTCCCTCCTGTGGGTGTGG + Intergenic
909451977 1:75807839-75807861 AAATCTGCCCTTAGTGTTGGTGG + Intronic
913252214 1:116920973-116920995 AAATGTGCCCCTAGTATTTGGGG + Intronic
914455874 1:147835799-147835821 AAACCTGTCCCCAGAGTCTGAGG + Intergenic
915304442 1:154969649-154969671 AACTCTCTCCCCAGTGTGTGAGG - Intronic
916257720 1:162807136-162807158 ACAACAGGCCCCAGTGTGTGAGG + Intronic
919040977 1:192387942-192387964 AAATCTGCCCTCAATGTGGGCGG - Intergenic
920885855 1:209927292-209927314 AATTTTGCCCCCAGTTTGTAGGG + Intergenic
921071366 1:211660905-211660927 AGATCTGTCCCCAGTGGGTGAGG + Intronic
921620069 1:217315587-217315609 AGATCTGCCCTCAATGTGGGTGG + Intergenic
922481428 1:225942052-225942074 CAATCTGCCCCCAGTACCTGTGG - Intergenic
922481640 1:225943431-225943453 CAATCTGCCCCCAGTACCTGTGG + Intergenic
923106371 1:230856987-230857009 GCATTTGCCCCCAGTGTCTGAGG - Intronic
1063824168 10:9875536-9875558 AAATCTGCCCTCAATATGGGCGG - Intergenic
1066724167 10:38372816-38372838 ACAACAGGCCCCAGTGTGTGAGG + Intergenic
1067179609 10:43974617-43974639 AAATCTGACCCCTGTGGGTAGGG - Intergenic
1067406165 10:46025332-46025354 AAATCCACCCTCAGTGTGTGTGG - Intronic
1067414709 10:46094520-46094542 TAATCTGCCCCAAGTGAGTTGGG - Intergenic
1067891111 10:50136742-50136764 AAATGTGACCCCAGTGTTGGAGG + Intergenic
1069639781 10:69947191-69947213 AAACCTGTCTCCAGTGAGTGAGG + Intronic
1071742195 10:88372138-88372160 ACATCTGCCCCCAGTATGGCAGG - Intronic
1073885918 10:108039577-108039599 AAATATGACCCAAGTGTGTGGGG + Intergenic
1074443469 10:113498748-113498770 CAATCTGCCCCAACTGGGTGTGG - Intergenic
1076763693 10:132618941-132618963 AAATGTGTCCCCAGTGTTAGAGG - Intronic
1081262223 11:40974734-40974756 AAAACTGCCTGCAGTGTGAGTGG + Intronic
1082053391 11:47791920-47791942 ACAGCTGCCCCCAGTGAGTCAGG - Exonic
1082194047 11:49280442-49280464 AGATCTACCCTCAATGTGTGTGG - Intergenic
1082913370 11:58402924-58402946 AAATGTGTCCCCAGTGTGGATGG + Exonic
1084665696 11:70575020-70575042 AAATGTGCCCTTTGTGTGTGTGG - Intronic
1084679902 11:70660892-70660914 ACATCCGCCCACTGTGTGTGTGG - Intronic
1085409396 11:76282388-76282410 AGCTCTGCCCACAGTGTGGGAGG + Intergenic
1085411786 11:76295681-76295703 AAACCTGTCCCCAGTGTCCGAGG - Intergenic
1086672105 11:89560599-89560621 AGATCTGCCCTCAATGTGTGTGG + Intergenic
1086771676 11:90774876-90774898 ACATCTTTCCTCAGTGTGTGGGG - Intergenic
1087688314 11:101290370-101290392 AGATCTGCCCTCAATGTGGGTGG + Intergenic
1090154183 11:124420136-124420158 AAACCTGCCCTCAATGTGAGTGG - Intergenic
1090258005 11:125299279-125299301 AAATGTGACCCCAGTGTCGGAGG - Intronic
1090590236 11:128259497-128259519 AAAGCTGGCCTCAGTGTGTGTGG + Intergenic
