ID: 1159524223

View in Genome Browser
Species Human (GRCh38)
Location 18:69567469-69567491
Sequence CCATTACCAAAAAAAAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1154
Summary {0: 1, 1: 1, 2: 6, 3: 100, 4: 1046}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159524221_1159524223 4 Left 1159524221 18:69567442-69567464 CCAAGAAGAAAGAAAAATTTTTA 0: 1
1: 1
2: 17
3: 196
4: 1871
Right 1159524223 18:69567469-69567491 CCATTACCAAAAAAAAAATGAGG 0: 1
1: 1
2: 6
3: 100
4: 1046

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159524223 Original CRISPR CCATTACCAAAAAAAAAATG AGG Intronic
900046585 1:511412-511434 CCGTTTAAAAAAAAAAAATGTGG - Intergenic
900426312 1:2581130-2581152 CCATTATCAAAAGAAAAGAGAGG + Intergenic
900994792 1:6115007-6115029 CCATCTCAAAAAAAAAAAAGGGG + Intronic
901395716 1:8979989-8980011 CCATCTCAAAAAAAAAAAAGGGG - Intergenic
901682480 1:10921651-10921673 CCATCTCAAAAAAAAAAAGGGGG + Intergenic
901728399 1:11260542-11260564 CAATTAAAAAAAAAAAAAAGAGG + Intronic
901832516 1:11901573-11901595 CCATCTCAAAAAAAAAAAAGAGG + Intergenic
902153463 1:14463757-14463779 CCCTTACCATAAAAAATGTGGGG + Intergenic
902189268 1:14750004-14750026 CCATGACCAAAAAAAAGGTGGGG + Intronic
902524191 1:17044321-17044343 CCAAAAAAAAAAAAAAAATGAGG - Intronic
902597545 1:17519836-17519858 CCATCTCAAAAAAAAAAAAGAGG + Intergenic
902864073 1:19266599-19266621 CCATTAAAAAAAAAAAAGAGTGG - Intergenic
903074838 1:20756400-20756422 TCATTAAAAAAAAAAAATTGGGG + Intronic
903199787 1:21725747-21725769 CCATCTCAAAAAAAAAAAAGAGG + Intronic
903210190 1:21813874-21813896 CCGTCACCAAAAAAAAAAAAGGG - Intronic
903465878 1:23552557-23552579 CCATCTCCAAAAAAAAAAGGGGG - Intergenic
904070009 1:27787815-27787837 CCATTACCAAAAAGTAAATTTGG + Intronic
904573616 1:31486898-31486920 CCATTTCAAAAAAAAATAGGTGG + Intergenic
904739108 1:32658549-32658571 CCATCTCCAAAAAAAAAAAAAGG - Intronic
904809603 1:33154791-33154813 CCGTATCCAAAAAAAAAAAGTGG + Intronic
905185224 1:36191534-36191556 CCACCTCAAAAAAAAAAATGGGG - Intergenic
905293132 1:36936808-36936830 CCATCAGAAAAAAAAAAATGAGG - Intronic
905351735 1:37351483-37351505 CCCTTTCTCAAAAAAAAATGGGG + Intergenic
905375980 1:37520585-37520607 CCGTTTCAAAAAAAAAAATGAGG + Intergenic
905438363 1:37975509-37975531 CTATTTCAAAAAAAAAAAAGAGG + Intronic
905767605 1:40614511-40614533 CCATCTCAAAAAAAAAAAAGGGG - Intergenic
905826983 1:41033281-41033303 CTATTAAAAAAAAAAAAAGGAGG + Intronic
906971711 1:50521653-50521675 CCATTACTGAAAACAAAAAGTGG + Intronic
906996092 1:50795873-50795895 TGATTACCAAGAAAAAAATTGGG + Intronic
907137311 1:52151991-52152013 CCATCTCAAAAAAAAAATTGGGG - Intronic
908110353 1:60890879-60890901 TCATTACCAAGAGTAAAATGTGG - Intronic
908224243 1:62040112-62040134 CCATTTCAAAAAAAAAAAAAAGG - Intronic
908233489 1:62128583-62128605 CCATTACCAAAATACAAAAATGG + Intronic
908361753 1:63375038-63375060 CCTTTACAAAAAGAAAAATTAGG + Intronic
908391129 1:63684705-63684727 CCATTTCCAAAAATAAAAAAGGG - Intergenic
908664105 1:66470663-66470685 CAAATACAAAAAAAAAAATGAGG - Intergenic
908721675 1:67132515-67132537 CCATTTCAAAAAAAAAAAAGAGG + Intronic
908792389 1:67795776-67795798 CCATTACAAGAAAAAGGATGTGG + Intronic
909094366 1:71269457-71269479 CCATGACTAAAAATAGAATGGGG + Intergenic
909773751 1:79458639-79458661 CTAATACAAAAAAAAAAATGAGG - Intergenic
909860769 1:80602546-80602568 TCATTACCAAAAACAAAAAAAGG + Intergenic
909956835 1:81788718-81788740 CCATCTCAAAAAAAAAAATATGG - Intronic
910390875 1:86742513-86742535 CCATTTCCAAATAACTAATGAGG - Intronic
910508135 1:87973594-87973616 CCCTCAGAAAAAAAAAAATGAGG + Intergenic
910653511 1:89595907-89595929 CATTTTCCAAAAAATAAATGTGG + Exonic
910678401 1:89838192-89838214 CCCTTAAAAAAAAAAAAAAGGGG + Intronic
910840643 1:91557697-91557719 CAATTACAAAAAAAAAAAAATGG + Intergenic
910958941 1:92739971-92739993 CCTTTAAAAAAAAAAAAAAGGGG + Intronic
911047860 1:93643221-93643243 CCATCTCAAAAAAAAAAAAGAGG + Intronic
911169678 1:94757602-94757624 ACATTTCCAAACAAATAATGGGG - Intergenic
911575254 1:99569365-99569387 CAAATAACAAAAGAAAAATGAGG + Intergenic
912188533 1:107310102-107310124 CCATTTCAAAAAAGAGAATGTGG + Intronic
912579297 1:110705712-110705734 CCATTACCACAAAAACATTATGG + Intergenic
912689822 1:111796394-111796416 ACCAGACCAAAAAAAAAATGTGG + Intronic
912783521 1:112576092-112576114 CCATCTCAAAAAAAAAATTGGGG - Intronic
912845549 1:113071840-113071862 ACCTTACAAAAAAAAAAAGGAGG - Intergenic
912858507 1:113192629-113192651 CCATCTCAAAAAAAAAAAAGAGG - Intergenic
912888884 1:113506414-113506436 CCATTAGCAAAAAAAAAAAAAGG - Intronic
913172002 1:116241546-116241568 CCATCAGGAAAAAAAAAAGGGGG + Intergenic
914708000 1:150187227-150187249 TCTTTAAAAAAAAAAAAATGGGG + Intergenic
915123560 1:153648005-153648027 CCATCTCGAAAAAAAAAAGGTGG + Intergenic
915126522 1:153669488-153669510 CCACTACAAAAAAAAAAAGATGG - Intronic
915189535 1:154137250-154137272 CCATTTCTAACAAAAAAAAGAGG + Intronic
915346338 1:155199108-155199130 CCATCTCAAAAAAAAAAAGGAGG + Intronic
915382369 1:155453353-155453375 CCATAAAAAAGAAAAAAATGTGG + Intronic
915959042 1:160248889-160248911 CCATCTCAAAAAAAAAAAAGAGG + Intronic
916134689 1:161641208-161641230 TGCTTACCAAAAAAAAAAAGTGG - Intronic
916302083 1:163286669-163286691 ACATTACCAAAAAGAAAGTCAGG - Intronic
916364744 1:164012645-164012667 GCATTAGAAAAAATAAAATGAGG + Intergenic
916447058 1:164882114-164882136 CAACTACCAAAAAAAAAAAAGGG - Intronic
917043283 1:170830032-170830054 CCATCTCAAAAAAAAAAAAGGGG - Intergenic
917352698 1:174094534-174094556 CCATTTCAAAAAAAAAAAAAAGG - Intergenic
917365959 1:174232481-174232503 CAATTAAAAAAAAAAAAAAGTGG + Intronic
917615624 1:176740978-176741000 CCATCACCAAAAAGAAATTCTGG + Intronic
917682004 1:177376792-177376814 ACATTAACAAAAGAAAAATGAGG - Intergenic
917851336 1:179067149-179067171 CCACTGCCAAAAAAAAAAAAAGG + Intronic
918021314 1:180694626-180694648 CCACAATCAAAAAAAAAATTGGG - Intronic
918029852 1:180796106-180796128 CACTTACAAAAATAAAAATGAGG - Intronic
918249641 1:182690543-182690565 CATTTAACAAAAAGAAAATGGGG - Intergenic
918671217 1:187218815-187218837 CTACTACAAAAAAAAAAATTGGG - Intergenic
918697869 1:187566617-187566639 CCATCACCCAAATAAAAATAGGG - Intergenic
919239073 1:194888432-194888454 CCATTACAAAATAAAACACGTGG + Intergenic
919357761 1:196547341-196547363 CCATTATTTAAAAAAAAATTGGG + Intronic
919470958 1:197978632-197978654 CCATTTCAAAAAAAAAAAAAAGG - Intergenic
919526074 1:198652566-198652588 CAATGACCAAAAAAAAAAAAGGG - Intronic
919599426 1:199604278-199604300 CAATAACCAAAAAAAAAAAATGG + Intergenic
920966506 1:210705570-210705592 CCATAGCCAAAAAAGAAAAGAGG + Intronic
921095336 1:211882349-211882371 CTATTTCCAAAGCAAAAATGTGG - Intergenic
921653145 1:217703173-217703195 CCATTTCAAAAAAAAAAAAAAGG - Intronic
921657287 1:217755118-217755140 CAATTACAAAACAAAAAAAGAGG + Intronic
921918027 1:220634830-220634852 ACATTTGCAAAAAAAAAATCTGG - Intronic
923008417 1:230069696-230069718 CTCATACCAAAAAAAAAATGTGG + Intronic
923208008 1:231777200-231777222 TCCTTACCAAAAAAAAGAGGGGG - Intronic
923750043 1:236739228-236739250 CCAGTTAAAAAAAAAAAATGAGG - Intronic
923845400 1:237725295-237725317 CGATTATCAAAAATAAAAAGTGG + Intronic
924047900 1:240051325-240051347 ACATTACTAAAGAAAAGATGAGG - Intronic
924346315 1:243076035-243076057 CGTTTAAAAAAAAAAAAATGTGG - Intergenic
924532799 1:244907549-244907571 CCATCTCCAAAAAACAAAAGAGG + Intergenic
924542592 1:244995355-244995377 CCATCTCAAAAAAAAAAAAGAGG + Intronic
924546135 1:245029598-245029620 CCTTTTCCAAAAAAAAAAACAGG - Intronic
924638103 1:245808003-245808025 CCACTGCCAAAATCAAAATGAGG + Intronic
1063538691 10:6910498-6910520 CCCTTAAAAAAAAAAAAAAGAGG - Intergenic
1063575804 10:7260955-7260977 ACATTAAAAAAAAAAAAGTGTGG + Intronic
1063646031 10:7884388-7884410 CCATCTCAAAAAAAAAAAGGAGG - Intronic
1063878191 10:10502620-10502642 CCATTATCAGGAATAAAATGGGG - Intergenic
1064118212 10:12596822-12596844 CCAGGTCTAAAAAAAAAATGTGG - Intronic
1064254660 10:13733437-13733459 CCATCTCCAAAAAAAAAACCAGG - Intronic
1064739420 10:18416947-18416969 ACATTAAAAAAAAAAAAATGAGG - Intronic
1065184932 10:23162389-23162411 CCCTTACCAAAAATAACCTGAGG + Intergenic
1065307399 10:24382016-24382038 CCAATACAAAAAAAAAAAAAAGG - Intronic
1065354065 10:24821845-24821867 CCATTAACAAAAAGAAAAAAGGG + Intergenic
1065680137 10:28222195-28222217 CGATTAAAAAAAAAAAAAAGTGG + Intronic
1066161530 10:32736658-32736680 ACATTATCACCAAAAAAATGAGG - Intronic
1066247933 10:33602454-33602476 CCATTAAGAGAAAAGAAATGTGG + Intergenic
1066360590 10:34726756-34726778 CCATCTCCAAAAAAAAAAGTGGG + Intronic
1066364220 10:34761060-34761082 CCAAAAACAAAAAAAAAGTGGGG + Intronic
1067055547 10:43047806-43047828 CCATGACCATAAAAACAATCTGG + Intergenic
1067362732 10:45597078-45597100 CCATCTCCAAAAAAAAAAAAGGG + Intergenic
1067415845 10:46101825-46101847 CAATTACCAGAAAAAAAAAAAGG - Intergenic
1067589529 10:47497313-47497335 CCATCACAAAAAAAAAAAAAAGG + Intergenic
1067917380 10:50415199-50415221 ACATTATTAAAAAACAAATGAGG + Intronic
1068031128 10:51706511-51706533 CTATTAAAAAAAAAAAAATTGGG - Intronic
1068187462 10:53604667-53604689 CCATGTCAAAAAAAAAAAAGAGG - Intergenic
1068398270 10:56493142-56493164 CAAATACAAAAAAAAATATGAGG + Intergenic
1068836240 10:61557212-61557234 TCATTACAAAAAAAAAAAAATGG + Intergenic
1068964331 10:62896487-62896509 CCCTTATTAAAAAGAAAATGTGG - Intronic
1069020964 10:63488093-63488115 CCATGACTTACAAAAAAATGGGG + Intergenic
1069039855 10:63684291-63684313 CCGTCTCCAAAAAAAAAAAGAGG + Intergenic
1069383039 10:67859994-67860016 CTGTTTCAAAAAAAAAAATGTGG - Intergenic
1069430333 10:68329385-68329407 CCATAACCACACAAAATATGCGG + Intronic
1069450491 10:68513400-68513422 CCATCTCAAAAAAAAAAAAGAGG + Intronic
1069735904 10:70654068-70654090 CCATCTCAAAAAAAAAAACGGGG - Intergenic
1070182433 10:74027313-74027335 TCATTACAAAAAAAAAAAAATGG - Intronic
1070803497 10:79256884-79256906 CCATTAAGAAAATAAAAAAGAGG + Intronic
1070889952 10:79935857-79935879 CCATCTCAAAAAAAAAAAAGGGG - Intergenic
1071184796 10:83029676-83029698 CCAGTACTCAATAAAAAATGAGG - Intergenic
1071680985 10:87705736-87705758 CCATCTCAAAAAAAAAAATAAGG - Intronic
1071691243 10:87821525-87821547 CCATCTCAAAAAAAAAAATTAGG + Intronic
