ID: 1159525247

View in Genome Browser
Species Human (GRCh38)
Location 18:69580731-69580753
Sequence TGTTAATTATAGTCACCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 3, 2: 21, 3: 63, 4: 304}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159525246_1159525247 8 Left 1159525246 18:69580700-69580722 CCTTCTAGCTATTTGAAAATATA 0: 7
1: 114
2: 293
3: 434
4: 831
Right 1159525247 18:69580731-69580753 TGTTAATTATAGTCACCTTATGG 0: 1
1: 3
2: 21
3: 63
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159525247 Original CRISPR TGTTAATTATAGTCACCTTA TGG Intronic
901009660 1:6192748-6192770 TGTTAACAATAGTCAACTTTTGG - Intronic
901272893 1:7966966-7966988 TGTTAACTATAGTCATTCTACGG + Intronic
901353050 1:8615295-8615317 TATTCATTATACTCACCTTGTGG - Intronic
903433065 1:23323892-23323914 TTTTTATTATAATGACCTTAGGG + Intronic
903535054 1:24061226-24061248 TGTGAATTATAGGCCCCTTCAGG - Intronic
906863744 1:49392212-49392234 GGCTAATTATAGCCACATTATGG + Intronic
907086971 1:51684314-51684336 TATTAATTATTGTCACCATGTGG - Intronic
907696551 1:56735895-56735917 TGTTAACTATAGTCATCCTATGG - Intronic
909009025 1:70311630-70311652 TGTTAACAATAGTCACCTCTGGG + Intronic
909922043 1:81394262-81394284 TGTTATTTATAGTCACTATATGG + Intronic
910148566 1:84112707-84112729 TGTGAATTAGAGTCCCCTTTAGG - Intronic
911685741 1:100775195-100775217 TATTAACTATAGTCACCATGTGG - Intergenic
912980869 1:114370919-114370941 TGTTAAATTTTGACACCTTATGG - Intergenic
915918603 1:159957287-159957309 TATTAACTGTAGTCACCATATGG - Intergenic
916793587 1:168145783-168145805 AGTAGATTTTAGTCACCTTAAGG + Intergenic
917170715 1:172170608-172170630 TGTTAATGACAGTCATTTTAGGG + Intronic
917992142 1:180391617-180391639 TGTTGATTATAGCCACCCTAAGG - Intronic
918452581 1:184673753-184673775 TGTTGACTATAGTCACCATATGG + Intergenic
918955877 1:191206074-191206096 TGTTAACTGTAGTCATCCTACGG + Intergenic
919870312 1:201815670-201815692 TATTAACTATAGTCACCATATGG - Intronic
920729098 1:208466121-208466143 TATTAATTCTAGTCACTTTGTGG - Intergenic
921875303 1:220189058-220189080 TCTAAATTACAGTTACCTTAGGG + Intronic
922350507 1:224731390-224731412 TGTAAAATAGAGTCACCATATGG + Intronic
922990250 1:229901366-229901388 TGCTTGCTATAGTCACCTTAGGG - Intergenic
924147885 1:241095826-241095848 TGTTAACTATAGTCATTCTACGG + Intronic
924313299 1:242769318-242769340 TGTTAACTATAGTCATCATGTGG - Intergenic
1062790049 10:297752-297774 TGTTAGTTATAGTCATCCTGCGG - Intronic
1064950497 10:20843881-20843903 AGTTAACCATATTCACCTTACGG + Intronic
1064980876 10:21165550-21165572 TGATAATATTAGTCACCTCAGGG - Intronic
1067739881 10:48887391-48887413 TGTAAATTAGTGTCACCTTGTGG + Intronic
1068422354 10:56811202-56811224 TGTTAATGATACTTTCCTTATGG + Intergenic
1068631173 10:59299054-59299076 TATTAATTATAGTCACTGTGTGG - Intronic
1068701015 10:60019538-60019560 TGTTAACTATAGTCACCCTACGG - Intergenic
1068892714 10:62164454-62164476 TCTTAACTATAGTCACCCTATGG - Intergenic
1069922940 10:71828317-71828339 TGTTCATTATAGTAACAGTATGG + Intronic
1070643253 10:78184030-78184052 TTTTAAGTAAAGTCACATTAGGG - Intergenic
1071318254 10:84424410-84424432 TATTCATTATAGTCACCTTGAGG - Intronic