1091103795 11:132899745-132899767 AGATCTGCCCTCACTGTATGTGG + Intronic
1092318774 12:7448354-7448376 TAATCTGCTCCCCTTGTGTGTGG - Intronic
1094423333 12:30295236-30295258 CAATCTGCCCTCAGTGTTTATGG + Intergenic
1100339321 12:93663314-93663336 AGATCTGCCCTCAATGTGGGTGG + Intergenic
1100351540 12:93788453-93788475 ACACCTGACCACAGTGTGTGTGG + Intronic
1101789503 12:107914109-107914131 ATATCTGCCCCTGGTGTGTCCGG + Intergenic
1102592675 12:113968866-113968888 CAGGATGCCCCCAGTGTGTGTGG - Intergenic
1102708853 12:114907605-114907627 AGATCTGGACCCATTGTGTGTGG - Intergenic
1103900511 12:124301416-124301438 AAAGCTGCCCCCAGTCTGTCTGG - Intronic
1107390040 13:39954164-39954186 AATTCTGGTCCCTGTGTGTGAGG - Intergenic
1107994158 13:45844296-45844318 AAAGCTGCCCTCAGTGTTGGTGG + Intronic
1109239152 13:59862373-59862395 AAAGCTCCCTCCAGTGAGTGTGG + Intronic
1112128137 13:96492542-96492564 AAATGTAGCCCCAGTGTCTGCGG + Intronic
1112341659 13:98557508-98557530 AACTGTGCCACCAGTGGGTGGGG - Intronic
1113310914 13:109131799-109131821 AAGGCTGCACCCGGTGTGTGAGG - Intronic
1114985721 14:28226093-28226115 AGATCTGCCCTCAGTGTGGGTGG - Intergenic
1115551362 14:34508129-34508151 AGATCTGCCCTCAGTGTTGGTGG - Intergenic
1116979306 14:51151025-51151047 AAATCTGTCCCCAGTGTTGATGG + Intergenic
1119179737 14:72597824-72597846 AAATCAGCCCCCAGAGAGAGAGG + Intergenic
1119339579 14:73865425-73865447 AGATCTGCCCTCAATGTGGGTGG - Intronic
1121788480 14:96680851-96680873 AAATGTGTCCCCAGAGGGTGTGG + Intergenic
1122216209 14:100206363-100206385 ATTTCTGCCCCCAGGGTATGGGG - Intergenic
1122786163 14:104164193-104164215 AAAACTGACCCCAGTGTGGAAGG - Intronic
1124610410 15:31204151-31204173 AGATCTGCCCTCGATGTGTGTGG - Intergenic
1125875539 15:43140871-43140893 AGATCTGTCCCCAGTGGGTGAGG + Intronic
1127574925 15:60282256-60282278 ACATCTTCCTCCACTGTGTGAGG + Intergenic
1128080893 15:64856301-64856323 AGATCTGCCACCTGTGTGTCTGG + Intronic
1129192651 15:73946542-73946564 ACAGCTGCCACCAGTGAGTGGGG + Exonic
1129680643 15:77656710-77656732 GAAGCTGCCCCCAGTGTGTTAGG + Intronic
1129988942 15:79944847-79944869 AGATCTGTCCCCAGCGGGTGAGG - Intergenic
1130896085 15:88171452-88171474 GATTCTGCCCCCTGTATGTGGGG - Intronic
1130980546 15:88809268-88809290 GCATCTCCCTCCAGTGTGTGTGG + Intronic
1131350359 15:91694067-91694089 ATATCTCCCCCCAGTGAGAGAGG + Intergenic
1131962979 15:97808539-97808561 AAACTAGCCCCCACTGTGTGTGG - Intergenic
1132351346 15:101141565-101141587 TTATATGCCCCCAGTGTGAGAGG + Intergenic
1132826608 16:1908403-1908425 ACATCTGCCCTCCGTGTGTTCGG + Intergenic
1134591139 16:15454399-15454421 AATTCTGTCCCCAGTGGATGGGG - Intronic
1135951564 16:26919081-26919103 AAGTCTGCCCTCTGTATGTGTGG - Intergenic
