ID: 1159518598

View in Genome Browser
Species Human (GRCh38)
Location 18:69489370-69489392
Sequence CCAGTGATGGACCATGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 556}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159518591_1159518598 6 Left 1159518591 18:69489341-69489363 CCAAGTACTGAAGGTCCATCATC 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1159518598 18:69489370-69489392 CCAGTGATGGACCATGGGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 556
1159518592_1159518598 -9 Left 1159518592 18:69489356-69489378 CCATCATCTTCCTACCAGTGATG 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1159518598 18:69489370-69489392 CCAGTGATGGACCATGGGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 556
1159518590_1159518598 12 Left 1159518590 18:69489335-69489357 CCACTTCCAAGTACTGAAGGTCC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1159518598 18:69489370-69489392 CCAGTGATGGACCATGGGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159518598 Original CRISPR CCAGTGATGGACCATGGGCC AGG Intronic
900543699 1:3216899-3216921 CCAGGGAGGGACCAGGAGCCTGG - Intronic
901019217 1:6247518-6247540 CAAGTGGAGGACCCTGGGCCTGG - Exonic
901101733 1:6724358-6724380 CCAATGTTGGAAGATGGGCCTGG - Intergenic
901107189 1:6765682-6765704 CCAGTGTTGGAAGAGGGGCCTGG + Intergenic
902467335 1:16626279-16626301 TCAGTGAGGCACCCTGGGCCCGG - Intergenic
902712112 1:18247509-18247531 CCAGCCAGGAACCATGGGCCAGG + Intronic
902800114 1:18824270-18824292 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
902855675 1:19202772-19202794 CAATTGATGAAACATGGGCCGGG + Intronic
902901076 1:19516577-19516599 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
904384176 1:30130841-30130863 CCAGTGTTGGAGAAGGGGCCTGG - Intergenic
905361300 1:37422782-37422804 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
906118955 1:43374784-43374806 CCAGTACTGGTCCATGGCCCAGG + Intergenic
906371043 1:45254175-45254197 ACAGAGATGAACCATAGGCCGGG + Intronic
906903628 1:49865018-49865040 CCAGTGATGAAGGATGGGTCTGG - Intronic
908094496 1:60722333-60722355 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
908838181 1:68249770-68249792 CCAGTGTTGGAGAAGGGGCCTGG - Intergenic
909042401 1:70669983-70670005 CCAGTGTTGGACGTGGGGCCTGG + Intergenic
909525070 1:76613573-76613595 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
909827388 1:80143100-80143122 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
910203692 1:84725911-84725933 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
910357759 1:86378903-86378925 CCAGTGTTGGAGCTGGGGCCTGG + Intronic
910460512 1:87443967-87443989 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
911166259 1:94727236-94727258 CAGGTGAGGGACCATGGGCGGGG - Intergenic
911529892 1:99031990-99032012 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
912942796 1:114059833-114059855 CCAGTGGTGGAGGAGGGGCCTGG + Intergenic
916301995 1:163285652-163285674 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
916346459 1:163797316-163797338 CCAGTACTGGGCCATGGCCCTGG - Intergenic
917634162 1:176918865-176918887 CAAGTGAGGGAACAGGGGCCTGG - Intronic
917780760 1:178393597-178393619 CCAGTACTGGTCCATGGCCCTGG + Intronic
918322942 1:183382302-183382324 CCAGTGTTGGAGGAAGGGCCTGG - Intronic
918490466 1:185075778-185075800 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
919605529 1:199678152-199678174 CCAGTGTTGGAAGAGGGGCCTGG + Intergenic
920315369 1:205072823-205072845 GCAGTGATGGACTATGGGGATGG + Intronic
921081891 1:211746901-211746923 ACAGTGATGGAACATGTGCTTGG - Exonic
922229511 1:223673618-223673640 CCAGTGTTGGAGAAGGGGCCTGG - Intergenic
922229773 1:223675575-223675597 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
923415172 1:233749486-233749508 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
923976647 1:239271594-239271616 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
924905935 1:248452785-248452807 CTTGTCATGGACCATGGGCATGG + Exonic
924921954 1:248639249-248639271 CTTGTCATGGACCATGGGCATGG - Exonic
1064233277 10:13548905-13548927 CCCGTGTTGGAGAATGGGCCTGG - Intergenic
1064574466 10:16730258-16730280 CCAGTGCTGGAGGTTGGGCCTGG - Intronic
1064964649 10:21002810-21002832 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
1065146761 10:22777183-22777205 CCAGTGTTGGAGGAAGGGCCTGG - Intergenic
1065211384 10:23406780-23406802 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1065283965 10:24169305-24169327 TGAGTGATGGAGCATGGGTCAGG - Intronic
1065420418 10:25537696-25537718 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1065624867 10:27619960-27619982 CCAGTGTTGGAGGAGGGGCCAGG - Intergenic
1065789718 10:29249720-29249742 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1067551902 10:47242231-47242253 GCAGTGAGGGATCATGGGCGTGG + Intergenic
1068192484 10:53669253-53669275 CCAGTGCTGGAGGTTGGGCCTGG - Intergenic
1068694882 10:59956994-59957016 CCAGTGGTGTACCAAGGGCAAGG - Exonic
1068929317 10:62573048-62573070 CCAGTGCCGGTCCATGGCCCAGG - Intronic
1069756373 10:70776438-70776460 CAAGTGATAGTCCATGGGCCAGG - Intronic
1070001134 10:72378309-72378331 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1071043133 10:81337961-81337983 CCAGTGTTGGAGTAGGGGCCTGG + Intergenic
1071487447 10:86111997-86112019 CCAGTGTGGGACTCTGGGCCTGG - Intronic
1071506804 10:86237295-86237317 CCAGTGTTGGACGGGGGGCCTGG + Intronic
1071564383 10:86664165-86664187 ACAGTGATGGAGCATGTGCTGGG - Intronic
1072034874 10:91554427-91554449 CCAGTACTGGTCCATGGTCCAGG + Intergenic
1072161084 10:92767175-92767197 CCAGTGTGGGACCCTGGCCCTGG + Intergenic