1073301439 10:102473396-102473418 TGATAATAGTACTCACCTTAAGG + Intronic
1076008312 10:126965918-126965940 GGTTAACTATAGTCATCCTAAGG + Intronic
1077801369 11:5541737-5541759 TATTAACTATAGCCACCATAGGG - Intronic
1077988558 11:7380371-7380393 TATTGACTATAGTCACCCTATGG - Intronic
1078964404 11:16321238-16321260 TGCCAATTATTGTCACATTATGG + Intronic
1079376438 11:19896230-19896252 TGTTAAGTATATTCACATTGTGG + Intronic
1079385387 11:19974415-19974437 TATTAACTAAAGTCACATTAGGG - Intronic
1079659549 11:23021333-23021355 TGTTAATTGGAGTAAGCTTAGGG - Intergenic
1079741475 11:24067319-24067341 TTTTAATTATATTCACATCAAGG + Intergenic
1079929873 11:26544525-26544547 TATTAACTATAGTCACCATGTGG - Intronic
1080390938 11:31845923-31845945 TGTTAACTATAGTCACCATATGG - Intronic
1085890356 11:80572380-80572402 TGTTGATGATAGTCATCTGATGG + Intergenic
1086067952 11:82766121-82766143 TGTTTATTATAGTCACCCTACGG - Intergenic
1086636308 11:89090822-89090844 TATTAACTATAGTTACCTTATGG - Intergenic
1087026288 11:93653071-93653093 TGTTAAAAAGAGTCACCTTTTGG - Intergenic
1089229534 11:116959865-116959887 TGTTAATTATAGCCAACAAAAGG - Intronic
1090442780 11:126737919-126737941 TGTTAACTACAGTCACCCTGTGG + Intronic
1090683823 11:129092689-129092711 TTTTAGTTGTGGTCACCTTAAGG - Intronic
1090870029 11:130736138-130736160 TATTAACTACAGTCACCTGATGG + Intergenic
1090879705 11:130822934-130822956 TGTTAATTAAGGTCTCCTTCAGG - Intergenic
1091559922 12:1604284-1604306 TGTTAACTATATTCGCCCTACGG - Intronic
1092118520 12:6026700-6026722 TGATAATTATAGTCACCCTGTGG - Intronic
1092771861 12:11904129-11904151 TGTGAAGGAAAGTCACCTTAAGG + Intergenic
1093823255 12:23648444-23648466 TTTTAAATATAGTCACATTCTGG - Intronic
1095102614 12:38200325-38200347 AATTAATTATAGTCACTTTTTGG - Intergenic
1096566244 12:52482736-52482758 TATTAACTATAGTCATCCTACGG + Intergenic
1097469350 12:59969086-59969108 TGTTAATTATAGTTCACATAAGG + Intergenic
1098033183 12:66275411-66275433 TTTTAAGTATAGTCAACTTTTGG + Intergenic
1098303405 12:69077663-69077685 TATTAAGTATAGTCACCATTGGG - Intergenic
1098742281 12:74188564-74188586 TATTAACTATAGTCACCATGAGG - Intergenic
1098789248 12:74799780-74799802 TTTTAATTATAGTTGCCATATGG - Intergenic
1098838544 12:75450756-75450778 TGTTAGGTACAGTCACATTATGG + Intergenic
1099710279 12:86215092-86215114 TGTTAATTACAGCATCCTTATGG - Intronic
1104628412 12:130378640-130378662 TTTTAATTTTAGTCATCTTGTGG + Intergenic
1106328287 13:28715642-28715664 TGTTAACTGTAGTCACCCTGTGG - Intronic
1106616266 13:31331459-31331481 TGTTAATTATATTTACTTTTTGG + Exonic
1106776208 13:33012418-33012440 TATTAACTATAGTCACCATGTGG - Intergenic
1107386125 13:39911645-39911667 TTTTAATGAAATTCACCTTAAGG + Intergenic
1107612693 13:42132327-42132349 TGTTAACTATAGTCATCCTACGG + Intronic
1107649695 13:42532468-42532490 TGTTAACTATAGTCACTCTATGG + Intergenic
1108120464 13:47180422-47180444 TGTTAACTATAGTCACCCTATGG - Intergenic
1108226015 13:48290089-48290111 TGTTAATTAAAGTCATCCTACGG + Intergenic
1108536126 13:51381670-51381692 TGTTAATTATATTATGCTTATGG - Intronic
1108797855 13:54053967-54053989 TGTTAACTATATTCACCGTACGG - Intergenic