1136105349 16:28026167-28026189 CAAGGTGCCCCCAGTCTGTGGGG - Intronic
1138764838 16:59589909-59589931 AGATCTGCCCTCAGTCTGGGTGG + Intergenic
1140329344 16:74038385-74038407 AAAACTGCCCACAATGTGTTAGG + Intergenic
1142837371 17:2597077-2597099 AAATCACCACTCAGTGTGTGGGG - Intronic
1146696054 17:34909740-34909762 AACTCTGCCCCCACTGGGTGTGG - Intergenic
1146896325 17:36544782-36544804 AAATTTGCGCCCAGAGGGTGCGG - Intergenic
1147031589 17:37642217-37642239 AAGTCTGTCCCAGGTGTGTGTGG - Exonic
1147402967 17:40191951-40191973 AAAGATGCCCCCACTGAGTGTGG - Intronic
1150497000 17:65615540-65615562 AAATCTGACCCAAGTCTGTGTGG - Intronic
1151461971 17:74259866-74259888 GACGCTGCCCCCAGTGTGAGGGG + Intronic
1152754171 17:82080205-82080227 AAAGCTGACCCCAGGCTGTGAGG - Exonic
1152893262 17:82895155-82895177 ATGTCTTCCCCCAGTGTGTTTGG + Intronic
1154218091 18:12430078-12430100 CCATCTGTCCCCCGTGTGTGTGG + Intronic
1158038857 18:53068883-53068905 AAACCTGCCCCCAGTGTCTGAGG + Intronic
1159219081 18:65436627-65436649 AGTGCTGCCCCCAGTGTGAGAGG - Intergenic
1159518360 18:69487426-69487448 AAATCTGCCCCCAGTGTGTGAGG + Intronic
1162736143 19:12748154-12748176 AACTCTGCCCCGAGGGGGTGGGG - Exonic
1163354048 19:16798110-16798132 AAATCTGCCCCCAAGGTTTGAGG - Intronic
1164611756 19:29637096-29637118 AAAACTGCTCCCGGGGTGTGGGG + Intergenic
1167740858 19:51324213-51324235 AAATCAGCTCCCAAGGTGTGGGG - Intronic
925831684 2:7902680-7902702 ATTTCTGCCCCCACTGTGTAGGG + Intergenic
926123239 2:10256107-10256129 TCATCTGGCCCCGGTGTGTGAGG + Intergenic
926197491 2:10772683-10772705 AAACATGCCCCGAGGGTGTGAGG + Intronic
926331044 2:11825460-11825482 ATATCTCCCCCCAGTTTTTGTGG + Intronic
926808922 2:16739198-16739220 AAATGTGACCCCAGTGTTGGAGG - Intergenic
927242770 2:20933021-20933043 AAATCTGGCCAAAGTGTCTGTGG - Intergenic
927284440 2:21341880-21341902 AAAACAGTCCCCAGTGTGTGAGG - Intergenic
930589748 2:53313022-53313044 AGATCTGCCTTCAGTGTGGGCGG - Intergenic
931631383 2:64304238-64304260 AGATCTGCCCCCAGTGTTGATGG - Intergenic
931798651 2:65736804-65736826 AAATCTTCCCCCAGTGTGAGTGG + Intergenic
932388342 2:71359486-71359508 AGATCTGCCCTCAATGTGGGCGG - Intronic
933261766 2:80139141-80139163 AAATCTTCCTCCAGAGTCTGTGG - Intronic
933494925 2:83038019-83038041 AACTCTGCCACCATTCTGTGTGG - Intergenic
933660056 2:84920320-84920342 AGATCTGCCCTCAGTGTGGGCGG + Intergenic
935734880 2:106098456-106098478 AGATTTGCTCCCAGTGTTTGAGG - Intronic
936476434 2:112843969-112843991 GCATTTGCCCCAAGTGTGTGTGG - Intergenic
938943866 2:136193006-136193028 AGATCTGCCCTCAATGTGGGTGG - Intergenic
942322271 2:174746071-174746093 AGATCTGTCCTCAGTGTGGGTGG + Intergenic