1072337412 10:94410539-94410561 CAACAACCAAAAAAAAACTGTGG - Intronic
1072580643 10:96736922-96736944 CAATTAACAAAAAAAGAATGGGG - Intergenic
1073222366 10:101886051-101886073 CCATCTCAAAAAAAAAAAGGGGG + Intronic
1073413121 10:103359000-103359022 CCATCTCAAAAAAAAAAAAGAGG + Intergenic
1074147334 10:110728421-110728443 CCTTATCCAAAAAAAAAGTGTGG - Intronic
1074632554 10:115274373-115274395 CTATAACCAAAACAAAAAAGAGG - Intronic
1074845840 10:117397041-117397063 CCATTTCCAAAAAAAAAAAAAGG + Intergenic
1075381351 10:122021222-122021244 CCATCTCGAAAAAAAAAAGGCGG + Intronic
1076131230 10:128015369-128015391 CCATCTCAAAAAAAAAAAAGAGG - Intronic
1077678512 11:4218731-4218753 CAAATAACTAAAAAAAAATGTGG - Intergenic
1077908289 11:6551934-6551956 CCGTCTCCAAAAAAAAAAAGGGG + Intronic
1078039706 11:7848601-7848623 ACCATACGAAAAAAAAAATGTGG - Intergenic
1078042171 11:7877448-7877470 CCAATAACAGAAAAAAAATTTGG + Intergenic
1078379777 11:10829602-10829624 CCATCTCAAAAAAAAAAAAGGGG - Intronic
1078765800 11:14296811-14296833 TCATTACCATAAAAAAAAGGGGG + Intronic
1079623770 11:22590566-22590588 CCATTTCCTAAAAAATAATTAGG + Intergenic
1079636052 11:22742339-22742361 TCATTGACAAAATAAAAATGTGG + Intronic
1079651645 11:22936828-22936850 CCAATAACAAAAATAAAATAAGG - Intergenic
1079803406 11:24898240-24898262 CAATTATAAAAAAAAAAATCAGG + Intronic
1080000718 11:27346166-27346188 CCATTAAGAAAAATTAAATGGGG + Intronic
1080068123 11:28043906-28043928 AAATGACCAAAAAAAAAAAGGGG + Intronic
1080250024 11:30222886-30222908 ACATTACAAATAAAGAAATGAGG - Intergenic
1080273506 11:30476213-30476235 TCATTACAAAAATCAAAATGTGG - Intronic
1080286221 11:30616197-30616219 ACATTAAAAAAAAAAAAATCCGG - Intergenic
1080869087 11:36221361-36221383 CCATCTCAAAAAAAAAAAAGAGG + Intronic
1080879303 11:36304126-36304148 CCTTTAGCAAGAAAAAGATGAGG - Intronic
1081226518 11:40530444-40530466 CTCTTATCAGAAAAAAAATGGGG + Intronic
1081544797 11:44063751-44063773 TAATTAACAAAAATAAAATGGGG - Intergenic
1082675596 11:56097778-56097800 AGATGAGCAAAAAAAAAATGTGG - Intergenic
1082829207 11:57602923-57602945 CCATTAAAAAAAAAAAAGTTGGG + Intronic
1082985469 11:59166366-59166388 CCATTTAGAAAAAAAAAATTTGG + Intergenic
1082994701 11:59243880-59243902 ACATTACAAAAGAAAACATGTGG - Intergenic
1083193154 11:61067014-61067036 TCATTAGCACTAAAAAAATGTGG + Intergenic
1083449607 11:62734291-62734313 CCATCTCAAAAAAAAAAATAGGG + Intronic
1083650161 11:64198650-64198672 CCACTACCTAAAAAAAGATCAGG - Intronic
1083772163 11:64873975-64873997 CCTTTCTAAAAAAAAAAATGTGG - Intronic
1083844848 11:65325342-65325364 CCACAATAAAAAAAAAAATGCGG - Intergenic
1084405522 11:68970017-68970039 CCATTTCAAAAAAAAAAAAAAGG + Intergenic
1084524106 11:69685203-69685225 CAAAAACCAAAAAAAACATGTGG - Intergenic
1084797865 11:71520092-71520114 CTGTTACCAAAAAAAAGAAGAGG + Intronic
1084854437 11:71973180-71973202 CCATCTCAAAAAAAAAAAAGAGG + Intronic
1084862125 11:72025963-72025985 CCATTAACTAAAATAAAAAGAGG + Intronic
1085090781 11:73711293-73711315 ACATTACCTAAAGCAAAATGAGG - Intronic
1085227371 11:74934342-74934364 TGATTAACAAAAAAAGAATGAGG - Intronic
1085839586 11:79996296-79996318 ACATTACAAAGAGAAAAATGAGG + Intergenic
1086464677 11:87040656-87040678 CCATCACAAAAAAAAAAAAAAGG + Intronic
1086722974 11:90144736-90144758 CCATTAAAAAAAAAAAAAAACGG + Intronic
1086734731 11:90291899-90291921 CCATTAAGAAAACAAAAATAAGG - Intergenic
1086809638 11:91292301-91292323 TTATAACAAAAAAAAAAATGAGG + Intergenic
1086896661 11:92320863-92320885 CCATCTCAAAAAAAAAAAGGGGG + Intergenic
1087419251 11:97899800-97899822 CCATTTTCAAACAAAAATTGGGG + Intergenic
1087893726 11:103564445-103564467 CCATCTCCAAAAAAAAAAAAGGG - Intergenic
1087967795 11:104439149-104439171 ACATTACTAAAACAAAAAGGTGG - Intergenic
1087975930 11:104546170-104546192 CTATTATCTAATAAAAAATGAGG + Intergenic
1088134239 11:106534747-106534769 ACAGTAAAAAAAAAAAAATGAGG - Intergenic
1088353382 11:108914831-108914853 CCATTAAAAAAAAAAAAAACTGG + Intronic
1088498610 11:110458969-110458991 CCAGTATGAAAAAAACAATGAGG - Intronic
1088513591 11:110602501-110602523 CCCTCACAAAAATAAAAATGAGG + Intronic
1089470516 11:118716674-118716696 ACATTAAAAAAAAAAAAAAGAGG - Intergenic
1089835935 11:121370676-121370698 TCTTTGCTAAAAAAAAAATGAGG - Intergenic
1089846558 11:121463256-121463278 CAGTTGGCAAAAAAAAAATGAGG - Intronic
1090581793 11:128168546-128168568 ACATTTCTGAAAAAAAAATGGGG + Intergenic
1091085410 11:132717277-132717299 CCATTATTAAAAAAAAATTCTGG - Intronic
1091469970 12:718111-718133 CCATTCACAAAAGGAAAATGTGG + Intergenic
1091554075 12:1558970-1558992 CCATCTCAAAAAAAAAAGTGGGG - Intronic
1091732593 12:2891748-2891770 CCATTACCAAGACAAAGATTTGG + Intronic
1092199605 12:6572120-6572142 CCACCTCCAAAAAAAAAAGGTGG + Intronic
1092202770 12:6596793-6596815 CCATTTCAAAAAAAAAAATTAGG + Intronic
1092315637 12:7410597-7410619 CCATATCCAAAAAAAAAAAAAGG + Intronic
1092396395 12:8130886-8130908 CTATTACAGAAAAGAAAATGAGG - Intronic
1092815855 12:12311731-12311753 ACATTAACAGAAAAAAAAGGGGG - Intergenic
1092846892 12:12591889-12591911 ACCTTACCAAAAAGAATATGAGG - Intergenic
1093115211 12:15201131-15201153 CCATTGCTAGAAAAAAAGTGAGG - Intronic
1093120732 12:15268063-15268085 CCATTAAAAAAAAAAAAAGGAGG - Intronic
1093545864 12:20346904-20346926 CCAGAAAAAAAAAAAAAATGAGG - Intergenic
1093852096 12:24053184-24053206 CCATCTCAAAAAAAAAAAAGGGG - Intergenic
1094352569 12:29543292-29543314 TAATTACTAAAAGAAAAATGTGG - Intronic
1094629675 12:32160494-32160516 CCATTAAAAAAAAAAAAGTGAGG - Intronic
1094691747 12:32776195-32776217 CCTTATCGAAAAAAAAAATGTGG + Intergenic
1095309264 12:40678377-40678399 CCATCACCAAAATAAACATAAGG - Intergenic
1095468458 12:42512116-42512138 CCATTACAAAAAAAAAAGATAGG + Intronic
1095566156 12:43626193-43626215 AAATTACCAAAAAAAAAGAGAGG - Intergenic
1095877914 12:47101940-47101962 CCATCTCAAAAAAAAAAAGGAGG + Intronic
1096127920 12:49133491-49133513 CCATCTCCAAAAAAAAAAAAGGG + Intergenic
1096158719 12:49358883-49358905 CCTTCACTTAAAAAAAAATGTGG + Intergenic
1096658838 12:53109373-53109395 GCATTGCCAAATATAAAATGGGG - Intronic
1096705511 12:53419283-53419305 CCATCTCAAAAAAAAAAAAGAGG - Intergenic
1097205080 12:57314182-57314204 CCATCTCAAAAAAAAAAATCAGG + Intronic
1097429232 12:59483368-59483390 CTATTACAAAAATAAAAAAGGGG - Intergenic
1097511558 12:60548200-60548222 CCATTTCAAAAAAAAAAAGGGGG + Intergenic
1098017435 12:66121008-66121030 CCATTACCAGAAAACATATTTGG - Exonic
1098270518 12:68765250-68765272 CCATTTCAAAAAAAAAAAATTGG + Exonic
1098453998 12:70651897-70651919 TCATTAAAAAAAAAAAAATTAGG + Intronic
1098736934 12:74117023-74117045 CTATTACCCAGAAAAAGATGGGG - Intergenic
1099210662 12:79784155-79784177 TCAATGCCAAAAAAAAAAGGTGG + Intronic
1099613575 12:84907974-84907996 CAATGACCAAAAAATAAATATGG + Intronic
1099662587 12:85583558-85583580 TCATTACTAAAAAAAAACTGAGG - Intergenic
1099986435 12:89670948-89670970 ACATTAAAAAAAAAAAAAAGGGG + Intronic
1099998113 12:89801776-89801798 CCATAACCACTAAAAAAATGTGG - Intergenic
1100027630 12:90149520-90149542 ACATTAAGAAAAAAAAACTGGGG - Intergenic
1100105043 12:91160176-91160198 ACATTAACAAACAAAAAATCAGG + Intronic
1100535538 12:95505488-95505510 CCATCTCAAAAAAAAAAATTTGG - Intronic
1100852997 12:98733132-98733154 CCAAAAACAAAAAAAAAAGGTGG - Exonic
1101042868 12:100774398-100774420 CCATGACCTAAAAAAATATTGGG - Intronic
1101249914 12:102922562-102922584 CCATTACAAAAGAATAAATAAGG - Intronic
1101308447 12:103554570-103554592 TTATTACAAAAAAAAAAAAGAGG + Intergenic
1101486649 12:105170466-105170488 CCTTTGTTAAAAAAAAAATGTGG - Intergenic
1101784419 12:107870515-107870537 CCACCACCAAAAAAAAAAGGTGG + Intergenic
1102120593 12:110437928-110437950 ACCTAACCAAAAAGAAAATGTGG + Intronic
1102358322 12:112259940-112259962 CCATAATAAAAAAAAAAATTGGG - Intronic
1102701051 12:114839833-114839855 CCATCTCAAAAAAAAAAAGGGGG - Intergenic
1102779626 12:115552909-115552931 CCATCTCAAAAAAAAAAAAGTGG + Intergenic
1102880589 12:116481916-116481938 CCCCCACCAAAAAAACAATGTGG + Intergenic
1102934852 12:116887789-116887811 CCATACCTGAAAAAAAAATGGGG + Intergenic
1103361099 12:120354433-120354455 CCATCTCAAAAAAAAAAAAGTGG - Intronic
1103362146 12:120360823-120360845 CCTTTTCCAAAAAAAAAAAAAGG - Intronic
1103590184 12:121986597-121986619 CAATTAAAAAAAAAAAAATTCGG - Intronic
1103757517 12:123220753-123220775 CCTTTAAGAAAAAAAAATTGTGG + Intronic
1105028022 12:132862593-132862615 CCGTCTCAAAAAAAAAAATGAGG - Intronic
1105259538 13:18768807-18768829 ACAGTAAAAAAAAAAAAATGGGG + Intergenic
1105893952 13:24702522-24702544 CTATTACCAAATAAAAAAGAAGG - Intronic
1105910051 13:24855625-24855647 CCATTAAAAAAAAAAAAAATTGG + Intronic
1106368816 13:29111431-29111453 CCAGTACCAGAACAAAGATGAGG + Intronic
1107347652 13:39479598-39479620 CGATTTCCAAAAGAAAAATCTGG - Intronic
1107454536 13:40542089-40542111 ACAGTACCAAAAAAAAAAATGGG + Intergenic
1108226681 13:48296564-48296586 CCATTAAGAAAACAAAAAAGAGG + Intergenic
1108464608 13:50702201-50702223 TCACTACCAAAAAAAAAATTAGG + Intronic
1108606295 13:52042464-52042486 CACTTACAAAAAAAAAAGTGTGG + Intronic
1108926088 13:55747639-55747661 CAAAAAACAAAAAAAAAATGTGG - Intergenic
1109410792 13:61965277-61965299 CAATTAACAATAAAACAATGTGG + Intergenic
1109471562 13:62813059-62813081 ACATAACCAAAAAAAAAAGAAGG - Intergenic
1109625279 13:64965795-64965817 CCATCTCAAAAAAAAAAAAGTGG + Intergenic
1109964793 13:69678309-69678331 CCATTCCAAAAAATAAAATGTGG - Intergenic
1109966913 13:69712256-69712278 GCCTTAAAAAAAAAAAAATGAGG - Intronic
1110078089 13:71275504-71275526 TAATTAAAAAAAAAAAAATGTGG + Intergenic
1110112324 13:71763531-71763553 CCATCTCAAAAAAAAAAATCAGG - Intronic
1110213123 13:72996067-72996089 TCATAACAAAAAAAAAAAAGCGG + Intronic
1110228010 13:73140163-73140185 CCATCTCCAAAAAAAAAAAAAGG - Intergenic
1110259430 13:73468514-73468536 CCATTAGCACACAAAAATTGAGG + Intergenic
1111092851 13:83470095-83470117 GAGTTACCAAAAAAATAATGGGG - Intergenic
1111119482 13:83827121-83827143 CTATAACAAAAAGAAAAATGAGG - Intergenic
1111208582 13:85046370-85046392 ACTTTTCCAAAAAATAAATGAGG + Intergenic
1111381877 13:87465812-87465834 CTATTTCCAAAAAGAAAATTTGG + Intergenic