1072358007 10:94631514-94631536 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1074603099 10:114935215-114935237 CCAGTGTTGGAGGTTGGGCCTGG - Intergenic
1074603117 10:114935288-114935310 CCAGTGTTGGAGGTTGGGCCTGG - Intergenic
1074603135 10:114935361-114935383 CCAGTGTTGGAGGTTGGGCCTGG - Intergenic
1074603153 10:114935434-114935456 CCAGTGTTGGAGGTTGGGCCTGG - Intergenic
1074603171 10:114935507-114935529 CCAGTGTTGGAGGTTGGGCCTGG - Intergenic
1074603188 10:114935580-114935602 CCAGTGTTGGAGGTTGGGCCTGG - Intergenic
1074603205 10:114935653-114935675 CCAGTGTTGGAGGTTGGGCCTGG - Intergenic
1074603222 10:114935726-114935748 CCAGTGTTGGAGGTTGGGCCTGG - Intergenic
1074603239 10:114935799-114935821 CCAGTGTTGGAGGTTGGGCCTGG - Intergenic
1074945564 10:118277747-118277769 CCAGTGCTGGACATGGGGCCTGG - Intergenic
1074981521 10:118623750-118623772 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1075101028 10:119506392-119506414 CCAGAGATGGACAGTGTGCCAGG + Intronic
1077114630 11:877945-877967 CCAGTGGGTGACCATGGGCATGG + Intronic
1077115973 11:884833-884855 CCAGAGATGGCCCAGGGGCCAGG - Intronic
1078267971 11:9769147-9769169 CCTGTGAGGGACAATGGGCAGGG - Intergenic
1078697442 11:13648608-13648630 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1079120159 11:17677239-17677261 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1079387987 11:19997849-19997871 CCAGCCATGGACCATGAGTCGGG - Intronic
1079538248 11:21540768-21540790 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
1079554193 11:21739400-21739422 CCAGTGTTGGAGCTGGGGCCTGG - Intergenic
1080707796 11:34714144-34714166 CCAGTGATGGATGAGGGGCCTGG + Intergenic
1080878575 11:36298680-36298702 CCAGTACTGGTCCATGGCCCGGG + Intronic
1080967643 11:37232194-37232216 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1081090068 11:38853634-38853656 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1081295964 11:41389738-41389760 CCAGTGATCGGGCATGTGCCTGG + Intronic
1081325561 11:41739691-41739713 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1081485612 11:43525639-43525661 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1081485671 11:43526124-43526146 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1081975616 11:47232770-47232792 CCAGTGAGTGATGATGGGCCTGG - Intronic
1083065658 11:59921546-59921568 CCAGTGCTGGAGGAGGGGCCTGG - Intergenic
1083880350 11:65545348-65545370 GGAATGATGGACCATGGACCGGG - Intronic
1084117441 11:67050381-67050403 CCAGTTATGGACCAAGGAACAGG - Exonic
1084233583 11:67771045-67771067 CCAGTGTTGGAGCTGGGGCCTGG + Intergenic
1084577309 11:69997637-69997659 CCAGTGCTGGAGGAGGGGCCTGG + Intergenic
1084858435 11:72003355-72003377 CCAGTGAAGGACCAGGGACCAGG + Exonic
1085194521 11:74660571-74660593 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1085563557 11:77492707-77492729 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1085600642 11:77853528-77853550 CCAGTGTTGGAGAAGGGGCCTGG - Intronic
1085696256 11:78707277-78707299 CCACTGATTCAGCATGGGCCTGG + Intronic
1086546411 11:87972845-87972867 CCAGTGTTGGAGGATGGGCCTGG + Intergenic
1086994026 11:93336337-93336359 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
1087177890 11:95111764-95111786 CCAGTACTGGTCCATGGCCCTGG + Intronic
1087951094 11:104220939-104220961 CCAGTGTTGGAAGAGGGGCCTGG - Intergenic
1088954013 11:114599830-114599852 CCAGTGTTGGAGCTGGGGCCTGG - Intergenic
1089653874 11:119933047-119933069 CCCGTGATGGATGAAGGGCCTGG + Intergenic
1090431186 11:126647994-126648016 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1091860840 12:3781748-3781770 CCAGTGTTGGACGTGGGGCCTGG + Intergenic
1092074316 12:5660555-5660577 CCAGGGATGGACAAGGGGCGTGG - Intronic
1092877791 12:12863739-12863761 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1094393000 12:29973488-29973510 CCAGTGTTGGAAGAGGGGCCTGG + Intergenic
1094408075 12:30140004-30140026 CCAGTGTTGGAGCTGGGGCCTGG + Intergenic
1094715145 12:33006391-33006413 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1095382371 12:41611203-41611225 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1096243139 12:49970054-49970076 GGAGTGAGGGGCCATGGGCCAGG + Intronic
1097075125 12:56387361-56387383 CCAGTGTTGGAGCTGGGGCCTGG - Intergenic
1097588592 12:61545401-61545423 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1097699576 12:62806523-62806545 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1097720118 12:63011212-63011234 CCAGGGATGGACCTTGTGCTGGG - Intergenic
1097750388 12:63346065-63346087 CCAGTATTGGAGCAGGGGCCTGG - Intergenic
1098911657 12:76215255-76215277 CCAGTGGTGGAAGAGGGGCCTGG - Intergenic
1099724517 12:86409706-86409728 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1099972431 12:89514106-89514128 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1100383659 12:94085508-94085530 CCAGTGTTGGAGGAAGGGCCTGG - Intergenic
1100448330 12:94681544-94681566 CCAGTGTTGGAAGAGGGGCCTGG + Intergenic
1101069995 12:101063653-101063675 CCAGTGATGCCACCTGGGCCTGG + Intronic
1101571046 12:105954015-105954037 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1101647276 12:106643097-106643119 TCAGTGATGGACAATGGGGTTGG - Intronic
1102424787 12:112834379-112834401 CCGTTGATGGACCATGGGTTTGG + Intronic
1104260084 12:127174219-127174241 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1104263151 12:127203853-127203875 CCAGTGATGGAGGAGGGGCCTGG - Intergenic
1104370698 12:128221526-128221548 CCAGTGTTGGAGGATGGGCCTGG + Intergenic
1104650665 12:130529978-130530000 CCTGTGCTGGTCCATGGCCCAGG + Intronic
1105439515 13:20403541-20403563 TGAGTGATGGACAAAGGGCCTGG + Intergenic