945537475 2:211036362-211036384 AAATCTGGCAGCAGTGGGTGGGG + Intergenic
945700708 2:213167849-213167871 TGATCTGCACCCACTGTGTGTGG + Intergenic
946620339 2:221555156-221555178 ACCTCTGCCCCCAGTGTGGCTGG - Intronic
947365875 2:229394458-229394480 AAACCTGCCCCCAAAGTCTGAGG - Intronic
948231559 2:236352541-236352563 AAATCTGCCCTTAGAGTTTGTGG + Intronic
948706879 2:239800121-239800143 CATTCTGCCTCCAGTGAGTGGGG - Exonic
1170880531 20:20293016-20293038 AAATCTGCCACCAGTGAGGTGGG + Intronic
1170895761 20:20412917-20412939 AAATCTTCCCCTTTTGTGTGTGG + Intronic
1170913094 20:20594366-20594388 AAATCTGCTCTCATTCTGTGGGG + Intronic
1171403000 20:24891703-24891725 AAATCTGCCCGCAGTGTTAAGGG + Intergenic
1173141843 20:40491617-40491639 AATCCTGCCACCAGTGAGTGGGG - Intergenic
1173730421 20:45324678-45324700 CAACCTGCCCCTAGTGTGTCTGG - Intergenic
1174946654 20:54993707-54993729 AGATCTGCCCTCAGTGTTGGTGG + Intergenic
1176171597 20:63698839-63698861 ACCTCTGCCCCCAGTGGCTGTGG + Exonic
1181089616 22:20463661-20463683 AGTTGTGCCCCCAGTGGGTGTGG - Intronic
1181396513 22:22626871-22626893 AAACCTGCACCCCATGTGTGGGG + Intergenic
1183786135 22:40030185-40030207 AATTCTGCCCCCACTGCGGGAGG - Exonic
1185038942 22:48494634-48494656 TGATCTGCCCCCAGTGTGGATGG + Intronic
1185179502 22:49350930-49350952 GAAGCTGCCCTCTGTGTGTGAGG - Intergenic
951295317 3:20926457-20926479 AAATGTGACCCCAGTGTTGGAGG - Intergenic
954787683 3:53106505-53106527 AAATCTGCCCCATGTTTGTGTGG - Intronic
955475182 3:59329085-59329107 AAGTCTGGCCCCAGAGTCTGTGG - Intergenic
956631368 3:71319896-71319918 AAATGTGCCTCCAGAGTGTTTGG - Intronic
956701933 3:71966408-71966430 AATGCTGCCCCCAGTGAATGTGG + Intergenic
957309460 3:78500965-78500987 AAATCTGATCCCAGTGTTGGAGG + Intergenic
958871006 3:99559146-99559168 ACAACAGGCCCCAGTGTGTGGGG - Intergenic
960051415 3:113242298-113242320 AAATCTACCCACAGTGTGGGGGG - Intronic
963654096 3:148023856-148023878 AAATCTTTCCCCAGTGAGTGTGG + Intergenic
963754781 3:149223710-149223732 AAAAATGCCCCCCGTCTGTGTGG - Intergenic
966859836 3:184224534-184224556 AGATCTGCCCTCATTGTGGGAGG - Intronic
969008048 4:4037566-4037588 AAAGCTGTCCCCAGTGTTAGAGG + Intergenic
969543710 4:7810430-7810452 AAAGCAGCCCCAAGTGTCTGAGG + Intronic
970612473 4:17738715-17738737 AAATTTGACCCCAGTGTTGGAGG + Intronic
972898464 4:43653753-43653775 AAATCTTCTCCCTTTGTGTGTGG + Intergenic
976204681 4:82613489-82613511 AGATCTACCCTCAGTGTGGGTGG - Intergenic
980627222 4:135389319-135389341 AAATGTGACCCCAGTGTTGGAGG + Intergenic
982285062 4:153725451-153725473 AAATGGGTCACCAGTGTGTGCGG - Intronic
982632271 4:157845782-157845804 AATTCTGCCCTCATTCTGTGAGG + Intergenic