1111422275 13:88028301-88028323 TCATTAAGAAAAAAAAAATCTGG - Intergenic
1111449714 13:88398925-88398947 CCAGAAGGAAAAAAAAAATGGGG - Intergenic
1111580107 13:90211564-90211586 CAACTACCAAAAAAAAAAAGGGG + Intergenic
1111590060 13:90334606-90334628 CCATTAGAAAAAGAAATATGGGG - Intergenic
1111971905 13:94925533-94925555 CCATCATCAACAAGAAAATGTGG - Intergenic
1112291391 13:98146230-98146252 CCATCTCAAAAAAAAAAATCAGG - Intronic
1112352413 13:98647178-98647200 CCATTACAAAAAAAATAACAAGG + Intergenic
1112371345 13:98796453-98796475 CCCTCACAAAAAAAACAATGTGG + Intronic
1112735871 13:102416210-102416232 ACATTACTAGAAATAAAATGGGG - Intergenic
1112870173 13:103961741-103961763 GCATTACCATGAAACAAATGAGG + Intergenic
1113315467 13:109174905-109174927 AAAATACAAAAAAAAAAATGTGG - Intronic
1113518470 13:110921131-110921153 CCATTAAAAAAAAAAAAAAAAGG + Intergenic
1113829266 13:113282094-113282116 CCATTAAGAAAACAAAAAGGTGG + Intergenic
1114084181 14:19227270-19227292 CCATCTCAAAAAAAAAATTGTGG - Intergenic
1114751633 14:25210559-25210581 CCATTAAAAAAAAAAAAAGGAGG - Intergenic
1115117687 14:29902253-29902275 CCATCTCCAAAAAAAAAAAAAGG + Intronic
1115506567 14:34099263-34099285 TTTTAACCAAAAAAAAAATGGGG - Intronic
1115633036 14:35264420-35264442 CTATTAAAAAAAAAAAAATTAGG - Intronic
1115830195 14:37329234-37329256 ACATTAAAAAAAAAAGAATGCGG + Intronic
1116037243 14:39642016-39642038 CAAAGACCAAAAAAAAAAGGGGG - Intergenic
1116899908 14:50351357-50351379 ACATTACCAAGAAAAAAAAATGG + Intronic
1118014541 14:61645341-61645363 TCATTAGTAAAAAAAAAATGAGG - Intronic
1118237085 14:64017005-64017027 CCATTTAACAAAAAAAAATGTGG + Intronic
1118454676 14:65933720-65933742 ACTTTAAAAAAAAAAAAATGGGG - Intergenic
1118480612 14:66161522-66161544 CCTATACCAAAAAAAAAATGTGG - Intergenic
1119013690 14:71025431-71025453 CCATTACCTACCAAAAAAGGTGG - Intronic
1119091562 14:71786831-71786853 CCATTTGTAAAAAAAAAATATGG - Intergenic
1119120547 14:72072248-72072270 CCACTTCCCAAAATAAAATGAGG - Intronic
1119461132 14:74805022-74805044 CCATTTCAAAAAAAAAAAAAAGG - Intronic
1119796241 14:77400147-77400169 ACTTTACCAAACAAAAATTGAGG + Intronic
1119887915 14:78159492-78159514 CCGTCTCAAAAAAAAAAATGAGG - Intergenic
1119904352 14:78287982-78288004 CCATCTCAAAAAAAAAAAGGGGG - Intronic
1120016311 14:79477908-79477930 TCATTACCAAAAACAAAACAGGG + Intronic
1120052840 14:79888102-79888124 GCATTATTAAAAAAAAAATTAGG - Intergenic
1120127936 14:80769234-80769256 CCTTTAAGAAAAAAAAAAAGAGG - Intronic
1120516351 14:85475822-85475844 CCCTTCCCCAACAAAAAATGAGG - Intergenic
1120954732 14:90071891-90071913 CCATCTCAAAAAAAAAAAAGAGG + Intronic
1121543076 14:94743067-94743089 CCATCTCAAAAAAAAAAATGGGG + Intergenic
1121684899 14:95828662-95828684 ACTTTACAAAAAAGAAAATGGGG + Intergenic
1122002862 14:98677311-98677333 TCATTACCAATAAAAAAGTCAGG - Intergenic
1122313169 14:100810173-100810195 CCATTAAAAAAAAAAAAAACAGG - Intergenic
1122467523 14:101944249-101944271 CCAGAGCCAAAAAAAAAAAGAGG + Intergenic
1122600901 14:102921340-102921362 CCATCTCAAAAAAAAAAAAGTGG - Intergenic
1122739685 14:103864860-103864882 CCATCTCAAAAAAAAAAAAGGGG - Intergenic
1122763454 14:104048053-104048075 CAATTTCCAACAAAAAAATTAGG - Intronic
1122995751 14:105262938-105262960 CCATTTAAAAAAAAAAAAAGTGG + Intronic
1123143606 14:106107338-106107360 CCATTAAGAAATAAAAAATCTGG - Intergenic
1123484333 15:20673772-20673794 ACATTACTTAAAAAAAAATGGGG + Intergenic
1123537060 15:21242740-21242762 ACATTACTTAAAAAAAAATGGGG + Intergenic
1123822178 15:24041977-24041999 CCGCTAATAAAAAAAAAATGTGG - Intergenic
1123829484 15:24119678-24119700 CCATCTCAAAAAAAAAAAAGTGG + Intergenic
1123859493 15:24449409-24449431 CCATCTCAAAAAAAAAAAAGTGG + Intergenic
1124127474 15:26949582-26949604 CCTGTCCCAAAAAAAAAGTGGGG - Intergenic
1124856794 15:33396932-33396954 TCATTACCAGAAAAATAAAGAGG - Intronic
1125514738 15:40311747-40311769 CCATCTCAAAAAAAAAAAAGTGG + Intergenic
1125598955 15:40905234-40905256 CCATCTCAAAAAAAAAAAAGAGG - Intergenic
1125693742 15:41617937-41617959 CCTTAACCACAAAAACAATGAGG + Intergenic
1126022421 15:44415877-44415899 CCGTTTCAAAAAAAAAAATTTGG - Intergenic
1126288368 15:47042804-47042826 CCATTATGAAAAACAGAATGGGG - Intergenic
1126319676 15:47408551-47408573 CTATAACCAAGAAATAAATGAGG + Intronic
1126422865 15:48493308-48493330 CCAATGCCAAAAAAAAAAGAGGG + Intronic
1126560518 15:50038092-50038114 TCATTAGCAAAAAAATAAGGGGG + Intronic
1126650070 15:50911176-50911198 ATATTAGCCAAAAAAAAATGGGG + Intronic
1126688956 15:51272961-51272983 CCATCTCAAAAAAAAAAGTGAGG - Intronic
1126825559 15:52544482-52544504 CCTGTCTCAAAAAAAAAATGTGG - Intergenic
1127274538 15:57430722-57430744 CCATCTCAAAAAAGAAAATGTGG - Intronic
1127594376 15:60464396-60464418 CAATAAGCAAAAATAAAATGTGG + Intronic
1128027531 15:64451115-64451137 CCATCTCAAAAAAAAAAGTGGGG - Intronic
1128079748 15:64849445-64849467 CCATCTCAAAAAAAAAAAAGAGG - Intronic
1128100402 15:64994027-64994049 CCATCTCAAAAAAAAAAATAAGG + Intergenic
1128424769 15:67530542-67530564 CCATTAAAAAAAAAAAAAAAAGG + Intergenic
1129122791 15:73412039-73412061 CCAAAAAAAAAAAAAAAATGAGG + Intergenic
1129319479 15:74766396-74766418 CCATTAAAAAAAAAAAAAAAAGG + Intergenic
1129346888 15:74927179-74927201 CCATCTCCAAAAAAAAAGTTAGG - Intronic
1129793194 15:78355756-78355778 ACAATACAAAAAATAAAATGAGG - Intergenic
1129913639 15:79248454-79248476 ACAAAACCAAACAAAAAATGTGG - Intergenic
1130117680 15:81019516-81019538 CCATCTCAAAAAAAAAAAGGAGG - Intronic
1130509450 15:84576702-84576724 CCATCTCAAAAAAAAAAATTGGG - Intergenic
1131233705 15:90678659-90678681 CCTTTATGAAAAAAAAAAAGTGG - Intergenic
1132488822 16:213389-213411 CCCTTCCAAAAAAAAAATTGTGG - Intronic
1133073290 16:3261132-3261154 CCGTCAAAAAAAAAAAAATGCGG - Intergenic
1133316877 16:4890390-4890412 CCACTTTAAAAAAAAAAATGAGG - Intronic
1133321730 16:4918286-4918308 CCATTTCAAAAAAAAAAAAAAGG + Intronic
1133769128 16:8857591-8857613 CCATTTCAAAAAAAAAAAAAAGG - Intronic
1134266197 16:12694779-12694801 CCATCTCAAAAAAAAAAAGGGGG - Intronic
1134863338 16:17581192-17581214 CCATTTCCACAGAAAAAAAGAGG - Intergenic
1135013114 16:18901936-18901958 CTATCTCCAAAAAAAAAAAGGGG + Intronic
1135438909 16:22449677-22449699 CTATCTCCAAAAAAAAAGTGGGG - Intergenic
1136330267 16:29571228-29571250 CTATCTCCAAAAAAAAAAGGGGG + Intergenic
1136386864 16:29932956-29932978 CCATTTCAAAAAAAAAAAAAAGG + Intergenic
1136528443 16:30848885-30848907 CCATCACAAAAAAAAAAAAAAGG + Intronic
1136574748 16:31116910-31116932 CCATCTCAAAAAAAAAAAAGGGG + Intronic
1136595254 16:31244641-31244663 CCATCTCAAAAAAAAAAAGGAGG - Intergenic
1136613002 16:31378466-31378488 GCTTTAAAAAAAAAAAAATGAGG - Intronic
1136968223 16:34941015-34941037 CCATCACCAAAAAATAAAAAAGG - Intergenic
1137027393 16:35491256-35491278 CCTTTAACAAAAAACTAATGTGG - Intergenic
1137561800 16:49507299-49507321 TATCTACCAAAAAAAAAATGTGG - Intronic
1137771624 16:51020283-51020305 ATGTTACCAAAAAAAAAATTGGG + Intergenic
1137977954 16:53046775-53046797 CCAAGAGCAAAATAAAAATGTGG + Intergenic
1138019046 16:53460296-53460318 CCATCATCAGAAATAAAATGGGG - Intronic
1138301906 16:55937534-55937556 ACAAAACCAAAAAAAACATGGGG + Intronic
1138322457 16:56127999-56128021 CCATCTCCAAAAAAAAAAAAAGG - Intergenic
1138820483 16:60253741-60253763 CCATCTCAAAAAAAAAAAGGGGG - Intergenic
1139019614 16:62731157-62731179 ACATTATCAGAAAAAAAAGGAGG - Intergenic
1139065493 16:63308052-63308074 CTATTAAAAAAAAAAAAATCAGG - Intergenic
1139741523 16:69039178-69039200 CCATCTCAAAAAAAAAAATTAGG + Intronic
1139758817 16:69167631-69167653 CTATTAACAAAAAAAAAAAAAGG + Intronic
1139807939 16:69585307-69585329 CAATTAAAAAAAAAAAAATTGGG - Intronic
1140111014 16:72004884-72004906 GCATTAAAAAAAAAAAAAAGAGG - Intergenic
1140315592 16:73893603-73893625 CTATTAAAAAAAAAAAAATAAGG - Intergenic
1140435449 16:74943237-74943259 CAATTAAAAAAAAAAAAAAGGGG - Intronic
1140772141 16:78214825-78214847 ATATTACCAAAAAAAAAAAAAGG + Intronic
1140782035 16:78305656-78305678 TCATTACCAAAACAAGAAAGGGG - Intronic
1141200871 16:81896600-81896622 CAAAAACCAAAAAAAAAGTGAGG + Intronic
1141207176 16:81941700-81941722 CCATCTCAAAAAAAAAAAAGGGG - Intronic
1141788985 16:86220196-86220218 ACAATAAAAAAAAAAAAATGAGG + Intergenic
1142447338 16:90149637-90149659 CCGTTTAAAAAAAAAAAATGTGG + Intergenic
1142831651 17:2553622-2553644 CAATAACCAGAAAAAAGATGTGG + Intergenic
1142874481 17:2843288-2843310 CCATTAAAAAAAAAAAAAAAGGG - Intronic
1143946250 17:10595283-10595305 CCATCTCCAAAAAAAAACTGTGG - Intergenic
1144081988 17:11771427-11771449 CCATTATTAAAAAATAAATTAGG - Intronic
1144338492 17:14293936-14293958 CCGTTACCCAAAAAAACAAGTGG + Intergenic
1144574602 17:16421212-16421234 CCGTCTCCAAAAAAAAAAAGGGG - Intronic
1144859948 17:18295155-18295177 CCGTCTCAAAAAAAAAAATGTGG - Intronic
1144942194 17:18949467-18949489 CCATGACCATTAAAAAGATGAGG - Intergenic
1145135141 17:20397347-20397369 CCATCTCAAAAAAAAAAAAGTGG + Intergenic
1145258514 17:21341056-21341078 CCATCTCCAAAAAAAAAAAGAGG + Intergenic
1145728027 17:27151775-27151797 ACATTTCAAAAAAAAAAATCAGG + Intergenic
1146379742 17:32319853-32319875 CCACTACCAAAAGAACACTGAGG - Intronic
1146415674 17:32630575-32630597 CCATTTCAAAAAAAAAAAGGAGG - Intronic
1146664579 17:34689376-34689398 ACATTACAAAAAAAAAAAGAAGG + Intergenic
1147116886 17:38307334-38307356 CCATCTCAAAAAAAAAAAGGGGG - Intronic
1147434050 17:40395982-40396004 CCATCTCAAAAAAAAAAAAGAGG - Intronic
1147487397 17:40830171-40830193 ACAATTGCAAAAAAAAAATGAGG - Intronic
1147525643 17:41219628-41219650 CCATCTCAAAAAAAAAAAAGTGG + Intronic
1147714317 17:42494227-42494249 CCATCTCAAAAAAAAAAAGGGGG + Intronic
1147801153 17:43089316-43089338 CCATCTCAAAAAAAAAAATTAGG + Intronic
1147841071 17:43371792-43371814 CCATCTCAAAAAAAAAAAAGCGG - Intergenic
1148024704 17:44578682-44578704 CCATCTCAAAAAAAAAAAGGGGG - Intergenic
1148155163 17:45419822-45419844 CCATTCACAGAAAAAAAAGGGGG + Intronic
1148412786 17:47482263-47482285 CCATCTCAAAAAAAAAAAAGGGG + Intergenic
1148725783 17:49788988-49789010 CCATACCCAACAGAAAAATGTGG + Intronic
1148888939 17:50793841-50793863 CCATCTCTAAAAAAAAAATCAGG + Intergenic
1149039087 17:52166055-52166077 GCATAACTAAAAAAAAAATATGG - Intergenic
1149456368 17:56791852-56791874 CCATCTCAAAAAAAAAAAAGTGG + Intergenic