1105712523 13:23026312-23026334 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1106587877 13:31072914-31072936 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1106894135 13:34279868-34279890 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1107336574 13:39362150-39362172 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1107437820 13:40396095-40396117 CCAGTATTGGTCCATGGCCCAGG + Intergenic
1107441100 13:40428046-40428068 CCAGGGATGGAGCCTGGGTCAGG + Intergenic
1107533569 13:41307224-41307246 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1108031041 13:46230082-46230104 CCAGTGTTGGACATGGGGCCTGG - Intronic
1108359737 13:49658222-49658244 CCAGTGTTGGAAGAGGGGCCTGG - Intergenic
1108802888 13:54121172-54121194 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1108842629 13:54638903-54638925 CCAGTGTTGGAAGAGGGGCCTGG - Intergenic
1109384683 13:61611005-61611027 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1109491174 13:63101555-63101577 CCAGTGCTGGAGGAGGGGCCTGG + Intergenic
1110125977 13:71942635-71942657 CCAGTGTTGGAGGAAGGGCCTGG + Intergenic
1110765988 13:79279870-79279892 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1110868299 13:80422185-80422207 CCAGTGTTGGACGTGGGGCCTGG - Intergenic
1110868723 13:80425285-80425307 CCAGTGATGGAGGTGGGGCCTGG - Intergenic
1110994452 13:82087990-82088012 CCAGTGTTGGAACTGGGGCCTGG - Intergenic
1111175893 13:84595958-84595980 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1111179308 13:84641014-84641036 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1111215409 13:85134162-85134184 CCAGTGTTGGAGAAAGGGCCTGG - Intergenic
1111494689 13:89033114-89033136 CCAGTGTTGGAGCTGGGGCCTGG + Intergenic
1111520892 13:89402313-89402335 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1111666004 13:91268923-91268945 CCAGTGAAGCTCTATGGGCCTGG + Intergenic
1112055055 13:95683340-95683362 CCAGTGTTGGATCTGGGGCCTGG + Intronic
1112400870 13:99077271-99077293 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1112945061 13:104918499-104918521 CCAGTGTTGGAAGAGGGGCCTGG + Intergenic
1113202974 13:107887421-107887443 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1113391822 13:109905124-109905146 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1114274759 14:21132741-21132763 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1116152962 14:41165643-41165665 CCAGTGATGGAGGTGGGGCCTGG + Intergenic
1116254989 14:42542146-42542168 CCAGTGAAGGAAAATGGGCTGGG - Intergenic
1117203334 14:53414759-53414781 CCAGGGCTGGATCATGTGCCTGG + Intergenic
1117762990 14:59051918-59051940 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1118012352 14:61622798-61622820 CCAGTGTTGGCCCCTGGGCATGG - Intronic
1118266505 14:64299863-64299885 CCAATGCTGTTCCATGGGCCAGG + Intronic
1118676077 14:68185877-68185899 CCAGTGTTGGTCCATGGCCTGGG + Intronic
1119037921 14:71246233-71246255 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1119345936 14:73924385-73924407 CCAGTGCTGGTCCATGGCCTGGG + Intronic
1120577999 14:86207892-86207914 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1120583090 14:86278638-86278660 CCAGTGTTGGAGGAAGGGCCTGG + Intergenic
1120691556 14:87598775-87598797 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1120796056 14:88634076-88634098 CCAGTGTTGGAGAAGGGGCCTGG + Intronic
1121214916 14:92240314-92240336 CCAGTGAAGGACCATGGTCCAGG - Intergenic
1121894952 14:97638176-97638198 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1122897965 14:104769754-104769776 CCAGGGATGGGGGATGGGCCAGG - Exonic
1122943676 14:104995066-104995088 CCAGGGATGGACCCTGGGCATGG + Exonic
1123470614 15:20549428-20549450 ACAGCCATGGCCCATGGGCCTGG - Intergenic
1123647446 15:22451272-22451294 ACAGCCATGGCCCATGGGCCTGG + Intergenic
1123730914 15:23144406-23144428 ACAGCCATGGCCCATGGGCCTGG - Intergenic
1123749053 15:23341832-23341854 ACAGCCATGGCCCATGGGCCTGG - Intergenic
1124012515 15:25850335-25850357 CCAGTGCTGCACCTTGGCCCAGG - Intronic
1124091403 15:26606105-26606127 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
1124281425 15:28365715-28365737 ACAGCCATGGCCCATGGGCCTGG - Intergenic
1124301278 15:28545906-28545928 ACAGCCATGGCCCATGGGCCTGG + Intergenic
1124451285 15:29793737-29793759 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
1124578742 15:30932520-30932542 CCAGTGAAGCAGTATGGGCCTGG + Intronic
1125068999 15:35529425-35529447 CCAGTGTTGGAGTAGGGGCCTGG - Intronic
1125454975 15:39848117-39848139 CCAGTGTTGGAAGAGGGGCCTGG - Intronic
1126595677 15:50382440-50382462 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1127578389 15:60314474-60314496 CCAGTGTTGGAGCAGGGGCCTGG - Intergenic
1128690040 15:69717242-69717264 CCAGTGATAGAGCATAGGCAGGG + Intergenic
1128707733 15:69850135-69850157 CCAGCGATGGACAAAGGGACAGG - Intergenic
1129309063 15:74692394-74692416 CCAGTGAAGTCCTATGGGCCTGG - Intronic
1129372299 15:75105217-75105239 CCAGGCATGGACCCTGGGGCTGG - Intronic
1129462051 15:75704470-75704492 CCAGAGATGGAACCTTGGCCAGG + Intronic
1129712351 15:77826744-77826766 CCAGTGCTGGCCTGTGGGCCGGG - Intergenic
1129715504 15:77846223-77846245 CCAGTGTTGGAGAAGGGGCCTGG + Intergenic
1129912569 15:79240566-79240588 CCAGAGAGGGACCAAGTGCCTGG - Intergenic
1130068807 15:80629178-80629200 CCAGTGTTGGAGGAGGGGCCCGG - Intergenic
1131065466 15:89432516-89432538 CCAGTGGTGTCCCAAGGGCCAGG - Intergenic
1131161028 15:90104923-90104945 ACAGTAATGGAATATGGGCCAGG - Intergenic
1131190353 15:90310423-90310445 CCAGTGTTGGAGGAGGGGCCGGG - Intronic
1131926021 15:97384847-97384869 GCAGTGATGGGTCATGAGCCAGG - Intergenic
1131992958 15:98108361-98108383 CCAGTGTTGGAGGAAGGGCCTGG + Intergenic
1132720132 16:1311685-1311707 ACACTGAAGGACCATGGGCAAGG - Intronic