982898238 4:160961929-160961951 AAGTCTGCCCTCCGTGTCTGTGG + Intergenic
984991430 4:185385174-185385196 AAATCTTCCCGCCGTTTGTGTGG + Intronic
985199503 4:187470532-187470554 AAATCTCACCCCAGTGTTGGAGG + Intergenic
986524750 5:8662168-8662190 AAATCCACCCTCAGTGTGGGTGG + Intergenic
988792431 5:34620839-34620861 AAATCTTCCCACAGTGTCTCTGG - Intergenic
990733623 5:58836028-58836050 AAATCTGTCCCCTGTGAGTTTGG - Intronic
990992814 5:61701821-61701843 AAATCTGCCCCCAGCATCCGAGG + Intronic
991369387 5:65902631-65902653 ATATCTGCCCTCAGTGTGGGTGG + Intergenic
993245110 5:85441072-85441094 AAATCTTCCCCTATTGAGTGAGG + Intergenic
993497694 5:88626388-88626410 AAAAATGCTCACAGTGTGTGTGG - Intergenic
993725484 5:91362024-91362046 AAATCTGCCTCCACTGTTTTAGG - Intergenic
995790939 5:115885593-115885615 AAACCTGCCCTCAATGTGGGTGG - Intronic
996754192 5:126919135-126919157 AATTCTGCTCCCAATCTGTGTGG + Intronic
997768715 5:136532070-136532092 AGATCTGCCCTGAATGTGTGTGG + Intergenic
998133251 5:139661613-139661635 TGATCAGGCCCCAGTGTGTGGGG - Intronic
998593480 5:143502411-143502433 AGATCTGCCCTCAGTGTTGGTGG + Intergenic
999237695 5:150108968-150108990 AAATCTGCCACCACTGTGTAGGG - Intronic
1000008180 5:157207254-157207276 AGATCTGCCCTCAGTGTTGGTGG - Intronic
1002337348 5:178489146-178489168 AGATCTGCCCTCAATGTGGGTGG + Intronic
1003314218 6:4997282-4997304 AGATCTGCCCTCACTGTGGGTGG + Intronic
1003383377 6:5645469-5645491 AAACCTGGCCCGACTGTGTGTGG - Intronic
1005367188 6:25090384-25090406 CTATCTGCCCCCATTTTGTGGGG - Intergenic
1006400062 6:33812582-33812604 AAATGTGTCCCCAGTCTCTGGGG - Intergenic
1009140501 6:59600347-59600369 AAATGTTCCACCCGTGTGTGGGG - Intergenic
1011850944 6:91628207-91628229 AGATCTGCCCTCAGTGTGGGTGG + Intergenic
1011991581 6:93526327-93526349 AAATCATCCCACTGTGTGTGTGG + Intergenic
1014152024 6:118068165-118068187 AGATCTGCCCTCACTGTGGGCGG - Intronic
1015555773 6:134459869-134459891 AAACCTGGGGCCAGTGTGTGTGG - Intergenic
1018718767 6:166556261-166556283 GAATTTGCACCCAGTGGGTGAGG - Intronic
1018794842 6:167177707-167177729 AGATTTGCCCCCCGAGTGTGAGG - Intronic
1018850561 6:167587593-167587615 ATTTCTGCCAACAGTGTGTGAGG - Intergenic
1020328569 7:6995697-6995719 AAAGCTGTCCCCAGTGTTAGAGG + Intergenic
1021171839 7:17406702-17406724 AAATCTGCCTTCAGTGTGGATGG + Intergenic
1024142941 7:46480587-46480609 ACATCTGCCCCACATGTGTGTGG + Intergenic
1024369326 7:48562005-48562027 TAAGCAGCCCCCAGTGTTTGAGG + Intronic
1028405440 7:90468974-90468996 CAATCTTGCCCCAGTATGTGTGG - Intronic
1029519080 7:101048771-101048793 AGATCTGCCCCCAGCCTGGGTGG - Intronic
1030680094 7:112425354-112425376 AGATCTGCCCTCAATGTGGGTGG + Intronic
1033984964 7:147213982-147214004 AGATCTGCCCTCAGTGTGTCTGG - Intronic