1149611903 17:57963729-57963751 CCATTAAAAAAAAAATAAGGCGG + Intergenic
1149738657 17:59021394-59021416 CAAAAAACAAAAAAAAAATGTGG + Intronic
1149780478 17:59393433-59393455 CTATTATGAAAAAAAAAATTCGG - Intronic
1150096288 17:62378917-62378939 GTATAACAAAAAAAAAAATGTGG + Intronic
1150140153 17:62721361-62721383 ACAGTACCAAAAAAAAAAAGGGG - Intronic
1150245529 17:63671980-63672002 CATTTAAAAAAAAAAAAATGAGG + Intronic
1150258275 17:63767463-63767485 GCTTTACAAAAAAAAAAGTGGGG + Intronic
1150336538 17:64334511-64334533 CCATCTCAAAAAAAAAAATTGGG - Intronic
1150348822 17:64425804-64425826 CAATTAAAAAAAAAAAAATCTGG - Intergenic
1150571676 17:66392232-66392254 CAACAACAAAAAAAAAAATGTGG + Intronic
1150639422 17:66939498-66939520 CCATCTCCAAAACAAAAGTGGGG + Intergenic
1151628500 17:75293462-75293484 TCTTTACAAAAAAAAAAATCAGG - Intergenic
1151977590 17:77491220-77491242 CCTTTCTCAAAAAAAAAAAGGGG - Intronic
1153264365 18:3254975-3254997 CCAATACCAGAAAATAAATCGGG + Intronic
1153310262 18:3670479-3670501 CAATTACCAAAAAAGAATTGGGG - Intronic
1153414803 18:4834968-4834990 CCATTTGAAAAAATAAAATGAGG - Intergenic
1153516425 18:5906829-5906851 CCCTCACCAAAAAAAAAAAATGG - Intergenic
1153548663 18:6237889-6237911 TCATAAACAAAATAAAAATGAGG + Intronic
1153792934 18:8596221-8596243 CCTGTCTCAAAAAAAAAATGTGG - Intergenic
1154938380 18:21085337-21085359 CCATTTCAAAAAAAAAAAAAAGG + Intronic
1155345965 18:24857076-24857098 CCAGTTCCAAAAAAGGAATGGGG - Intergenic
1155558252 18:27046293-27046315 CCTTAACCAACCAAAAAATGAGG + Intronic
1155706273 18:28818100-28818122 CAATTACCAAATAATAAATTAGG - Intergenic
1155737472 18:29241580-29241602 CCATAATTAAAAGAAAAATGAGG - Intergenic
1155913797 18:31535911-31535933 CCATCTTCAAAAAAAAATTGAGG + Intronic
1155919262 18:31586653-31586675 CAATTAACAAAAATAAAATATGG + Intergenic
1156080842 18:33333173-33333195 CCATTATAAAAAAAAAATGGAGG - Exonic
1156455634 18:37292029-37292051 CCCTTATAAAAAAAAAAAAGAGG + Intronic
1157632181 18:49109026-49109048 GCATTAATAAAAAAAAAAAGGGG - Intronic
1157671752 18:49535966-49535988 CAATAACCAAAAAAAAAAAAAGG - Intergenic
1157768539 18:50324354-50324376 CCATCTCCAAAAAAAAAAGGGGG - Intergenic
1158141666 18:54262247-54262269 CCAAAAACAAACAAAAAATGAGG - Intergenic
1158252431 18:55504628-55504650 TCAATACCAAAAATAAACTGAGG + Intronic
1158518185 18:58148044-58148066 CAGTGACCAAAAAAAAAAGGGGG - Intronic
1158524306 18:58198444-58198466 CCATTCCCTAAAACAAAATTCGG - Intronic
1158609251 18:58923859-58923881 CCATCTCAAAAAAAAAAATATGG - Intronic
1158669551 18:59462682-59462704 CCATTTAAAAAAAAAAAATTAGG - Intronic
1158672137 18:59485899-59485921 TCATTAAAAAAAAAAAAATCTGG - Intronic
1159297352 18:66511679-66511701 GAATTACCTAAAAAAAAAGGGGG + Exonic
1159323815 18:66889765-66889787 CCACTATCACAAGAAAAATGAGG - Intergenic
1159524223 18:69567469-69567491 CCATTACCAAAAAAAAAATGAGG + Intronic
1159532545 18:69672689-69672711 CCACTATTAAAAAAAAAAAGGGG + Intronic
1160049969 18:75423858-75423880 CCATTAGTAAAAAAAAAATTTGG - Intronic
1160168157 18:76531447-76531469 CCATCTCAAAAAAAAAAAGGGGG + Intergenic
1160269177 18:77368513-77368535 CCAATACTGGAAAAAAAATGTGG - Intergenic
1160931795 19:1574292-1574314 CCATCTCAAAAAAAAAACTGTGG + Intronic
1160997093 19:1887689-1887711 CAACAACCAAAAAAAAAAAGAGG - Intergenic
1161091875 19:2364572-2364594 CCTTTATGAAAAAAAAAATTGGG + Intergenic
1161796175 19:6387932-6387954 CCATCTCAAAAAAAAAAATTTGG - Intronic
1162000486 19:7741892-7741914 CCATTCCTACAAAAGAAATGGGG + Exonic
1162162677 19:8730422-8730444 CCATCTCAAAAAAAAAAATGCGG - Intergenic
1162193911 19:8968767-8968789 CCTGTTTCAAAAAAAAAATGCGG + Intronic
1162665212 19:12204632-12204654 CCGTCTCCAAAAAAAAAAGGGGG + Intergenic
1162703555 19:12538323-12538345 CTATTAAAAAAAAAAAAATTTGG + Intronic
1162757783 19:12870662-12870684 CCAAAAAAAAAAAAAAAATGTGG + Intronic
1162773251 19:12963116-12963138 CAATTGGGAAAAAAAAAATGTGG - Intergenic
1162962836 19:14137826-14137848 CCATCTCAAAAAAAAAAAAGTGG - Intergenic
1163041346 19:14605098-14605120 CCGTCTCAAAAAAAAAAATGTGG - Intronic
1163259663 19:16180921-16180943 CCATCTCCAAAAAAAAAAAAAGG - Intergenic
1163412311 19:17162816-17162838 CCATCTCCAAAAAAAAATTATGG + Intronic
1163582802 19:18148295-18148317 CCATCTCAAAAAAAAAAATTAGG + Intronic
1163636661 19:18440133-18440155 CCTGTCTCAAAAAAAAAATGGGG + Intergenic
1164558181 19:29269468-29269490 CCATGAAAAAAAAAAAAAAGAGG + Intergenic
1164583880 19:29453348-29453370 ACCTTACCATAAATAAAATGTGG + Intergenic
1165484143 19:36085120-36085142 CCATCTCAAAAAAAAAATTGAGG - Intronic
1165582038 19:36874488-36874510 CCACTAAAAAAAAAAAAAGGGGG + Intronic
1165985754 19:39767427-39767449 CCCTTAAAAAAAAAAAGATGTGG + Intergenic
1165990230 19:39807001-39807023 CCATATCAAAAAAAAAAAAGTGG + Intergenic
1166051265 19:40261901-40261923 CCTTTAAAAAAAAAAAAACGGGG - Intronic
1166231925 19:41429620-41429642 CCATAAGAAAAAAAAAACTGTGG + Intronic
1166287055 19:41837688-41837710 CCATTTCAAAAAAAAAAAAAAGG + Intronic
1166464534 19:43020489-43020511 CTAGTAACAAAAAAAAAATTTGG + Intronic
1166538345 19:43590195-43590217 CCATTTCAAAAAAAAAAAGAAGG + Exonic
1166553673 19:43684046-43684068 CCATCTCAAAAAAAAAAAGGAGG + Intergenic
1166770829 19:45281055-45281077 CCATCTCAAAAAAAAAAATCGGG - Intronic
1167032667 19:46973684-46973706 CCATCTCAAAAAAAAAATTGAGG + Intronic
1167075477 19:47246048-47246070 CCATCTCAAAAAAAAAAAAGGGG - Intergenic
1167224400 19:48227796-48227818 CCATCACAAAAAAAAAAAAAAGG + Intronic
1167343620 19:48931369-48931391 TCTCTACCAAAAAAAAAAAGTGG - Intergenic
1168134784 19:54343022-54343044 CCCTGACCAAAAAAAAAATAAGG - Intergenic
1168454594 19:56496563-56496585 GGATTACCAGAAAACAAATGTGG + Intergenic
1168520987 19:57050381-57050403 CCTCCACCAAAAAAAAACTGGGG + Intergenic
1202633796 1_KI270706v1_random:24789-24811 CAATAAGCCAAAAAAAAATGTGG - Intergenic
925477328 2:4232003-4232025 CCATTGACAAATAACAAATGGGG - Intergenic
926113988 2:10199838-10199860 ACTTTACCTAAAAAAAAATCTGG - Intronic
926431740 2:12794018-12794040 CCATCACAAAAAAAAAAAAAAGG - Intergenic
926434264 2:12822628-12822650 CCCACACCAAAAATAAAATGTGG + Intergenic
926869776 2:17401811-17401833 CCATTAATAAAAACAGAATGAGG - Intergenic
926881285 2:17547049-17547071 CCATTCACAAACTAAAAATGAGG - Intronic
927386157 2:22536079-22536101 CCATTAAAAAAAAAAATCTGAGG - Intergenic
927865320 2:26584183-26584205 CTTTTACCAAAAAGAAACTGAGG + Intronic
928455162 2:31414058-31414080 CCTTTATGAAAAAAAAATTGTGG + Intronic
928501123 2:31896813-31896835 AAATTACCAAAATAAAAATTGGG + Intronic
929270590 2:39966905-39966927 CCATTAAAAAAAAAAAAAAAAGG + Intergenic
929408763 2:41672795-41672817 CCATTCCCAAAGAAAAAACTTGG + Intergenic
929505955 2:42528223-42528245 CTATTTCCAAAAAAAAAAGGGGG - Intronic
929649799 2:43666742-43666764 ACTTTACCAAAAAATAAATATGG - Intronic
930391223 2:50764020-50764042 CCTTTAGCAAAAAAAAAAAAAGG - Intronic
930558178 2:52926644-52926666 CCAATACAAAAAAAAATAAGTGG - Intergenic
930653564 2:53986339-53986361 CCATCAAAAAAAAAAAAAAGAGG - Intronic
931213124 2:60215982-60216004 ATATTACCAAAAAAAAAAAGGGG + Intergenic
931403935 2:61957584-61957606 TCATTACAAAAAAAATTATGTGG + Intronic
931541316 2:63332523-63332545 ACATTACCAAAGAAAAAATATGG - Intronic
931819231 2:65934899-65934921 CAATTAATAAAAGAAAAATGAGG - Intergenic
931922397 2:67035320-67035342 CCATGACAAAAAAAAAAAAGGGG - Intergenic
933312222 2:80675244-80675266 CCATCTCAAAAAAAAAAATATGG - Intergenic
933506678 2:83184779-83184801 AAATAACCAAATAAAAAATGAGG + Intergenic
933589820 2:84219847-84219869 CCATCTCAAAAAAAAAAAAGGGG - Intergenic
933891188 2:86772058-86772080 GCTTTAACAAAAAAATAATGAGG - Intronic
933891644 2:86777336-86777358 CCCTTCCCAAAAAAAAGATCAGG - Exonic
934054781 2:88242502-88242524 CCTATATCAAAAAAAAATTGTGG + Intergenic
934183011 2:89644720-89644742 CTATTAAAAAAAAAAAGATGAGG - Intergenic
934570214 2:95365925-95365947 CCATTACCACAATCAAGATGTGG + Intronic
934694215 2:96387232-96387254 CCATAATAAAAAAAAAAATGTGG - Intergenic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
935262609 2:101368281-101368303 CCATCTCAAAAAAAAAAAAGAGG + Intronic
935436279 2:103037814-103037836 ACATTTCCAAACAAAAACTGAGG - Intergenic
935981878 2:108635693-108635715 CCATCTCAAAAAAAAGAATGAGG + Intronic
936580497 2:113696490-113696512 CCATCTCAAAAAAAAAAATCTGG - Intergenic
936582261 2:113711504-113711526 CTGTTACTATAAAAAAAATGTGG + Intronic
936902282 2:117495184-117495206 CCTTTACCAAGAAAGAAAAGAGG - Intergenic
936988539 2:118336226-118336248 CTATTATCAAAAAAAAAAAAAGG - Intergenic
937166376 2:119822361-119822383 CCATCTCAAAAAAAAAAAAGGGG - Intronic
937176171 2:119937950-119937972 CCAAAACCAAAAAAAAAAAAAGG + Intronic
937246207 2:120495619-120495641 CCTTTCCTAAAAAAATAATGGGG + Intergenic
937515955 2:122655571-122655593 CCATCTCAAAAAAAAAAAAGGGG + Intergenic
938582930 2:132663608-132663630 CCTTTGCCAAAAATAGAATGTGG + Intronic
938620769 2:133050310-133050332 CTAAAAACAAAAAAAAAATGGGG + Intronic
938678339 2:133661971-133661993 ATATTGTCAAAAAAAAAATGTGG + Intergenic
939202714 2:139058736-139058758 CCATAAGTGAAAAAAAAATGTGG - Intergenic
939336935 2:140841817-140841839 CCTTTTCAAGAAAAAAAATGAGG + Intronic
939533762 2:143398772-143398794 CCATTTCAAAAAAAAAAATGAGG - Intronic
939877149 2:147590311-147590333 CAATTACAAAAAAAAAAAAAAGG + Intergenic
940553142 2:155187132-155187154 CCATTACTCAGAAAAATATGAGG - Intergenic
940673328 2:156697461-156697483 ACACTGGCAAAAAAAAAATGAGG - Intergenic
941033432 2:160539022-160539044 CCAATAGAAAAAAAAAAAAGTGG - Intergenic
941067599 2:160920795-160920817 CCATTACAAGAAAATAAATGGGG - Intergenic
941265433 2:163355954-163355976 CCAAAAACAAAAACAAAATGAGG + Intergenic
941612660 2:167680509-167680531 CTCCTACCAAAAAAAAAATTTGG - Intergenic
941699253 2:168586378-168586400 CTTCCACCAAAAAAAAAATGAGG - Intronic
941798957 2:169633833-169633855 CCATCTCAAAAAAAAAAAAGGGG - Intronic
941900908 2:170677088-170677110 CCGTCTCCAAAAAAAAAATACGG + Intergenic
942744943 2:179221310-179221332 CCATTAAAAAAAAAAAAATGGGG + Intronic
943044995 2:182849933-182849955 CAATTAACAAAAAGAAAAGGGGG + Intronic
943584627 2:189723521-189723543 TCATTCCAAGAAAAAAAATGAGG - Intronic