1133580152 16:7136938-7136960 CTCGTCATGGCCCATGGGCCAGG + Intronic
1133617564 16:7492616-7492638 CCAGTGTTGGACTTAGGGCCTGG + Intronic
1133748101 16:8702665-8702687 CCAGTGTTGGACGAGGAGCCTGG - Intronic
1133815730 16:9195933-9195955 CCTGTGATGGGCCAGGTGCCAGG + Intergenic
1134572602 16:15304085-15304107 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1134605042 16:15563805-15563827 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
1134729780 16:16451938-16451960 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1134937651 16:18259958-18259980 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1136080252 16:27847646-27847668 CCAGTGTTGGAGAAGGGGCCTGG + Intronic
1136109859 16:28057888-28057910 CCTGTGATGGGTCATGGGACAGG + Intronic
1136383980 16:29911390-29911412 CCAGTGAGGGACCGGGAGCCAGG + Intronic
1136394868 16:29987329-29987351 CCAGTGCGGTACCCTGGGCCAGG - Exonic
1137460708 16:48660328-48660350 CCAGTGTTGGAGGTTGGGCCTGG + Intergenic
1142023024 16:87795791-87795813 CCAGGGAGGGACCATGGCCTGGG - Intergenic
1143595554 17:7911677-7911699 CCAGTGATGGCCCAAGGGGTGGG - Exonic
1144254513 17:13453411-13453433 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1144388805 17:14774453-14774475 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1146156883 17:30531856-30531878 CCAGTGTTGGACGCAGGGCCTGG + Intergenic
1146828573 17:36046762-36046784 CTAGTGTTGGACCTGGGGCCTGG - Intergenic
1148138652 17:45312245-45312267 CCAGTTATGGAGCAAGGTCCAGG + Intronic
1148962497 17:51405207-51405229 CCAGAGATGGAACATGAGCTGGG + Intergenic
1148976793 17:51536777-51536799 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1148977870 17:51545369-51545391 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1149174451 17:53853146-53853168 CCACTGAGGAAACATGGGCCAGG - Intergenic
1149661294 17:58335341-58335363 GCAGTGAGGGACCATGAGCCTGG - Intergenic
1150813145 17:68372634-68372656 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
1151579563 17:74970586-74970608 CCAGGACTGGACCATGGGGCAGG + Intronic
1152983330 18:299517-299539 CCAGTTAAGAACCATGGGTCTGG + Intergenic
1153439313 18:5099484-5099506 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1153505941 18:5798054-5798076 TGAGTGATGGAGCATGGCCCAGG - Intergenic
1153818268 18:8809729-8809751 TCAGTGATGGCCCATCGCCCAGG - Intronic
1153828014 18:8895162-8895184 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1155589642 18:27411732-27411754 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1155707707 18:28837424-28837446 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1155992006 18:32287619-32287641 CCAGTGATGGACCAGGGTTTCGG + Exonic
1156329254 18:36103963-36103985 CCAGTGTTGGAAGAGGGGCCTGG + Intergenic
1156823311 18:41399101-41399123 CCAGTACTGGTCCATGGCCCAGG - Intergenic
1156995969 18:43466964-43466986 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1157157614 18:45282982-45283004 ACAGTGATGGACCTCCGGCCCGG + Intronic
1157291128 18:46410643-46410665 CCAATAATTGTCCATGGGCCTGG + Intronic
1157904595 18:51558310-51558332 CCAGTACTGGTCCATGGCCCAGG - Intergenic
1158216402 18:55104650-55104672 CCAGTGTTGGAAGAGGGGCCTGG - Intergenic
1158719902 18:59915509-59915531 CAAATGATAGACCTTGGGCCAGG - Intergenic
1159518598 18:69489370-69489392 CCAGTGATGGACCATGGGCCAGG + Intronic
1159653440 18:71004180-71004202 CCAGTGTTGGAGCAGGGGCCTGG + Intergenic
1160382362 18:78470132-78470154 CCCATGTTGGACCAGGGGCCTGG + Intergenic
1160418336 18:78727189-78727211 CCTTGGATGTACCATGGGCCCGG - Intergenic
1160588061 18:79923442-79923464 CCAGAGATGGACCTTAGACCTGG - Intronic
1160625991 18:80205454-80205476 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1160722204 19:602714-602736 CCAGAGAGGGACAATGTGCCTGG - Intronic
1160808308 19:1001936-1001958 CCAGTGCTGGAGGATGGGCTTGG - Intronic
1161086566 19:2338263-2338285 CCAGTGTTGCACCCTGAGCCTGG + Intronic
1162028685 19:7908258-7908280 CCAGTCATGAACGCTGGGCCTGG + Intronic
1162546773 19:11335583-11335605 CCAGTGGTGAGCCATGAGCCGGG + Intronic
1163062078 19:14768192-14768214 CCAGTCTTGGTCCATGTGCCTGG - Intronic
1164048973 19:21567894-21567916 CCAGTGATGGTCCCCTGGCCTGG - Intergenic
1164635470 19:29788081-29788103 CTAGTGCTGGACACTGGGCCAGG - Intergenic
1165059511 19:33198225-33198247 CCAGTCATGGAGCTTGGGCGAGG + Intronic
1165183595 19:33996016-33996038 CCAGTGAAATAACATGGGCCTGG - Intergenic
1166027894 19:40105716-40105738 CCAGTGTTGGAGGAAGGGCCTGG + Intergenic
1166033482 19:40150383-40150405 CCAGTGTTGGAGGAAGGGCCTGG + Intergenic
1166375385 19:42324542-42324564 CCGGTCATGGCCCATGGGGCAGG - Intronic
1166999919 19:46739642-46739664 CCAGAGATGAGCCTTGGGCCAGG - Intronic
1167072859 19:47230774-47230796 CCCGCGAGGGACCCTGGGCCAGG - Intronic
1167981127 19:53276648-53276670 CCAGTGTTTGACCTGGGGCCTGG - Intergenic
1167984987 19:53307098-53307120 CCAGTGTTAGACCTGGGGCCTGG + Intergenic
1168374384 19:55863595-55863617 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
924972522 2:141968-141990 CCAGTGTTGGACGAGGGGCCTGG - Intergenic
925116337 2:1381521-1381543 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
925354264 2:3226748-3226770 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
925644363 2:6020862-6020884 CCAGTGTTGGAGAAAGGGCCTGG + Intergenic
925998125 2:9308416-9308438 CCAGTGTTGGAGCTGGGGCCTGG - Intronic
926099448 2:10104955-10104977 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
926208292 2:10849534-10849556 CCAGTGTTGGAGAAGGGGCCGGG - Intronic
926373640 2:12205165-12205187 CCAGTGTTGGAGGATGGGTCTGG + Intergenic
927561649 2:24077563-24077585 CCAGTGAAGGAGGATGGGGCAGG - Exonic
928306182 2:30172167-30172189 TCACTGATGGAGCAGGGGCCTGG - Intergenic