1034523538 7:151639501-151639523 AGATCTGCCTCCAGTGTGGGCGG + Intronic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1036128061 8:6082054-6082076 AGACCTGCCCTCAGTGTGGGTGG + Intergenic
1036249394 8:7148613-7148635 AAAGCTGTCCCCAGTGTTAGAGG + Intergenic
1036368055 8:8138432-8138454 AAAGCTGTCCCCAGTGTTAGAGG - Intergenic
1036882829 8:12527215-12527237 AAAGCTGTCCCCAGTGTTAGAGG + Intergenic
1039417673 8:37409540-37409562 AGACCTGCCCTCAGTGTGGGGGG + Intergenic
1039786132 8:40835633-40835655 AAATCTGCCCTCAATCTGTCTGG - Intronic
1041485132 8:58367985-58368007 CAATATACACCCAGTGTGTGTGG - Intergenic
1041709870 8:60884703-60884725 ACATCAGTCCCCAGAGTGTGAGG - Intergenic
1044337483 8:91004360-91004382 AGATCTGCCCTCAATGTGAGTGG - Intronic
1045002975 8:97894200-97894222 AATTCTTCCAGCAGTGTGTGTGG - Intronic
1045573221 8:103391395-103391417 AGATCTGCCCTCAGTGTGGGTGG - Intergenic
1046646893 8:116794996-116795018 AAAACAGGCCCCAGTGTATGTGG + Intronic
1048289965 8:133173676-133173698 AGATCTGCCCTCAGTGTTAGTGG - Intergenic
1050178235 9:2891949-2891971 ATGTCTGCCCTCAGTGTGGGTGG + Intergenic
1050577298 9:7010592-7010614 AAAGCTGCACCCAGTGTCTAGGG - Intronic
1050858627 9:10395264-10395286 ACAACAGGCCCCAGTGTGTGAGG + Intronic
1051562205 9:18454370-18454392 AGATCTGCCCTCAATGTGGGTGG - Intergenic
1052448212 9:28591136-28591158 ACAACAGGCCCCAGTGTGTGAGG - Intronic
1056551979 9:87659840-87659862 CACTGTGCCCCCGGTGTGTGCGG - Intronic
1057043010 9:91860758-91860780 AGATCTGCCCTCAATGTGAGTGG - Intronic
1057351291 9:94300847-94300869 ACCTGTGCCCCCAGTGTGGGCGG + Exonic
1058128057 9:101219267-101219289 AATTCTGCCCCAAGTGTAGGAGG + Intronic
1058759582 9:108118105-108118127 AAATGTGCCCCCATTGTAAGTGG - Intergenic
1061293138 9:129663698-129663720 AGTGCTGCCCACAGTGTGTGTGG - Intergenic
1062442975 9:136579300-136579322 ATTTCAGCACCCAGTGTGTGGGG - Intergenic
1185672609 X:1824705-1824727 AAATCTGTCTCCAGTGTTGGAGG - Intergenic
1185673145 X:1827206-1827228 AAATCTCGCCCCAGTGTTGGAGG - Intergenic
1185673156 X:1827263-1827285 AAATCTCGCCCCAGTGTTGGAGG - Intergenic
1186510932 X:10129318-10129340 AAATCTGCCCTCTGTGTCTATGG + Intronic
1188308363 X:28586497-28586519 AAATCTTCCCTAAGTGAGTGGGG - Intergenic
1189948438 X:46203948-46203970 AGCTCTGCCCCCAGTCTCTGGGG + Intergenic
1195532119 X:105969116-105969138 TAAACTGCCCCTAGGGTGTGGGG - Intergenic
1195835568 X:109111301-109111323 ATAACAGGCCCCAGTGTGTGAGG + Intergenic
1197678676 X:129358804-129358826 ATGGCTGCCCCCAGTGTGGGTGG - Intergenic
1198055131 X:132986378-132986400 GAATTTTCCCCCAGTGTGTGAGG + Intergenic
1199134413 X:144233962-144233984 AAATCTGCACCCTGTCTATGTGG + Intergenic