943941544 2:194003706-194003728 TCATTACCAAGAGAAAAGTGTGG + Intergenic
944803041 2:203254984-203255006 CCGTCTCCAAAAAAAAAAAGAGG + Intronic
944809710 2:203316194-203316216 CCATCTCAAAAAAAAGAATGGGG - Intergenic
944834765 2:203568169-203568191 AAATTACCATAAAAAATATGAGG - Intergenic
944987914 2:205199968-205199990 AAATTAAAAAAAAAAAAATGTGG + Intronic
945524795 2:210874764-210874786 CCATTCCTAACAAAAAACTGTGG - Intergenic
945543777 2:211123383-211123405 TCCTTAATAAAAAAAAAATGAGG + Intergenic
945576855 2:211542001-211542023 CAATAACAATAAAAAAAATGTGG - Intronic
945675570 2:212851698-212851720 CCATTATCAAAAACAAACAGTGG + Intergenic
945841956 2:214897521-214897543 CCATTACCAAACAAAAATATGGG + Intergenic
945999834 2:216472655-216472677 CCAGTAGGAAAAAAAAAAAGGGG + Intronic
946015310 2:216599487-216599509 CCATCTCCAAAAAAAAAAAAAGG - Intergenic
946277347 2:218641542-218641564 CCATTTAAAAAAAAAAATTGAGG - Intronic
946331656 2:219013023-219013045 CCAGTTCCAATTAAAAAATGAGG - Intronic
946964024 2:225017631-225017653 GCTTTGTCAAAAAAAAAATGTGG + Intronic
946970997 2:225091347-225091369 TCTTCAACAAAAAAAAAATGAGG - Intergenic
947397413 2:229700146-229700168 CAGTTAACACAAAAAAAATGGGG + Intronic
947541484 2:230982886-230982908 CTATTATTAAAAAAAAAATTTGG - Intergenic
947577937 2:231291808-231291830 CCATCTCAAAAAAAAAAAAGAGG + Intronic
948170557 2:235898396-235898418 CCATTTAAAAAAAAAAAAGGTGG + Intronic
948238363 2:236407774-236407796 CCACTGAAAAAAAAAAAATGAGG - Intronic
948246878 2:236494005-236494027 CATTTAAGAAAAAAAAAATGAGG + Intronic
1168797591 20:621829-621851 CCTGTCTCAAAAAAAAAATGGGG + Intergenic
1169083233 20:2810387-2810409 CTCTTAAAAAAAAAAAAATGTGG - Intergenic
1169583854 20:7058446-7058468 CCAAAAAAAAAAAAAAAATGGGG + Intergenic
1169765022 20:9139708-9139730 CCTTCTGCAAAAAAAAAATGTGG - Intronic
1169807343 20:9573095-9573117 CCATTTCAAAAAAAAAAAAGAGG - Intronic
1170154563 20:13257708-13257730 CCTTAAAAAAAAAAAAAATGAGG + Intronic
1170818158 20:19732576-19732598 TCAATACCAAAAAAAAAAAAAGG - Intergenic
1171567999 20:26213060-26213082 CCTGAACCAAAAAAAGAATGTGG + Intergenic
1171995841 20:31730682-31730704 CCTTTAAGAAAAAAAAAAAGGGG + Intergenic
1172004985 20:31812949-31812971 CCATTTCCAAAAGGAAACTGAGG - Intergenic
1172148051 20:32770910-32770932 ACATTACAAAAAAAAAATTTAGG - Intronic
1172257595 20:33533111-33533133 CTTTCACTAAAAAAAAAATGAGG + Intronic
1172299676 20:33840239-33840261 CCATCTCAAAAAAAAAAAAGGGG + Intronic
1172514760 20:35525546-35525568 CCATCTCAAAAAAAAAGATGAGG + Intronic
1172710154 20:36915730-36915752 CCATCTCCAAAAAAAAAAAAAGG + Intronic
1172856591 20:38008974-38008996 CTTTTAAAAAAAAAAAAATGAGG - Intronic
1172864198 20:38082782-38082804 CCATTAGCAAACAAACAATAAGG - Intronic
1172879189 20:38187423-38187445 CCATCTCAAAAAAAAAAATGTGG + Intergenic
1173510649 20:43625499-43625521 CCATCTCAAAAAAAAAAATAGGG + Intronic
1173513801 20:43650596-43650618 CTATTAAAAAAAAAAAGATGGGG + Intergenic
1173633704 20:44536372-44536394 TCATAATCAGAAAAAAAATGAGG + Intronic
1173651174 20:44665389-44665411 CCTTAAAAAAAAAAAAAATGGGG + Intergenic
1173670524 20:44795625-44795647 CCATCTCCAAAAAAAAAAATAGG + Intronic
1174006953 20:47418573-47418595 GCATTACAAAAAAAAAAAAGTGG - Intergenic
1174183242 20:48688082-48688104 CCCCAGCCAAAAAAAAAATGGGG + Intronic
1174195606 20:48770703-48770725 CCATCTCAAAAAAAAAAATCTGG + Intronic
1174247418 20:49192044-49192066 CCATCTCAAAAAACAAAATGAGG + Intergenic
1174254010 20:49240726-49240748 CCATTAAAAAAAACAAAAAGGGG - Intronic
1174368875 20:50073053-50073075 CCATCTCAAAAAAAAAAAAGGGG + Intergenic
1174813442 20:53666755-53666777 CCATCTCCAAAAAAAAAAAAGGG - Intergenic
1176175174 20:63718620-63718642 CTATTAAAAAAAAAAAATTGGGG - Intronic
1176189940 20:63803710-63803732 CCATTACAAAAACAAAAAGAAGG - Intronic
1176627974 21:9110561-9110583 CAATAAGCCAAAAAAAAATGTGG + Intergenic
1176913457 21:14596706-14596728 CAATTCCCATAAAAAAACTGAGG + Intronic
1177060402 21:16366782-16366804 CAACTACCAAAATAAAAATACGG + Intergenic
1177137586 21:17322567-17322589 CTATTAAAAAAAAAAAAAGGAGG + Intergenic
1177363007 21:20098710-20098732 CCATTTCAAAAAAAAAAAAAGGG - Intergenic
1177641389 21:23848231-23848253 CAATTAAAAAAAAAAAAAAGAGG - Intergenic
1177727395 21:24987367-24987389 CCAAAAAAAAAAAAAAAATGAGG - Intergenic
1177829980 21:26127194-26127216 TCATTTAAAAAAAAAAAATGAGG + Intronic
1178066417 21:28909193-28909215 CCATCTCTAAAGAAAAAATGAGG - Intergenic
1178122168 21:29480264-29480286 CCATCTCAAAAAAAAAAATATGG - Intronic
1178399262 21:32270233-32270255 CCAATACCAAATAAAGAAGGAGG + Intronic
1178547401 21:33503862-33503884 GCAATACCAAAAAAAAAAAGAGG + Intergenic
1178809293 21:35866746-35866768 ACATTCCAAAAAAAAAAAGGCGG + Intronic
1179056334 21:37938534-37938556 CCACTTCCATAAAGAAAATGTGG + Intergenic
1179518030 21:41922998-41923020 CCATCTCCAAAAAAAAAAAAAGG - Intronic
1179827646 21:43976009-43976031 ACATTAACAAAAATAAAATGTGG - Intronic
1179965986 21:44806148-44806170 CCATTACCAAATGAGAAATGTGG + Exonic
1180327525 22:11444027-11444049 CAATAAGCAAAAAAAACATGTGG - Intergenic
1180605272 22:17054156-17054178 ACATTATAAAAAAAAAAAGGTGG + Intergenic
1180646185 22:17341012-17341034 CCATAAAAAAAAAAAAAATCAGG - Intergenic
1180977941 22:19860783-19860805 AAATTAAAAAAAAAAAAATGTGG + Intergenic
1181290410 22:21788092-21788114 CTGTTTCCAAAAAAAAAAAGGGG + Intronic
1181557257 22:23678197-23678219 CCACTCCAAAAAAAAAAAGGAGG - Intergenic
1181685813 22:24527349-24527371 CTATCTCCAAAAAAAAAAAGGGG + Intronic
1181847532 22:25723941-25723963 ACTTTGCAAAAAAAAAAATGTGG + Exonic
1181895352 22:26102428-26102450 GCATAACCAAAGAAAAAATACGG + Intergenic
1182000503 22:26915874-26915896 CAATTACAAAGAAAAGAATGGGG - Intergenic
1182190591 22:28456209-28456231 CCGCCACTAAAAAAAAAATGTGG + Intronic
1182386324 22:29944989-29945011 TCATTTCCAGAAATAAAATGTGG - Intronic
1182487346 22:30647399-30647421 CAATTAAAAAAAAAAAAAAGTGG + Exonic
1182509509 22:30808947-30808969 CCGTCTCAAAAAAAAAAATGTGG + Intronic
1182577264 22:31281422-31281444 CCATCTCAAAAAAAAAAATCTGG + Intergenic
1182716151 22:32357469-32357491 CCATCTCAAAAAAAAAAAAGGGG - Intronic
1183081263 22:35458206-35458228 CCATTTCCAAAAAGACACTGAGG - Intergenic
1183621465 22:38975435-38975457 TCATTAAAAAAAAAAAAATCTGG + Intronic
1183818944 22:40328529-40328551 CCCTCACCCAAAAAAAAAAGTGG - Exonic
1184132458 22:42525166-42525188 CCATTAAAAAAGAAAAATTGAGG - Intergenic
1184209353 22:43026163-43026185 CCATCTCAAAAAAAAAAAAGGGG - Intergenic
1184215663 22:43065587-43065609 CCATCTCAAAAAAAAAAATTTGG - Intronic
1184539648 22:45112234-45112256 AAATTACCAAAAAAAAAAAATGG + Intergenic
949206114 3:1440484-1440506 CCATTAAAAAAAAAAAAAGAGGG + Intergenic
949486191 3:4541629-4541651 CCATCTCAAAAAAAAAAAAGTGG - Intronic
949619219 3:5791249-5791271 CCACAAAGAAAAAAAAAATGTGG - Intergenic
949790923 3:7791271-7791293 GCATTACAAAAAAAAATCTGGGG + Intergenic
950057034 3:10033395-10033417 CCATTTCCAAAAAACAAAAATGG + Intronic
950105891 3:10388211-10388233 AAATAAACAAAAAAAAAATGTGG + Intronic
950595848 3:13980797-13980819 TCTCTACCAAAAAAAAAATTTGG - Intronic
950741475 3:15055899-15055921 CCATTAAAAAAAAAAAAAAACGG - Intronic
951557299 3:23933644-23933666 GCAGGACCAAAAAAAAAGTGGGG - Intronic
951995594 3:28724580-28724602 CCATTATCGTAAACAAAATGAGG + Intergenic
952793929 3:37222392-37222414 CAATAACCAAAAACAAATTGTGG - Intergenic
953985695 3:47440905-47440927 CCATCTCAAAAAAAAAAAAGAGG - Intronic
954228007 3:49195415-49195437 CCATCTCAAAAAAAAAAAAGAGG + Intergenic
954244152 3:49317477-49317499 CCATCTCAAAAAAAAAAATAGGG - Intronic
954841151 3:53512968-53512990 CTATTTCCATAAAATAAATGTGG - Intronic
955271613 3:57505412-57505434 CCAAAACCAAAAACAAAATTAGG - Intronic
955375589 3:58393482-58393504 CCATTAATGAAAAAAAAATCAGG - Intronic
955446635 3:59018003-59018025 CCATTCCTAAAAGAATAATGTGG + Intronic
955880292 3:63537141-63537163 CTATTACTTAAAAAAAAATTAGG + Intronic
956028163 3:65006307-65006329 GATTTACAAAAAAAAAAATGAGG - Intergenic
956609351 3:71106622-71106644 CGATTAAAAAAAAAAAAAAGTGG - Intronic
956781919 3:72610519-72610541 CCATTTCAAAAAAAAGAATTAGG + Intergenic
957110844 3:75954931-75954953 CCTGAACCAAAAAAAGAATGTGG - Intronic
957668691 3:83271511-83271533 TCACTACCAGAAAAAAAAAGGGG + Intergenic
957735750 3:84200391-84200413 CCATCTGGAAAAAAAAAATGTGG - Intergenic
957779097 3:84795194-84795216 CCATTAAAAAAAAAAAAAAGAGG + Intergenic
957836518 3:85599157-85599179 GCATTGCCAAAAATAAACTGTGG - Intronic
958043649 3:88256406-88256428 GCTTTACTTAAAAAAAAATGAGG - Intergenic
958157812 3:89776749-89776771 ACATTAAAAAAAAGAAAATGTGG - Intergenic
958414342 3:93855976-93855998 CCATAGACAAAAATAAAATGAGG + Intergenic
958558206 3:95706558-95706580 TCTTTAAAAAAAAAAAAATGGGG - Intergenic
958916519 3:100056697-100056719 CCATTAAAAAAAAAAAAATGGGG + Intronic
958992480 3:100863319-100863341 CCATCTCAAAAAAAAAAAAGAGG - Intronic
959457069 3:106575803-106575825 CCATTTAGAAAAAAAAATTGTGG + Intergenic
959613080 3:108316672-108316694 ACTTTATCAAAGAAAAAATGTGG + Intronic
960113962 3:113874025-113874047 CCATCAGCAAAACAAAAGTGAGG - Intronic
960750258 3:120942578-120942600 CAATTACCAAAAAAAAAGGGAGG - Intronic
960849395 3:122036582-122036604 CCATTTCAAAAAAAAAAAAAAGG + Intergenic
960892653 3:122466238-122466260 CCATTTACCAAAAAAAAAGGTGG + Intronic
961090512 3:124107337-124107359 CCAACAGGAAAAAAAAAATGTGG - Intronic
961261205 3:125603538-125603560 CCTTTACCAAAAGAAAAAAAAGG + Intergenic
961697272 3:128714107-128714129 CCATCTCAAAAAAAAAAGTGGGG - Intergenic
962097252 3:132304860-132304882 TCATCTTCAAAAAAAAAATGGGG + Intergenic
962146620 3:132846384-132846406 CTATTTCAAAAAAAAAAAAGAGG + Intergenic
962447010 3:135475257-135475279 CCATTATGAAAAACAAGATGAGG - Intergenic
962878689 3:139555680-139555702 CCATTTAAAAAAAAAAAAGGTGG + Intergenic
963209732 3:142675680-142675702 CCCTTTCAAAAAAAAAAACGGGG - Intronic
963220212 3:142801067-142801089 CCTTTAACAAAATAGAAATGGGG + Intronic
963307285 3:143667207-143667229 ACCTGACCAAAAAAGAAATGGGG + Intronic
963385152 3:144583272-144583294 TCATTTACAAATAAAAAATGAGG + Intergenic
963386469 3:144600762-144600784 CTATGAAGAAAAAAAAAATGTGG - Intergenic
963786143 3:149536465-149536487 GCATGACAAAAAAAAAAAGGGGG + Intronic