929253438 2:39783124-39783146 CCAGTGTTGGAGGACGGGCCTGG - Intergenic
929806566 2:45151412-45151434 CCAGTGTTGGAGCTGGGGCCTGG + Intergenic
930289402 2:49474816-49474838 CCAGTGATGGAGAAGGGGCATGG + Intergenic
930362508 2:50399582-50399604 CAAGTGATGGGCCCTGGGCAAGG - Intronic
931059042 2:58505535-58505557 CCAGTAATGGAACATGAGCAAGG + Intergenic
931218103 2:60264770-60264792 CGAGTTCTGGACCATGTGCCAGG + Intergenic
931915282 2:66948130-66948152 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
932302577 2:70677602-70677624 CCATTGACTGACCATGGCCCAGG - Intronic
933058484 2:77704258-77704280 CCAGTGCTGGAGGTTGGGCCTGG - Intergenic
934525262 2:95048005-95048027 CCAGCCCTGGACCAGGGGCCAGG - Exonic
934680782 2:96282545-96282567 CCAGTGTTGGAGGAAGGGCCTGG + Intronic
935298385 2:101670784-101670806 CCAGTGTTGGATGAGGGGCCTGG - Intergenic
935561109 2:104561098-104561120 CTAGTGATGGATGGTGGGCCGGG - Intergenic
935569156 2:104641006-104641028 CCTGTGATTGGGCATGGGCCTGG + Intergenic
935611228 2:105027635-105027657 CCAGTACTGGTCCATGGCCCAGG + Intergenic
935711478 2:105902692-105902714 CCAGTAGTGGTCCATGGTCCAGG - Intergenic
936155170 2:110042445-110042467 GCAGTGATGGCACATGGGCCCGG - Intergenic
936189512 2:110328969-110328991 GCAGTGATGGCACATGGGCCCGG + Intergenic
936593096 2:113822128-113822150 TGAGTGAAGGACCAAGGGCCAGG + Intergenic
936760040 2:115766936-115766958 CCAGTGTTGGAGCTGGGGCCTGG - Intronic
937328583 2:121007413-121007435 CCAGTGCTGGAGGAGGGGCCTGG - Intergenic
937525904 2:122769886-122769908 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
938768075 2:134476687-134476709 TCAGTGGTGGAACATGGACCTGG + Intronic
939501243 2:142987789-142987811 CCAGTGTTGGAGCAGGGGCCTGG + Intronic
939754496 2:146093445-146093467 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
942106312 2:172636815-172636837 CCAGTGATGGAGGTGGGGCCTGG - Intergenic
942257467 2:174118195-174118217 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
942753053 2:179309501-179309523 TCAGTGATGGAGGAGGGGCCTGG - Intergenic
942853037 2:180513144-180513166 CCAGTGATGGAGATGGGGCCTGG + Intergenic
943250739 2:185518653-185518675 CCAGTGAGGGGGCATGGGTCAGG + Intergenic
943443803 2:187956967-187956989 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
944884323 2:204047464-204047486 CCAGTACTGGTCCATGGGCCAGG + Intergenic
944942351 2:204642718-204642740 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
945568601 2:211435490-211435512 CCAGTGCTGCTCCATGGCCCAGG - Intronic
945919161 2:215737899-215737921 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
946464107 2:219896188-219896210 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
946649879 2:221880744-221880766 CCAGTGATGGAGGTGGGGCCTGG - Intergenic
947207311 2:227673674-227673696 CCAGTGTTGGAGAAGGGGCCGGG + Intergenic
947601911 2:231456799-231456821 ACAGTGAAGGAGCATGTGCCTGG - Intronic
947750690 2:232530438-232530460 CCAGTGTGTGACCGTGGGCCTGG + Intronic
1168816565 20:741676-741698 CCAGTGTTGGAAAAGGGGCCTGG + Intergenic
1169377001 20:5074150-5074172 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
1169852799 20:10070827-10070849 CCAGTGTTGGAGAAGGGGCCTGG - Intergenic
1169890134 20:10443733-10443755 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1170590033 20:17764928-17764950 CCAGTGTTGGAGCTGGGGCCTGG - Intergenic
1171104327 20:22418054-22418076 CCAGTGTTGGAGCTGGGGCCTGG - Intergenic
1171403725 20:24895682-24895704 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1171475346 20:25404473-25404495 CCAATGAGTGACCATGGCCCAGG - Intergenic
1171971922 20:31570021-31570043 CCAGTCATGGCACAAGGGCCAGG + Exonic
1172020666 20:31911548-31911570 CCAGAGATGCAGGATGGGCCAGG - Intronic
1173353083 20:42262659-42262681 ACATTGATGGAGCATGTGCCAGG - Intronic
1173951520 20:46997319-46997341 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
1174679147 20:52387806-52387828 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1175966939 20:62664507-62664529 CCAGTGACGGAACAGGGTCCTGG + Intronic
1177855913 21:26399931-26399953 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1178574943 21:33778390-33778412 CCAGTGAAGGCCTCTGGGCCTGG + Intronic
1178596492 21:33958079-33958101 CCTGTAATGGTCCATGGCCCAGG + Intergenic
1178618069 21:34151272-34151294 CCAGTGTTGGAGAAGGGGCCTGG - Intergenic
1178694260 21:34779560-34779582 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1178883089 21:36464039-36464061 CCAGTGTTGGAGGAAGGGCCTGG + Intronic
1180953519 22:19731267-19731289 TCATTGATGGCCCATGGACCCGG - Intergenic
1180970604 22:19813014-19813036 CCAGTGGTGGCTCATGGGCCCGG + Intronic
1180983152 22:19888789-19888811 CCAGTGAGGCACCTTGGACCAGG + Intronic
1181107716 22:20584763-20584785 ACTGTGAGTGACCATGGGCCTGG + Intronic
1182197642 22:28535636-28535658 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1183047596 22:35232538-35232560 CCTGTGATGGGCCATGAGCCAGG - Intergenic
1183737224 22:39650794-39650816 CCTGTGATGGCCCAGGGGCCTGG - Intronic
1184694273 22:46131079-46131101 CCAGTGATGGATGAGGGGCGTGG + Intergenic
1184975587 22:48059147-48059169 GCAGAGAAGGACCATGGCCCCGG + Intergenic
1185120237 22:48961954-48961976 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1185197146 22:49478818-49478840 CCAGTGTTGGACGAGAGGCCTGG - Intronic
1185226709 22:49657625-49657647 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
949354019 3:3158355-3158377 CCAGTGCTGGTTCGTGGGCCAGG + Intronic
949360937 3:3231454-3231476 CCAGTGTTGGAAAAGGGGCCTGG - Intergenic
950870777 3:16226648-16226670 CCAGTGTTGGAAGAGGGGCCTGG - Intronic
951224797 3:20108682-20108704 CCTATGGTGGACCATGGCCCAGG - Intronic