963972094 3:151441646-151441668 CCATTACAGGACAAAAAATGAGG - Intronic
964030527 3:152133642-152133664 CCTTCACCAAAAAACATATGTGG + Intergenic
964329038 3:155580732-155580754 ACATTTCCAGAAAAAAAATACGG + Intronic
964765543 3:160175498-160175520 CCATTATCAAAAATTAAATTTGG + Intergenic
964789386 3:160437911-160437933 ACATTGCTAAACAAAAAATGGGG - Exonic
965539599 3:169859000-169859022 CCATCTCAAAAAAAAAAAGGGGG + Intronic
965621111 3:170643209-170643231 CCTTTACAAAGAAGAAAATGAGG - Intronic
966005186 3:175002113-175002135 CCATTACCTAAAAAAAATTTAGG + Intronic
966377888 3:179315485-179315507 CCATTAAGAAAAGAAAAACGAGG - Intergenic
966386175 3:179401053-179401075 AAACTACCAAAAAAAAAGTGGGG - Exonic
966646116 3:182247840-182247862 CCATCTCGAAAAAAAAAAAGAGG + Intergenic
966678938 3:182619615-182619637 CCATTTCAAAAAAAAAAGTGGGG + Intergenic
966805712 3:183805780-183805802 CCCTGTCCAAAAAAAAAAGGGGG + Intronic
966953130 3:184842924-184842946 TAATAACCAAAAAAAAAAAGAGG - Intronic
967034238 3:185636222-185636244 CCGTCTCCAAAAAAAAAAGGGGG - Intergenic
967061302 3:185875149-185875171 CCATCTCAAAAAAAAAAAAGAGG + Intergenic
968283969 3:197497421-197497443 CCATCTCCATAAAAAAAAAGTGG + Intergenic
969245069 4:5926617-5926639 CCTTTAAAAAAAAAAAATTGAGG - Intronic
969420525 4:7091912-7091934 CCATTATTAAAAAAAAAAGTTGG - Intergenic
970236452 4:13963642-13963664 CTTTTACCAAAAAAAAAAGGGGG - Intergenic
970272640 4:14363885-14363907 CTTTTGCCAAAAAAAAAATTAGG - Intergenic
970434227 4:16017815-16017837 CCATCTCAAAAAAAAAAGTGAGG + Intronic
970920384 4:21387261-21387283 CTATAACCAAGAAAAAAATAAGG + Intronic
971415380 4:26422209-26422231 ACATGACCAAAAAAAAAAAAGGG - Intronic
971568104 4:28171255-28171277 CCATTTAAAAAAAAAAAAAGAGG - Intergenic
971690664 4:29830899-29830921 GTATTACCAAAAAATAAATGAGG + Intergenic
971738766 4:30493084-30493106 GCAATACAAAAAAAAAACTGTGG - Intergenic
971928321 4:33044216-33044238 TCATTACCAAGAAAAAAATTTGG + Intergenic
972504941 4:39712127-39712149 CCATCTCCAAAAAAAAAAGGGGG - Intronic
972531213 4:39963017-39963039 CAATTAAAAAAAAAAAAATCAGG + Intronic
972619365 4:40732351-40732373 CCATCTCAAAAAAAAAAATCAGG - Intergenic
972788660 4:42349838-42349860 CCTGTCTCAAAAAAAAAATGTGG + Intergenic
973363428 4:49186803-49186825 CAATAAGCCAAAAAAAAATGTGG - Intergenic
973397666 4:49610055-49610077 CAATAAGCCAAAAAAAAATGTGG + Intergenic
973784435 4:54321794-54321816 CCACTACCAAACCAGAAATGGGG - Intergenic
974274813 4:59704932-59704954 CCATTAAAAAAAAAAAAAGGGGG + Intergenic
974686958 4:65242735-65242757 CCATTGCCATCAAAAACATGTGG + Intergenic
974745693 4:66072554-66072576 CTATTCCAAAAAAAAAAATGAGG - Intergenic
974831623 4:67196548-67196570 CCATCACAAAAAAAAAGAGGTGG - Intergenic
974913748 4:68154267-68154289 CCAAAGCCAAAAAAAAAAAGGGG - Intergenic
975381867 4:73709889-73709911 CCCCTGCCAAAAAAAAAGTGGGG - Intergenic
976190776 4:82484616-82484638 CCATGATCAAAGAAAAACTGAGG - Exonic
976215942 4:82715525-82715547 TCATTAATAAAAAAAAAATAAGG + Intronic
976377850 4:84365218-84365240 CCAAAAAAAAAAAAAAAATGGGG + Intergenic
976379391 4:84382096-84382118 GCATTTTCAAAAATAAAATGGGG - Intergenic
976496450 4:85735403-85735425 TCATTAGTAAAAAAAAAATCTGG - Intronic
977051513 4:92133853-92133875 CTATTTCGAAAAAAAAAATGAGG + Intergenic
977053851 4:92164214-92164236 CAATTTACAAAAAAAAAAGGGGG + Intergenic
977349485 4:95863155-95863177 CCATTACAAAAAACATATTGAGG + Intergenic
977997872 4:103516678-103516700 CCCTCATCAAAAAAAAATTGAGG - Intergenic
978151147 4:105436697-105436719 CAAATAACAAAAAAATAATGGGG + Intronic
978787307 4:112624456-112624478 CAATTAAAAAAAAAAAAATTGGG + Intronic
979068642 4:116171746-116171768 CCATTAAAAAAAAAAAAAGTGGG - Intergenic
979618622 4:122772788-122772810 GCATTAACTAAAAGAAAATGTGG - Intergenic
980271226 4:130586477-130586499 CAATTTCCAAAAAAATACTGTGG - Intergenic
980551973 4:134349410-134349432 CAAGTACCAAAATAAAAATCTGG + Intergenic
980609810 4:135144622-135144644 CCATTAGCAAAAGAAAAATATGG - Intergenic
980751047 4:137088920-137088942 TCATTATTAAAAAAAAAATAGGG + Intergenic
980871548 4:138616357-138616379 CCCTTTCCAAGAAAAAAATAAGG + Intergenic
980927440 4:139152337-139152359 CCATTTCAAAAAAAAAAAAATGG - Intronic
981278379 4:142928531-142928553 CCAGTGCCAAAAGAAAAAGGAGG + Intergenic
981514731 4:145595532-145595554 CCTTTACAGAAAAACAAATGCGG - Intergenic
982391839 4:154873354-154873376 CTATTAGCAAAAACAAAGTGTGG - Intergenic
982475624 4:155846628-155846650 CCATTGCAAAAATAAAACTGAGG - Intronic
982581890 4:157189198-157189220 CTATCTCAAAAAAAAAAATGGGG - Intergenic
982687452 4:158508211-158508233 CCATTACAAAAAAAACAGTATGG + Intronic
983204154 4:164895323-164895345 TCATTATTAAAAAAAAAATTAGG + Intronic
983248473 4:165317210-165317232 TTATTAAAAAAAAAAAAATGAGG + Intronic
983708354 4:170686125-170686147 CCAACACCAAAAAAAAAAAAAGG - Intergenic
983724401 4:170902466-170902488 CCATTTTGAAAAAAAGAATGAGG + Intergenic
984847229 4:184118026-184118048 CCAATACCCTAAAATAAATGAGG + Intronic
985768073 5:1791576-1791598 CCAAAAACAAAAAAAAAAAGGGG - Intergenic
985775927 5:1841784-1841806 CTTTAACCAAAAAAAAAAAGGGG + Intergenic
986376582 5:7138026-7138048 CTGTTACCATAAGAAAAATGGGG - Intergenic
986477970 5:8154849-8154871 CCAGTTCCAAGAAAAAAGTGTGG - Intergenic
986598225 5:9445367-9445389 CCATTAAAAAAAAAAAAAGTGGG + Intronic
987750530 5:22033035-22033057 CCAAAAAAAAAAAAAAAATGGGG + Intronic
988309126 5:29534873-29534895 CTATTCCAAAAAAAAAACTGAGG - Intergenic
988518495 5:31925338-31925360 AAGTTAACAAAAAAAAAATGAGG + Intronic
988840031 5:35074456-35074478 CCATTTCAAAAAAAAAAATGTGG + Intronic
989362310 5:40616399-40616421 CCAATACAAAAAAAAATGTGGGG + Intergenic
989601403 5:43204020-43204042 CCATCTCCAAAAAAAAAAAGTGG + Intronic
990025495 5:51182925-51182947 CCTTTACCAACAGAAAAATTAGG - Intergenic
990111917 5:52336883-52336905 ACCTGACCAAAAAAACAATGGGG - Intergenic
990577130 5:57134313-57134335 AGATTAAAAAAAAAAAAATGAGG - Intergenic
990972805 5:61528092-61528114 CAATTACCAAAAATAAAGTAGGG - Intronic
991123143 5:63039929-63039951 CAATCACCAAATAAATAATGGGG - Intergenic
991203604 5:64023384-64023406 ACAAAAGCAAAAAAAAAATGTGG + Intergenic
991532147 5:67627335-67627357 CAATGATAAAAAAAAAAATGTGG - Intergenic
991622606 5:68560422-68560444 CTATTACCAATAAAACAATTAGG - Intergenic
991643827 5:68780589-68780611 CAATTACCAAAAAACAAAAGTGG + Intergenic
991796578 5:70309302-70309324 CCTTTAAAAAAAAAAAAAAGAGG - Intergenic
992046442 5:72895350-72895372 ACATTAAAAAAAAAAAAAGGAGG - Intronic
992170697 5:74098830-74098852 CCAATAACAAGAAAAAAATGTGG - Intergenic
992518092 5:77517009-77517031 CCATCTCCAAAAAAAAAAAAAGG + Intronic
992638310 5:78746843-78746865 AGATTATGAAAAAAAAAATGGGG - Intronic
993198755 5:84784443-84784465 TGACTACAAAAAAAAAAATGTGG + Intergenic
994012524 5:94922490-94922512 CCATTTCAAAAAAAAAAGGGGGG - Intronic
994361713 5:98858222-98858244 CCATTACTAAAAGAAGAATAGGG + Exonic
994815024 5:104575154-104575176 CAAAAACCAAAAATAAAATGAGG + Intergenic
994874461 5:105399207-105399229 CTATTATAAAAAAAAAAAAGTGG - Intergenic
995157544 5:108932853-108932875 CCATCAAAAAAAAAAAAAAGTGG - Intronic
995625261 5:114069353-114069375 CCATTACCATAAAAAATGAGAGG - Intergenic
995637028 5:114204666-114204688 CCATTTCCAAAAACTAAAAGTGG - Intergenic
995806603 5:116059436-116059458 ACATGAACAATAAAAAAATGAGG - Exonic
995977966 5:118064490-118064512 CTAATTCCAAAAAAAAATTGAGG - Intergenic
996157778 5:120123939-120123961 CCATCTCCAAAAAAAAAAAGTGG + Intergenic
996218966 5:120904972-120904994 CAACTATTAAAAAAAAAATGAGG - Intergenic
996360196 5:122637076-122637098 CAAAAACCAAAAAAACAATGTGG - Intergenic
997015010 5:129922405-129922427 CCATTATGAAAAACAATATGGGG - Intronic
997172654 5:131739155-131739177 ACATTACAAAAGAAAAAATGAGG - Intronic
997244715 5:132337738-132337760 CCATCTCCAAAAAAAAAAAAAGG - Intronic
997840034 5:137231045-137231067 CCATCTCAAAAAAAAAAAAGGGG - Intronic
997927214 5:138041764-138041786 CCATCTCAAAAAAAAAAATTGGG + Intronic
997930190 5:138066497-138066519 CCTTTATAAAAATAAAAATGTGG + Intergenic
997986971 5:138509589-138509611 CCATTTCTATAAAAAAAATTAGG + Intronic
998270819 5:140704786-140704808 AAATTACAAAAAAAAAAATAAGG - Intronic
999032807 5:148313098-148313120 CCATTATCAAAAACACTATGAGG + Intronic
999488534 5:152025604-152025626 CCATCTCAAAAAAAAAAAGGGGG - Intergenic
999899186 5:156067965-156067987 CAATTAAAAAAAAAAAAGTGGGG - Intronic
999932832 5:156452335-156452357 GCATTATCCAAAGAAAAATGTGG - Intronic
1000281278 5:159784558-159784580 CGATTAGAAAAAAAATAATGGGG + Intergenic
1000780444 5:165473820-165473842 GCGTTACCTGAAAAAAAATGAGG + Intergenic
1000782507 5:165499936-165499958 CCTTTGCAAAAAAAATAATGAGG + Intergenic
1001187185 5:169585491-169585513 CAACTACCAAAATAAAAATAGGG - Intronic
1001570640 5:172728360-172728382 CCATCTCAAAAAAAAAAATGGGG + Intergenic
1001782416 5:174381536-174381558 CCTTAAGAAAAAAAAAAATGAGG - Intergenic
1001845992 5:174922116-174922138 CCATTAAAAAAAAAAAAAGAGGG - Intergenic
1002444229 5:179279433-179279455 TCATTACCAAAAGGAAGATGGGG - Intronic
1002501591 5:179650726-179650748 CCATCTCAAAAAAAAAAAAGAGG - Intergenic
1002585862 5:180247546-180247568 CCATGAACAAAACAAAAGTGAGG + Intronic
1002755709 6:157800-157822 CCATTTTGAAAAAAAAAATTTGG + Intergenic
1002991090 6:2239688-2239710 CCATTTCAAAAAAAAAAAAAAGG - Intronic
1002998603 6:2310168-2310190 CCATTAGAAAAAAAAAAAAAAGG + Intergenic
1003108512 6:3233714-3233736 CTATTAACAAAAGAAAAAGGAGG + Intronic
1003320409 6:5046149-5046171 CCATCTCAAAAAAAAAAAAGTGG - Intergenic
1004038784 6:11953142-11953164 CCATCTCAAAAAAAAAAATTAGG + Intergenic
1004090853 6:12499465-12499487 CCATTGATAAAAAAGAAATGGGG + Intergenic
1004379853 6:15123436-15123458 CATTTAAGAAAAAAAAAATGGGG - Intergenic
1004493242 6:16138314-16138336 ACTTTACAAAAAAAAAAAGGAGG + Intronic
1004600942 6:17149274-17149296 CCATCTCCAAAAAAAAAAAATGG + Intergenic
1004654372 6:17644640-17644662 CCATTATAAAAAAACAAATTCGG + Intronic
1005481739 6:26261368-26261390 CCAGTATCAAGAACAAAATGGGG + Intergenic
1005671732 6:28113252-28113274 CCATTAGCAGATAAAAAAAGTGG - Intergenic
1005750215 6:28875272-28875294 AAATTACAACAAAAAAAATGCGG - Intergenic
1005754233 6:28911203-28911225 CCATCAAAAAAAAAAAAGTGAGG - Intronic
1006120713 6:31803478-31803500 CCATCTCAAAAAAATAAATGTGG + Intronic
1006330254 6:33385232-33385254 TCATTAAAAAAAAAAAAAAGGGG - Intergenic
1006532886 6:34672105-34672127 CCATCTCAAAAAAAAAAAGGGGG - Intronic
1006564609 6:34944269-34944291 CCATCTCAAAAAAAAAAAAGTGG + Intronic
1006687193 6:35845690-35845712 TGATTACCAAACAGAAAATGAGG + Intronic
1006941578 6:37755164-37755186 CTTGTACCAAAAAATAAATGTGG + Intergenic
1007552569 6:42741430-42741452 TCAATAAAAAAAAAAAAATGAGG - Intergenic
1008301533 6:49846734-49846756 CCATTCATAAAATAAAAATGAGG - Intronic
1008513575 6:52299174-52299196 CCATCTCAAAAAAAAAAAAGGGG - Intergenic
1008714947 6:54276898-54276920 ACAATAACAAAAAAAAAATTGGG + Intergenic
1008881606 6:56385901-56385923 CCATTTCAAAAAAAAAAAAAAGG - Intronic
1008990256 6:57593303-57593325 CCATCTCAAAAAAAAAAAAGAGG - Intronic
1009741257 6:67748876-67748898 CCTTAATAAAAAAAAAAATGAGG + Intergenic
1010248165 6:73681604-73681626 CCATTTCAAAAAAAAAAAAGTGG - Intergenic
1010302808 6:74281656-74281678 CCATCTCAAAAAAAAAAAAGTGG - Intergenic
1010381515 6:75231099-75231121 CCACTAACAAAAGAAAAATGTGG + Intergenic
1010475179 6:76277778-76277800 CCATCAACAACAAAAAAATTGGG - Intergenic
1010496762 6:76542586-76542608 CTATTAGAAAATAAAAAATGAGG - Intergenic
1011046606 6:83090754-83090776 CCATTATAAAACAAAATATGGGG + Intronic
1011058800 6:83237897-83237919 CCACTAACAAAGACAAAATGGGG - Intronic
1011067913 6:83348682-83348704 ACATTAAAAAAAAAAAAAAGTGG + Intronic
1011645122 6:89450304-89450326 CCATCTCAAAAAAAAAAAAGAGG + Intronic
1011673396 6:89706940-89706962 CAATTAACAAAAAAAAAACATGG + Intronic
1012109337 6:95207706-95207728 TCATTATCTAAAAATAAATGTGG + Intergenic
1012713325 6:102636688-102636710 CCATTACAAAAGAAAACATGTGG - Intergenic
1012886399 6:104850996-104851018 CCTATGCCAAAATAAAAATGAGG + Exonic
1013096456 6:106949992-106950014 CTATTACCAAAAGAAGGATGAGG - Intergenic
1013201303 6:107898994-107899016 CCATTATCAAAAATCAAATCTGG + Intronic
1013226808 6:108124940-108124962 CCAGTAGCAAAAACAAAATGAGG - Intronic
1013314843 6:108931765-108931787 CCATCTCAAAAAAAAAAAAGTGG - Intronic
1013363781 6:109419414-109419436 CGATTAAAAAAAAAAAAAAGAGG + Intronic
1013374312 6:109499602-109499624 CCATCTCAAAAAAAAAAATTAGG - Intronic
1013452503 6:110298547-110298569 CAAATACAAAAAAAAAAATCGGG - Intronic
1013529062 6:111002501-111002523 CCATTTCTTAAAAAAAAATGTGG - Intronic
1013973396 6:116047394-116047416 CAATTAAAAAAAAAAAAAAGAGG - Intronic
1014162735 6:118188544-118188566 CCATTTCAAAAAAAAAAAAAAGG + Intronic
1014605280 6:123466223-123466245 TCATTAGCAAAGAAAAAATAAGG + Intronic
1014925521 6:127266437-127266459 CCCTTTCAAGAAAAAAAATGGGG - Intergenic
1015138651 6:129904013-129904035 GCATTACTAAAAAAAAAATAAGG + Intergenic
1015324593 6:131909891-131909913 TCATTAAAAAAAAAAAATTGTGG - Intergenic
1015385986 6:132624049-132624071 CATTTATCAAAGAAAAAATGAGG - Intronic
1015965123 6:138690438-138690460 TTATTAAAAAAAAAAAAATGGGG + Intronic
1016176710 6:141085387-141085409 CTAATACCAAAAAAAAAAAAAGG + Intergenic
1016822816 6:148362225-148362247 CCATCTCAAAAAAAAAAAAGAGG - Intronic
1016938431 6:149465748-149465770 CCATCTCAAAAAAAAAAAAGGGG + Intronic
1017062546 6:150498851-150498873 CTATTACCATAAAACTAATGTGG + Intergenic
1017118712 6:151003526-151003548 CCATATCCAAAAAAAAAGGGGGG + Intronic
1017159978 6:151355599-151355621 CCATTAAAAAAACAAAGATGGGG - Intronic
1017248942 6:152259271-152259293 ACATTTCTAAAAAAAAAATTAGG - Intronic
1017325731 6:153139694-153139716 CAATAACCAAATAGAAAATGAGG + Intergenic
1017450012 6:154546392-154546414 ACAAAACCAAAAAAAAAAAGAGG - Intergenic
1017540266 6:155394654-155394676 CAATGACCAAATAGAAAATGTGG - Intergenic
1017601133 6:156082523-156082545 AGTTTACGAAAAAAAAAATGAGG - Intergenic
1017850860 6:158304669-158304691 CCATCTCAAAAAAAAAAATAAGG - Intronic
1018118269 6:160610128-160610150 CCATGACCAGAAAATAAATCAGG - Intronic
1018213952 6:161508846-161508868 CCATCTCCAAAAAAAAAAAAAGG - Intronic
1018492918 6:164315089-164315111 CAAGTTGCAAAAAAAAAATGTGG - Intergenic
1018877950 6:167842248-167842270 TCATTACCAAGAAAAAAAAAGGG - Intronic
1019830643 7:3325110-3325132 GCATCACCAAAAAAAAAAAGTGG - Intronic
1020119902 7:5497193-5497215 CCATTTTTAAAAAAAAAAAGTGG + Intronic
1020577522 7:9952719-9952741 GCACTATGAAAAAAAAAATGAGG - Intergenic
1021252607 7:18349700-18349722 TCCTGACAAAAAAAAAAATGTGG + Intronic
1021254534 7:18374917-18374939 CCATCACCAAAAAACACGTGAGG - Intronic
1021743955 7:23719419-23719441 CTCTAACCAAAAAAAAAGTGGGG + Intronic
1022269487 7:28792496-28792518 GCATTTCCAACCAAAAAATGAGG - Intronic
1022369915 7:29760841-29760863 GCAGTAGCAAAAAAAAAATGTGG + Intergenic
1022435787 7:30383574-30383596 CAATTTCCATAAACAAAATGTGG - Intronic
1023612222 7:41982538-41982560 CCATGTCTAAAAAAAAAATCAGG + Intronic
1023612824 7:41988457-41988479 CCATCTCAAAAAAAAAAAGGGGG + Intronic
1024957987 7:54945998-54946020 CAATAACCAAAAAAAAAAGTAGG + Intergenic
1025015226 7:55434110-55434132 CCATCTCAAAAAAAAAAAAGTGG + Intergenic
1025113108 7:56235876-56235898 CCATAAAAGAAAAAAAAATGAGG + Intergenic
1025193744 7:56916444-56916466 CCATCTCAAAAAAAAAAATGTGG + Intergenic
1025791078 7:64687298-64687320 CCATTACAAATAAAAAACTGAGG + Intronic
1025797087 7:64748570-64748592 GCATTGCCAAATATAAAATGGGG - Intergenic
1025806986 7:64843375-64843397 TCATTACAAAAAACAAAATAAGG - Intergenic
1025823019 7:64988324-64988346 TCATTACAAAAACAAAAATAAGG + Intronic
1025960538 7:66216998-66217020 CAATAACCAAAAAAAAAGTTTGG - Intronic
1025975221 7:66364324-66364346 CAATGACCAAAATAAAAAGGAGG + Intronic
1026057537 7:66997316-66997338 CTCTTAAAAAAAAAAAAATGAGG + Intronic
1026138769 7:67686654-67686676 CCATTAAAAAAAAAAAATTCAGG + Intergenic
1026232451 7:68497029-68497051 CCATTAGCAAAAGATAAATATGG - Intergenic
1026382152 7:69810507-69810529 CAATGATCAAAAAAAAACTGAGG - Intronic
1027014833 7:74773192-74773214 CCATCTCAAAAAAAAAAAAGTGG + Intergenic
1027169418 7:75860530-75860552 TCAATAACAGAAAAAAAATGTGG - Intronic
1027282312 7:76617686-76617708 CCATCTCCAAAAAAAAAAAAAGG - Intronic
1027337388 7:77166783-77166805 CCAGTACAAAAAAACAAATCTGG - Intronic
1028408067 7:90498028-90498050 CCATCTCAAAAAAAAAAAGGGGG - Intronic
1028681742 7:93543091-93543113 CAAAAACCAAACAAAAAATGTGG - Intronic
1028695420 7:93705148-93705170 CCTTTAGAAAAAAATAAATGGGG - Intronic
1028733155 7:94176501-94176523 CCATAAATTAAAAAAAAATGGGG + Intergenic
1028893940 7:96020027-96020049 CTATTATAAAAAAAAAAATAAGG + Intronic
1029002007 7:97164230-97164252 CCGTCTCCAAAAAAAAAAAGAGG - Intronic
1029191296 7:98774143-98774165 CCATCTCAAAAAAAAAAAAGTGG + Intergenic
1029228946 7:99050201-99050223 CCATCTCCAAAAAAAAAAATAGG + Intronic
1029461771 7:100698526-100698548 CCATTAAAAAAAAAAAAGTGGGG - Intergenic
1029643949 7:101839669-101839691 CCATTTAGAAAAAAAAAAAGAGG - Intronic
1029807941 7:103016297-103016319 CCGTTACAAAAACAGAAATGTGG + Intronic
1030185995 7:106762558-106762580 CCCTTACAAAATAAAAAATCAGG - Intergenic
1030232410 7:107222202-107222224 CCATCTCAAAAAAAAAAAAGGGG - Intronic
1030256715 7:107517700-107517722 CCATCACAAAAAAAAAAAAAAGG - Intronic
1030351827 7:108498269-108498291 CCATCTCAAAAAAAAAAATCTGG - Intronic
1031323810 7:120366481-120366503 CCATTAAAAAAAAAAAAAAAGGG + Intronic
1031600355 7:123700443-123700465 CCATCTCAAAAAAAAAAAAGAGG - Intronic
1031713284 7:125075749-125075771 CCATTACAAAAAAGAAAAATTGG - Intergenic
1031736596 7:125370738-125370760 CCATCTCTGAAAAAAAAATGCGG + Intergenic
1033373687 7:140736429-140736451 CCATCTCCAAAAAAAAAAAGTGG - Intronic
1033580617 7:142730344-142730366 CCAAAAAGAAAAAAAAAATGGGG + Intergenic
1033638744 7:143239381-143239403 GCATGTCCAAAAAAAAAGTGGGG + Intergenic
1033722552 7:144076937-144076959 ACATAACCAAAAAAAAAGTGGGG + Intergenic
1033991930 7:147298418-147298440 CCATCACAAAAAAAAAAGAGGGG + Intronic
1034525420 7:151657130-151657152 CCATCTCAAAAAAAAAAAGGGGG + Intronic
1034975065 7:155443629-155443651 CTAGTACCAAAAAAAAAAATTGG - Intergenic
1035003467 7:155636624-155636646 CTATCACTAAAAAAAAAACGAGG - Intronic
1035104017 7:156427054-156427076 CCAATCCAAAAAAAAAAATAAGG - Intergenic
1035655402 8:1301440-1301462 TCATTAAGAAAAAAAAAAAGTGG - Intergenic
1035868892 8:3115203-3115225 CCATCTCAAAAAAAAAAAAGGGG - Intronic
1036939306 8:13036352-13036374 CATTTACAAAAAAAAAAAAGAGG + Intergenic
1037040842 8:14230743-14230765 CCACCACCAAAAAAAAAAGAAGG - Intronic
1037046176 8:14306759-14306781 CCCTGATCAAATAAAAAATGTGG + Intronic
1037197427 8:16207650-16207672 TCCTTTCCAAAAAAAAAATAAGG - Intronic
1037426254 8:18757977-18757999 CCACTCTAAAAAAAAAAATGGGG - Intronic
1038072062 8:24028158-24028180 CCATCTGGAAAAAAAAAATGTGG + Intergenic
1038098826 8:24348679-24348701 CCATTACCAGAAACAAGAAGAGG + Intronic
1038202010 8:25421726-25421748 CCATTTCCACCAAAAAATTGTGG + Intronic
1038246369 8:25860041-25860063 CCCTGGGCAAAAAAAAAATGAGG + Intronic
1038776195 8:30533132-30533154 CAGTTACAAAAAATAAAATGAGG - Intronic
1038815323 8:30897207-30897229 ACCTTACCAAAACACAAATGAGG - Intergenic
1038988136 8:32835828-32835850 CCACACCCAAAAAAAAAATCAGG - Intergenic
1039139088 8:34363155-34363177 CAATTTCTAAAAAAAAAACGAGG + Intergenic
1039963611 8:42268569-42268591 CCATCTCAAAAAAAAAAATTTGG - Intergenic
1040068333 8:43167728-43167750 TCATGACCAAAAAATAAAAGGGG + Intronic
1040682868 8:49835103-49835125 CCATTACAAAAGAAAACTTGTGG - Intergenic
1040800052 8:51330383-51330405 GCAATATTAAAAAAAAAATGTGG + Intronic
1041140160 8:54809150-54809172 CCTTTACCTAGAAAGAAATGTGG + Intergenic
1041483453 8:58348625-58348647 CCATGTTCAAAATAAAAATGAGG + Intergenic
1041506075 8:58599129-58599151 ACAATACCAACAAAAAAATGAGG - Intronic
1041518959 8:58733585-58733607 CCATTACAAGAAAAGACATGTGG + Intergenic
1041522612 8:58772211-58772233 CCAGTACAAAATAAAATATGAGG + Intergenic
1042703217 8:71639534-71639556 CCCATACCAAAAAATCAATGTGG - Intergenic
1042934215 8:74042512-74042534 CCATCTCAAAAAAAAAAATTTGG + Intergenic
1043124888 8:76379892-76379914 CCATTTCAAATAAAAGAATGAGG - Intergenic
1043523382 8:81071013-81071035 ACTTTACCAAAAAAGAAAAGAGG - Intronic
1044010324 8:86985910-86985932 ACAATAACAAAAAAACAATGAGG - Intronic
1044255207 8:90052088-90052110 ACATTAAAAAAAAAAAAAGGAGG + Intronic
1044328261 8:90885453-90885475 CTATGACCAAAAAGAGAATGAGG + Intronic