953095185 3:39767972-39767994 CCAGTGTTGGAAGAGGGGCCTGG - Intergenic
953160839 3:40417539-40417561 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
953471076 3:43167183-43167205 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
953633326 3:44639415-44639437 CCAGTGAAGCAGCCTGGGCCTGG + Intronic
953696766 3:45165923-45165945 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
955092666 3:55767919-55767941 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
956358282 3:68418003-68418025 CCAGTGTTGGAACAGGGGCCTGG - Intronic
957018793 3:75100809-75100831 CCAGTGTTGGAAAAGGGGCCTGG + Intergenic
958550142 3:95601746-95601768 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
958560378 3:95742003-95742025 CCAGTGTTGGAAGAGGGGCCAGG - Intergenic
958567798 3:95836836-95836858 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
958852871 3:99349946-99349968 CCAGTGTTGGAGGATGGGCTTGG + Intergenic
959647927 3:108724157-108724179 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
961786841 3:129352583-129352605 CCAGTTCTGGGCCCTGGGCCTGG - Intergenic
961883165 3:130077401-130077423 CCAGTGTTGGAGCTGGGGCCTGG + Intergenic
961954623 3:130788689-130788711 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
962218989 3:133547467-133547489 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
963571588 3:147003937-147003959 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
964268091 3:154922524-154922546 CCAGTGTTGGATGTTGGGCCTGG - Intergenic
965363830 3:167774521-167774543 CCAGTACTGGTCCATGGCCCAGG - Intronic
965397433 3:168175745-168175767 CCAGTGCTGGACCTGGGGCCAGG - Intergenic
966408836 3:179627757-179627779 CCAGTGTTGGACGTGGGGCCTGG - Intergenic
967584322 3:191192975-191192997 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
968697178 4:2036989-2037011 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
968735007 4:2290710-2290732 CCAGGGCTGGGCCAGGGGCCAGG + Intronic
969175229 4:5393728-5393750 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
969176918 4:5405792-5405814 CCAGTGTTGGAAGAGGGGCCTGG - Intronic
969666081 4:8558252-8558274 GCAGTGATGAAGAATGGGCCAGG + Intergenic
969697447 4:8742750-8742772 CCAGTCCTGGCCCATGGCCCCGG + Intergenic
969821565 4:9724727-9724749 CCAGTGTTGGAGCTGGGGCCTGG - Intergenic
970110268 4:12629938-12629960 GCAGTGTTGGAGGATGGGCCTGG - Intergenic
970683663 4:18540396-18540418 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
972743686 4:41912583-41912605 CCAGTGCTGGAAGTTGGGCCTGG + Intergenic
973543148 4:51954171-51954193 CCAGTGTTGGAAGAGGGGCCTGG + Intergenic
974596553 4:64020287-64020309 TCAGTGTTGGACACTGGGCCTGG - Intergenic
975206112 4:71645635-71645657 CCAGCGCTGCACCATGGGCCTGG + Intergenic
975483265 4:74905516-74905538 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
976805143 4:89037703-89037725 CCAGTGTTGGAGAAGGGGCCTGG + Intronic
976883226 4:89955649-89955671 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
978417140 4:108488509-108488531 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
978923616 4:114216875-114216897 CCAGTGGTGGAGCATGGCCAGGG + Intergenic
979118884 4:116866811-116866833 CCAGTGTTGAACCATGGATCTGG + Intergenic
979515392 4:121603254-121603276 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
979716979 4:123851730-123851752 CCAGTGTTGGACATGGGGCCTGG + Intergenic
980888876 4:138793098-138793120 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
981447725 4:144859610-144859632 CCAGTGTTGGAGGATGGGCCTGG + Intergenic
981453140 4:144921753-144921775 CCAGTGTTGGAGAAGGGGCCCGG - Intergenic
983010598 4:162540703-162540725 CCAGTGATGGAAGTGGGGCCTGG - Intergenic
983469197 4:168136152-168136174 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
984731345 4:183070659-183070681 CCAGTGTTGGAGGAAGGGCCTGG - Intergenic
985753645 5:1699652-1699674 CCAGGGCTGGTCCATGGCCCAGG + Intergenic
986127379 5:4895560-4895582 CCAGTGATGGAGTTGGGGCCTGG + Intergenic
986150781 5:5128879-5128901 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
986197963 5:5555259-5555281 CCAGTACTGGTCCATGGCCCAGG - Intergenic
986432178 5:7692036-7692058 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
986474040 5:8107007-8107029 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
986569570 5:9150971-9150993 CCAGTAATACAACATGGGCCTGG + Intronic
988761756 5:34317170-34317192 CCAGTGTTGGATGTTGGGCCTGG + Intergenic
988884262 5:35538280-35538302 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
989154168 5:38328333-38328355 CCAGTGTTGGAGGAAGGGCCTGG - Intronic
989343505 5:40403775-40403797 CCAGTGCTGGAAGAGGGGCCTGG + Intergenic
990679318 5:58223290-58223312 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
991432156 5:66559436-66559458 CCAGTGTTGGAGGACGGGCCTGG - Intergenic
992500856 5:77341692-77341714 CCAGTTTTGGACCAGGTGCCTGG + Intronic
992843112 5:80715854-80715876 CCAGTGCTGGAGCAGGGACCTGG - Intronic
992905125 5:81338306-81338328 CCAGTGCTGGAGCAGGGACCTGG + Intronic
993215551 5:85018376-85018398 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
993455050 5:88118195-88118217 CCAGTGTTGGAGGAAGGGCCTGG - Intergenic
993805810 5:92407604-92407626 CCAGTGTTGGAGAAGGGGCCTGG + Intergenic
994080712 5:95706261-95706283 CCAGTGTTGGAGGAGGGGCCCGG + Intergenic
994081595 5:95713334-95713356 CCAGTGTTGGAGGAGGGGCCCGG + Intergenic
994176209 5:96714086-96714108 CTATTGATGTACCATGTGCCAGG + Intronic
994221567 5:97201586-97201608 CCAGTGTTGGAGCTGGGGCCTGG - Intergenic
994253582 5:97566172-97566194 CCAGTGATGGAGGTGGGGCCTGG - Intergenic
995348383 5:111147352-111147374 CAAGTGATGGCCCATGGATCTGG + Intergenic