1044361482 8:91289866-91289888 ATATTACCAAAGAAAATATGAGG + Intronic
1044443420 8:92246195-92246217 CCATTACCAAAAAAAAAAGGTGG - Intergenic
1045010683 8:97956190-97956212 CCATCTCAAAAAAAAAAAAGTGG - Intronic
1045041081 8:98225416-98225438 GCTTTACCGAAATAAAAATGGGG - Intronic
1045195108 8:99922797-99922819 CCAATCCCAAAAAAAATCTGTGG - Intergenic
1045399464 8:101797808-101797830 CCATCTCAAAAAAAAAAAAGAGG + Intronic
1045452295 8:102339523-102339545 CCATCACAAAAAAAAAAAAAAGG + Intronic
1045668428 8:104517835-104517857 CCATCTCCAAAATAAAAATTTGG + Intronic
1045946340 8:107801189-107801211 CCATTTCCTAAGAGAAAATGAGG - Intergenic
1045961422 8:107973263-107973285 CCATCTCAAAAAAAAAAATGGGG + Intronic
1046290401 8:112151961-112151983 GCAATAGCAAAAAATAAATGTGG - Intergenic
1046374724 8:113361950-113361972 CCAATCTCAAAAGAAAAATGAGG + Intronic
1046889628 8:119408290-119408312 CCATTATCCTAAAAAAAATAAGG + Intergenic
1046927880 8:119812321-119812343 AAATTAAAAAAAAAAAAATGAGG - Intronic
1047313072 8:123708542-123708564 CCATTTCCAAAGGAGAAATGAGG - Intronic
1047337332 8:123949345-123949367 ACAGCATCAAAAAAAAAATGAGG + Intronic
1047394900 8:124487997-124488019 CCATTTCTAAAGAAAAACTGAGG - Intergenic
1047581456 8:126220596-126220618 GGATTGCCAAAATAAAAATGAGG - Intergenic
1047668063 8:127114271-127114293 TCATTACCAAAATAAAGATTTGG - Intergenic
1047836000 8:128692630-128692652 CCAACACCAAAAAGAAAATCAGG - Intergenic
1047884548 8:129234636-129234658 CCCTTATGAAAAAAAAAATGTGG - Intergenic
1049143014 8:140974903-140974925 TCATCACCAAAGAAAAAATCTGG + Intronic
1049146451 8:141004213-141004235 CCATCTCAAAAAAAAAAATTAGG + Intergenic
1049292095 8:141809372-141809394 CCATCTCAAAAAAAAAGATGGGG + Intergenic
1050100790 9:2117506-2117528 ACATTTCCAAAAAAACAATATGG + Intronic
1050287156 9:4115339-4115361 GCATTTCCAAAAGAAGAATGTGG + Intronic
1050390889 9:5143230-5143252 CTATTAAAAAAAAAAAATTGAGG - Intronic
1050676840 9:8065285-8065307 ACATTAAAAAAAAAAAAAGGAGG - Intergenic
1050829436 9:9991883-9991905 CCATTAACATAAAGAAAAGGTGG + Intronic
1051160563 9:14203161-14203183 GCTTTAGGAAAAAAAAAATGTGG - Intronic
1051422646 9:16904045-16904067 CCATAACCAAAAATGAAATGTGG + Intergenic
1051589766 9:18765825-18765847 CTATTATAAAAAATAAAATGAGG + Intronic
1051631612 9:19146102-19146124 CTATTAAAAAAAAAAAAAAGAGG - Intronic
1051764053 9:20502075-20502097 CCATCTCAAAAAAAAAAAAGGGG + Intronic
1051852122 9:21521612-21521634 CCTGTAACAAAAAAAAAAAGTGG - Intergenic
1051920923 9:22263061-22263083 CCCCTACAAAAAAAAAAATTAGG - Intergenic
1052583819 9:30397700-30397722 TTATTATCAAAAACAAAATGAGG + Intergenic
1052810118 9:33050819-33050841 CCATCTCAAAAAAAAAAATAAGG + Intronic
1052938608 9:34114102-34114124 CCGTCTCAAAAAAAAAAATGTGG + Intronic
1052952942 9:34228576-34228598 CCATCTCCAAAAAAAAAAGGGGG - Intronic
1053574663 9:39346142-39346164 CCATCTCCAAAAAAAAAAAGAGG - Intergenic
1053685622 9:40518330-40518352 ACATCACCAAAAAAATAAAGAGG + Intergenic
1053784272 9:41643131-41643153 TCAGCACAAAAAAAAAAATGTGG - Intergenic
1054096227 9:60904832-60904854 CCATCTCCAAAAAAAAAAAGAGG - Intergenic
1054278107 9:63106631-63106653 ACATCACCAAAAAAATAAAGAGG - Intergenic
1054298710 9:63353786-63353808 ACATCACCAAAAAAATAAAGAGG + Intergenic
1054396730 9:64658302-64658324 ACATCACCAAAAAAATAAAGAGG + Intergenic
1054431371 9:65163505-65163527 ACATCACCAAAAAAATAAAGAGG + Intergenic
1054499006 9:65858020-65858042 ACATCACCAAAAAAATAAAGAGG - Intergenic
1054779628 9:69154622-69154644 CCATTAAAAAAAAAAAAAGAAGG + Intronic
1054846367 9:69802771-69802793 CTATTACCAGAACGAAAATGTGG + Intergenic
1054880271 9:70137111-70137133 ACATTACAAAAAAAAAGATTAGG - Intronic
1055023673 9:71696469-71696491 CCATTAAAAAAAAAAAAAATTGG + Intronic
1055149137 9:72974143-72974165 CCATTTCCAAATAAGAAATTAGG + Intronic
1055942743 9:81665858-81665880 TCTTTAAAAAAAAAAAAATGAGG - Intronic
1055946215 9:81693486-81693508 CAATTAAAAAAAAAAAAAGGTGG - Intergenic
1056071629 9:82993029-82993051 CCAGGAAGAAAAAAAAAATGGGG + Intronic
1056446336 9:86669765-86669787 CCATTACCAGGAAAAAAACAGGG - Intergenic
1056599338 9:88034385-88034407 CCATTTCAAAAAAAAAAAAAGGG - Intergenic
1056717904 9:89048237-89048259 CCATTAAAAAAAAAAAAAAAAGG + Intronic
1056930999 9:90877344-90877366 CCATTACTAAAAAAGAATGGTGG - Intronic
1057043170 9:91862323-91862345 CCATCACCAAAAAAAAAAGGAGG + Intronic
1057091442 9:92261753-92261775 CCATCTCAAAAAAAAAAAGGGGG - Intronic
1057135596 9:92685509-92685531 CCATTTCAAAAAAAAAAAAGAGG + Intergenic
1057361566 9:94378119-94378141 CCATTTCCAAAAAAAAAAAAAGG + Intronic
1057789238 9:98112062-98112084 CTGTTAACAAAAAAAAATTGAGG + Intronic
1058286133 9:103181244-103181266 TTATTAAAAAAAAAAAAATGAGG + Intergenic
1058818967 9:108711752-108711774 CCTGTCTCAAAAAAAAAATGAGG - Intergenic
1058869752 9:109191709-109191731 CAATTTCCAAAAAAAAAACATGG - Intronic
1058967617 9:110051905-110051927 CCATTTCAAAAAAAAAAAAAAGG - Intronic
1059185313 9:112263688-112263710 CCATTAGCAAAACATAAATGGGG + Intronic
1059683581 9:116611341-116611363 CCATTTCAAAAATTAAAATGCGG + Intronic
1059749575 9:117235235-117235257 CAATTAAAAAAAAAAAAAGGCGG + Intronic
1059946773 9:119417201-119417223 CCCTAAAGAAAAAAAAAATGGGG + Intergenic
1060506390 9:124201255-124201277 CCATCTCAAAAAAAAAAAAGGGG - Intergenic
1060624857 9:125102600-125102622 CCATCTCAAAAAAAAAAAAGTGG - Intronic
1060774496 9:126362836-126362858 CCATTTTAAAAAATAAAATGAGG - Intronic
1060924864 9:127449244-127449266 CCATTACCAAAACCAAACTAGGG + Intronic
1061681177 9:132243080-132243102 CCTTTCCCAAAAAAGAAATCCGG + Exonic
1061692369 9:132343954-132343976 TCATGGCCAAAAAAAAGATGAGG + Intronic
1203483170 Un_GL000224v1:26101-26123 CAATAAGCCAAAAAAAAATGTGG - Intergenic
1185868373 X:3642663-3642685 CCTTTATCCAAAAAAAAAAGTGG + Intronic
1186207858 X:7218808-7218830 CCATGACAAAACAAAAAAAGAGG - Intergenic
1186443292 X:9604404-9604426 CCACTGGCAAAAAAAAAAGGGGG - Intronic
1186504956 X:10083712-10083734 TCAATACCAGAAAAATAATGAGG - Intronic
1186524847 X:10238817-10238839 CCATTTCAAAAAAAAAAAAAGGG + Intergenic
1186781227 X:12914187-12914209 CCATTTAGAAAAAAATAATGTGG + Intronic
1187015436 X:15323115-15323137 CTTTAACCAAAAGAAAAATGTGG + Intronic
1187156967 X:16729230-16729252 GCATTGCCAAATATAAAATGGGG - Intronic
1187808045 X:23142890-23142912 CCATCAACAAAAAAAAAAAGGGG + Intergenic
1187956352 X:24522899-24522921 CCATCTCAAAAAAAAAAAAGAGG + Intronic
1188357651 X:29212311-29212333 CCATTTTGAAAAAAAAATTGGGG - Intronic
1188703565 X:33297405-33297427 CCATTACAAAAAAAATAGTAGGG + Intronic
1189055034 X:37689965-37689987 CCAGTAATAAAAAAGAAATGAGG - Intronic
1189451062 X:41131034-41131056 CTCTTACCAAAAAAAAAAAGGGG + Intronic
1189555630 X:42142377-42142399 CCAAAAACAAAACAAAAATGAGG - Intergenic
1189565611 X:42238128-42238150 CCATTACCAAAAGTAATCTGTGG + Intergenic
1189789664 X:44591178-44591200 CCATCTCAAAAAAAAAAATCTGG + Intergenic
1190396108 X:49986836-49986858 CCATGATCAAGAAAAAATTGGGG - Intronic
1190684277 X:52856682-52856704 GCTTTTCTAAAAAAAAAATGAGG + Intergenic
1191000142 X:55651109-55651131 CTATTCTAAAAAAAAAAATGAGG + Intergenic
1192473555 X:71420067-71420089 CCCTTACTAAAAAAAGTATGAGG - Intronic
1192666175 X:73088292-73088314 CCATTATCAAAAAATAAAATTGG + Intergenic
1193778303 X:85671212-85671234 ACATTAAAAAAAAAAGAATGGGG + Intergenic
1193792859 X:85837484-85837506 CTAAGACAAAAAAAAAAATGAGG + Intergenic
1193820894 X:86163422-86163444 ACATTAAAAAAAAGAAAATGTGG - Intronic
1193932886 X:87578822-87578844 CAATTATAACAAAAAAAATGGGG + Intronic
1194503611 X:94707147-94707169 TCATTACCACAAGAAAAATATGG + Intergenic
1194645515 X:96454126-96454148 TTATTACCAAAAAAAAAAAGAGG + Intergenic
1194998809 X:100622063-100622085 CCATCACAAAAAAAAAAAAAGGG + Intergenic
1195398353 X:104435273-104435295 CCATTAAAAAAAAAAGAATGGGG + Intergenic
1195563169 X:106308538-106308560 CCAGTGCCAAGAGAAAAATGAGG - Intergenic
1195563208 X:106310092-106310114 CCAGTGCCAAGAGAAAAATGAGG + Intergenic
1195746930 X:108128233-108128255 CCATCTCTACAAAAAAAATGAGG - Intronic
1195769752 X:108338021-108338043 CCATTATTAAAAAAAAAATCTGG - Intronic
1196461071 X:115931724-115931746 ACAATTCAAAAAAAAAAATGAGG - Intergenic
1197007886 X:121524950-121524972 GCATTCCCAAGAAAAAAATGTGG + Intergenic
1197080033 X:122401237-122401259 TTATTACCAAAAAGAAAAGGAGG - Intergenic
1197156429 X:123274790-123274812 CCATGACCAAAAAAATATTAGGG + Intronic
1197175726 X:123483925-123483947 CCATCTCAAAAAAAAAAATTAGG + Intronic
1197845894 X:130802262-130802284 CCATTTTAAAAAAAATAATGTGG - Intronic
1197851559 X:130866855-130866877 AGACTACTAAAAAAAAAATGGGG - Intronic
1198034572 X:132787884-132787906 CCATCTCAAAAAAAAAAAAGAGG + Intronic
1198107379 X:133474543-133474565 TCTTTACAAAAAAAAAAATTTGG - Intergenic
1198521357 X:137456023-137456045 CCATAACAAAAAAAAAAATCTGG - Intergenic
1198717098 X:139569330-139569352 CCATTTCAAAAAAAAAAAAAAGG - Intergenic
1198825586 X:140695040-140695062 CCATCTCAAAAAAAAAAAAGGGG + Intergenic
1198974549 X:142321516-142321538 CCAAACTCAAAAAAAAAATGAGG - Intergenic
1199020471 X:142871634-142871656 CAATTAAAAAAAAAAAAAAGAGG - Intergenic
1199251445 X:145666822-145666844 CCAATATCAAAAAATTAATGAGG - Intergenic
1199273709 X:145917191-145917213 CTAATATCAAAAATAAAATGAGG + Intergenic
1200054494 X:153452203-153452225 ACATTCCCACATAAAAAATGAGG + Intronic
1200082647 X:153586268-153586290 CTATTAAAAAAAAAAAAATTAGG - Intergenic
1200413367 Y:2883913-2883935 CCAGTAAAAAAAATAAAATGTGG + Intronic
1200574775 Y:4874804-4874826 CCATTACAAAAAAAAAACACGGG - Intergenic
1200618701 Y:5413773-5413795 CCCTGAACAAATAAAAAATGAGG - Intronic
1200959864 Y:8986754-8986776 CCATTCCCACAAAAAAAACTAGG + Intergenic
1201483522 Y:14467489-14467511 ATATTACCAAAAAAAAAGTGGGG + Intergenic
1201611770 Y:15851211-15851233 CCAACACCAAAAAAAAATGGGGG - Intergenic
1201676780 Y:16594972-16594994 CCTTTCTCAAAAAAAAAAAGGGG + Intergenic
1201798387 Y:17926350-17926372 CCGATACAAACAAAAAAATGGGG + Intergenic
1201803166 Y:17979607-17979629 CCGATACAAACAAAAAAATGGGG - Intergenic
1202014778 Y:20390890-20390912 ACATAACCAAAAAGAAAATAAGG - Intergenic
1202353876 Y:24025358-24025380 ACCGGACCAAAAAAAAAATGAGG + Intergenic
1202516903 Y:25644754-25644776 ACCGGACCAAAAAAAAAATGAGG - Intergenic