995460925 5:112402087-112402109 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
995838766 5:116423538-116423560 CCAGTGAAGGACCATAAGCTTGG + Intergenic
995911485 5:117193066-117193088 CCAGTGCTGGAGGCTGGGCCTGG + Intergenic
996308506 5:122077614-122077636 CCAGTGACGGGCGGTGGGCCTGG + Exonic
996452492 5:123641360-123641382 CCAGTGTTGGAGGAGGGGCCCGG - Intergenic
997016357 5:129939267-129939289 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
998479080 5:142446213-142446235 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
998767077 5:145500169-145500191 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1000034606 5:157435299-157435321 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
1001563996 5:172687871-172687893 CCTGTGGTGGCCCCTGGGCCTGG + Exonic
1001973048 5:175972179-175972201 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
1002244387 5:177871603-177871625 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1003147617 6:3521925-3521947 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1004201120 6:13549051-13549073 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1004353441 6:14911245-14911267 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1004806620 6:19210301-19210323 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1004846349 6:19647396-19647418 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1005149285 6:22730253-22730275 CCAGTGTTGGAGCTGGGGCCAGG + Intergenic
1005594604 6:27367744-27367766 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1008691444 6:53983583-53983605 CCAGTGTTGGAGGGTGGGCCTGG - Intronic
1009027633 6:58018818-58018840 CCTCTGATGACCCATGGGCCTGG + Intergenic
1009056859 6:58346624-58346646 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1009203166 6:60770295-60770317 CCTCTGATGACCCATGGGCCTGG + Intergenic
1009234384 6:61104948-61104970 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1009890224 6:69671857-69671879 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1010135575 6:72548764-72548786 CCAGTGTTGGAGGAAGGGCCTGG + Intergenic
1010395803 6:75390689-75390711 CCAGTGTTGGACATAGGGCCTGG - Intronic
1011735088 6:90302531-90302553 CCAGTGGTGGAATATGGGACTGG + Intergenic
1011898386 6:92260797-92260819 CCAGTGTTGGAACAGGGGCCTGG + Intergenic
1011996753 6:93599338-93599360 CCAGTGTTGGAGCAGGGGCCTGG + Intergenic
1013710211 6:112888150-112888172 CCAGTGATGGAGGTGGGGCCTGG - Intergenic
1014082575 6:117304782-117304804 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1017360758 6:153566793-153566815 CCAGTAAAGCAACATGGGCCTGG - Intergenic
1019127027 6:169847401-169847423 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1019441868 7:1051520-1051542 CCACTGCTGGCCCATGGCCCAGG + Intronic
1019556257 7:1633104-1633126 CAAGGGTTGGACCATGGGGCGGG + Intergenic
1020317185 7:6914133-6914155 CCAGTGTTGGAGCTGGGGCCTGG + Intergenic
1020372253 7:7444876-7444898 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1021200993 7:17728516-17728538 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1021674273 7:23064611-23064633 CCAGTGTTGGAGTAGGGGCCTGG + Intergenic
1021783861 7:24133650-24133672 CCAGTGGTGGGCCATGGCCAGGG + Intergenic
1022233183 7:28434773-28434795 CCTGTGCTGAACCATGGCCCTGG + Intronic
1022468734 7:30668776-30668798 CCAGGGATGGGCCTTGGCCCAGG - Intronic
1023301784 7:38780762-38780784 CCAGTGTTGGACGAGGGGCCTGG + Intronic
1024015219 7:45307502-45307524 CCAGTACTGGTCCATGGCCCTGG + Intergenic
1026054344 7:66971516-66971538 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1026125830 7:67578760-67578782 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1026301637 7:69102916-69102938 GCACTGAGGAACCATGGGCCTGG - Intergenic
1026302839 7:69112994-69113016 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1027154673 7:75758210-75758232 CCAGTACTGGTCCATGGCCCAGG + Intergenic
1029230542 7:99064376-99064398 CCAGTGATGGCCTCTAGGCCTGG + Intronic
1030139825 7:106293111-106293133 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1031182294 7:118433733-118433755 CCAGTGTTGGAGGAAGGGCCTGG + Intergenic
1031443236 7:121819702-121819724 CCAGTGATGCCACCTGGGCCTGG - Intergenic
1031784680 7:126014433-126014455 CCAGTGTTGGAAGTTGGGCCTGG - Intergenic
1031872638 7:127103288-127103310 CCAGTGATGGAGGCAGGGCCTGG + Intronic
1033175078 7:139116290-139116312 CCAGTGATGGAACACGGGATGGG - Intergenic
1033542120 7:142366773-142366795 CCAGTGATGGAGGTGGGGCCTGG - Intergenic
1033671223 7:143495149-143495171 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1034929180 7:155147762-155147784 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1035822611 8:2610604-2610626 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1036037095 8:5031517-5031539 CCAGTGATAAGCCCTGGGCCAGG + Intergenic
1037068136 8:14608745-14608767 CCAGTGTTGGACGTGGGGCCTGG - Intronic
1037086472 8:14856986-14857008 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1037380799 8:18283528-18283550 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1038092379 8:24268819-24268841 CCAGTAATGGTCCATGGCCCGGG - Intergenic
1038275130 8:26115045-26115067 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1038286744 8:26212110-26212132 CAAGAGATGAACCAGGGGCCAGG - Intergenic
1039118329 8:34117132-34117154 CCAGTGCTGGAGCTGGGGCCTGG + Intergenic
1040516711 8:48141777-48141799 CCAGTCATGGAGCCAGGGCCTGG - Intergenic
1040807963 8:51415546-51415568 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
1042887204 8:73565175-73565197 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1043044218 8:75300788-75300810 CCAGTGATTGACCATGAAGCCGG + Intergenic
1043358237 8:79439199-79439221 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1044345634 8:91100943-91100965 CCAGTGTTGGAGACTGGGCCTGG + Intergenic
1044550794 8:93510378-93510400 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1044638200 8:94349746-94349768 CCAGTGCTGGAGGAGGGGCCTGG - Intergenic
1045135115 8:99208269-99208291 CCAGTGATGGAGATGGGGCCTGG - Intronic
1045430001 8:102104816-102104838 CCAGGGATGGACAATGACCCAGG + Intronic
1045561956 8:103272244-103272266 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1045778546 8:105835851-105835873 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1047286991 8:123495881-123495903 CCAGTGCTGGTCCATGGTCTGGG + Intergenic
1047682088 8:127264643-127264665 CCAGTGCTGGAGGAGGGGCCTGG - Intergenic
1047891378 8:129315154-129315176 CCAGTACTGGTCCATGGCCCGGG - Intergenic
1047937883 8:129799861-129799883 CCAGTGTTGGAGGATGGGTCTGG - Intergenic
1048557592 8:135495746-135495768 CCAGTGATGGCCCATAGACCTGG - Intronic
1049515186 8:143050693-143050715 CCAGGGTTGCAACATGGGCCAGG + Intronic
1049600517 8:143505342-143505364 CCGGAGATGGCGCATGGGCCAGG + Intronic
1049731637 8:144181276-144181298 CCAGTGATGGGGGAGGGGCCCGG + Intronic
1049770485 8:144378311-144378333 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1049918489 9:341721-341743 CCAGTAATGGTCTATGGCCCGGG - Intronic
1050432983 9:5580830-5580852 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1050673526 9:8025229-8025251 CCAGTGTTGGACATGGGGCCTGG - Intergenic
1050876215 9:10640187-10640209 CCAGTGTTGGAAGAGGGGCCTGG - Intergenic
1050976761 9:11949121-11949143 CCAGTGTTGGAAGAGGGGCCTGG - Intergenic
1051006024 9:12345802-12345824 CCAGTGTTGGAGAAAGGGCCTGG + Intergenic
1051040370 9:12802299-12802321 CCAGTGGTGGAGGTTGGGCCTGG + Intronic
1051873817 9:21769596-21769618 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1052208442 9:25871372-25871394 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1052362481 9:27575656-27575678 CCAGTGTTGGAGGTTGGGCCTGG - Intergenic
1052391462 9:27883113-27883135 CCAGTGTTGGAGCAGGGGCCTGG + Intergenic
1053185722 9:36014490-36014512 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1053186778 9:36023037-36023059 CCAGTGCTGGAGCTGGGGCCTGG - Intergenic
1053456727 9:38238731-38238753 CCAGTGTTGGAGGAAGGGCCGGG - Intergenic
1054717650 9:68572489-68572511 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1055351995 9:75399155-75399177 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1056032112 9:82563865-82563887 CCAGTGTTGGAGGATGGGCCTGG + Intergenic
1056847369 9:90052398-90052420 CCAGCTATGGACCTTGGGACAGG - Intergenic
1056897299 9:90562979-90563001 CCAGTGTTGTTCCATTGGCCTGG - Intergenic
1059001748 9:110355937-110355959 CCAGTGTTGGAGAAGGGGCCTGG + Intergenic
1059327057 9:113510414-113510436 CCAGTGCAGGACCCAGGGCCTGG + Intronic
1059700188 9:116768439-116768461 CCAGTGATGGAGGACGGGTCAGG - Intronic
1060045388 9:120336402-120336424 GCACTGAGAGACCATGGGCCTGG + Intergenic
1060436012 9:123593825-123593847 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1060505307 9:124193296-124193318 CCAGTGTTGGAGGAAGGGCCTGG + Intergenic
1060834564 9:126745361-126745383 ACAGAGATGGAGCAAGGGCCTGG + Intergenic
1062090803 9:134677894-134677916 CCAGCGGTGGAACAAGGGCCAGG - Intronic
1062126432 9:134865384-134865406 CTCGTGGTGGACCAGGGGCCAGG + Intergenic
1203779549 EBV:93477-93499 CCAGTGAGGAACCGTGCGCCTGG + Intergenic
1185828741 X:3277835-3277857 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
1185913138 X:4004607-4004629 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1186103367 X:6180254-6180276 CCAGTGATGGAGGTGGGGCCTGG + Intronic
1186592381 X:10944526-10944548 CCAGTACTGGTCCATGGCCCAGG + Intergenic
1187165510 X:16800860-16800882 CCAGTGATGGAGGTGGGGCCTGG + Intronic
1187650130 X:21392611-21392633 CCAGTGTTGGAGGAGGGGCCTGG - Intronic
1187742332 X:22369531-22369553 CCAATGTTGGAGGATGGGCCTGG + Intergenic
1188039206 X:25352358-25352380 CCAGTGTTGGAGAAGGGGCCTGG - Intergenic
1188657476 X:32716227-32716249 CCAGTGTTGGAGGAGGGGCCTGG + Intronic
1188791160 X:34409523-34409545 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1188927576 X:36063969-36063991 CCTGTGATGTACCCTGGGGCAGG - Intronic
1188959420 X:36471828-36471850 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1189103805 X:38217061-38217083 CCAGTGATGGGCCATTGGACAGG - Intronic
1190270738 X:48861444-48861466 CCAGCGCTGCACCCTGGGCCTGG + Intergenic
1193083590 X:77428515-77428537 CCAGTGATGGATGGTGGGGCGGG - Intergenic
1193593848 X:83422076-83422098 CCAGTGTTGGAAGAGGGGCCTGG + Intergenic
1194212473 X:91084697-91084719 CCAGTGTTGGAACATAAGCCTGG - Intergenic
1195238995 X:102932392-102932414 CCAGTGTTGGAGGTTGGGCCTGG - Intergenic
1195281968 X:103344921-103344943 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1196148354 X:112344610-112344632 CCAGTGTTGGAGGAAGGGCCTGG - Intergenic
1196721622 X:118859738-118859760 CCAGTGTTGGAGCTGGGGCCTGG + Intergenic
1196749374 X:119101008-119101030 CCTGGGTTGGACCTTGGGCCAGG + Intronic
1198081282 X:133242149-133242171 CCAGTGTTGGAGAAGGGGCCTGG - Intergenic
1198188766 X:134282816-134282838 CCAGTACTGGTCCATGGCCCAGG - Intergenic
1198506739 X:137308747-137308769 CCAGTGTTGGAGCAGGGGCCTGG + Intergenic
1198622818 X:138533320-138533342 CCAGTGCTGGAGGAGGGGCCTGG + Intergenic
1198861477 X:141075324-141075346 CCAGTGTTGGACATGGGGCCTGG + Intergenic
1199109294 X:143911055-143911077 CCAGTGTTGGAGGAGGGGCCTGG - Intergenic
1199463088 X:148105232-148105254 CCAGTGTTGGAGGAGGGGCCTGG + Intergenic
1201677318 Y:16601318-16601340 CCAGTGATGGCCAATGAGACTGG - Intergenic
1201708680 Y:16965685-16965707 CCAGTAGTGGTCCATGGCCCAGG + Intergenic