1109614724 13:64816761-64816783 TGTGAATTATAGTAATCTCATGG - Intergenic
1109743601 13:66589319-66589341 TGTTACCTATAGTCATCGTAAGG - Intronic
1109777641 13:67063133-67063155 TGTTAATTGTACTCACTTTGTGG + Intronic
1110024988 13:70525727-70525749 TATTAGCTATAGTCACCTTGCGG - Intergenic
1110594506 13:77304539-77304561 TGTTTATGATAGTCACCCTGTGG - Intronic
1110748519 13:79084989-79085011 TGTTAATTATTTTCACATAATGG - Intergenic
1110908177 13:80919011-80919033 TCTTATTTATTTTCACCTTATGG - Intergenic
1112202167 13:97287558-97287580 TGTTAAGTACAGTCATCCTATGG + Intronic
1114492194 14:23110043-23110065 TGAGAATAATAGTCACTTTATGG + Intergenic
1114679190 14:24470015-24470037 TGTTAACTATAGTTATCCTATGG - Intergenic
1114769829 14:25416270-25416292 TGATAATTAAAATCACCTTATGG - Intergenic
1115243071 14:31268471-31268493 TCTTAATTAAAATGACCTTAAGG - Intergenic
1115520672 14:34230173-34230195 TGTTAACTACAGTCATCCTATGG - Intronic
1116099374 14:40413215-40413237 TGATGATTATACTCAACTTATGG + Intergenic
1116320965 14:43462255-43462277 TGTTAACTATCATCACCTTATGG + Intergenic
1116631865 14:47346026-47346048 TGTTAACTATAGTCATTTTACGG - Intronic
1116631899 14:47346666-47346688 TCTTAATTATAGTTTTCTTATGG + Intronic
1117746530 14:58875354-58875376 TTTAAAAAATAGTCACCTTAAGG + Intergenic
1117760035 14:59017008-59017030 TATTAACTATAGCCACCATATGG - Intergenic
1117917489 14:60693026-60693048 CGTTAATGATAGTCATCCTATGG + Intergenic
1117917566 14:60693642-60693664 CGTTAATGATAGTCATCCTATGG - Intergenic
1117976828 14:61306844-61306866 TGTTAATTACAGTCATTTAAAGG - Intronic
1118504718 14:66398726-66398748 TTAAAATTATATTCACCTTATGG - Intergenic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1119695941 14:76713536-76713558 TGTTAATAAAAATCTCCTTAGGG + Intergenic
1119797826 14:77415267-77415289 TGTTAATTATATGCACATTGTGG + Intronic
1121298046 14:92846081-92846103 TGTGAACTATAGTCACCCTATGG + Intergenic
1121921157 14:97882894-97882916 TTTAACTTATAGTCACCTTCTGG - Intergenic
1123098712 14:105779411-105779433 TGTTAGTTATAGTCACCCTATGG + Intergenic
1127058811 15:55161163-55161185 TATTAACTATAGTCACCTTGCGG - Intergenic
1127433519 15:58934553-58934575 TGTGCATCATAATCACCTTATGG - Intronic
1128073038 15:64809018-64809040 TCTTGATTATTGTCACCTGAAGG - Intergenic
1128593060 15:68919566-68919588 TTTTAATTATAGTTACTGTAAGG - Intronic
1129597729 15:76977722-76977744 TGTTAATTATAGTCATCCTAGGG + Intergenic
1129682842 15:77667695-77667717 TGCTAATTACAGCCACCATAAGG + Intronic
1130634925 15:85609176-85609198 TGCTAACTATAGTCACCCTTCGG + Intronic
1134323305 16:13183741-13183763 TGTTAATTACACTTACTTTAAGG + Intronic
1135876855 16:26209436-26209458 TAATAATTATAGTCACCATGTGG - Intergenic
1136489196 16:30594421-30594443 TGTTAACTATAGTCATCCTACGG - Intergenic
1137256715 16:46781155-46781177 TATTAACTATAGTCATCCTACGG + Intronic
1137271731 16:46906773-46906795 TGTTAATTATATTGACCCTGTGG + Intronic
1137870063 16:51941246-51941268 TGTTAATTATAGTCACCCTATGG - Intergenic
1138912782 16:61422434-61422456 TATTGACTATAGTCACCCTACGG + Intergenic
1138934418 16:61700826-61700848 TGTTTATTATGGCCACCCTATGG - Intronic
1139189956 16:64850944-64850966 TGTTAACTATAGTCACCCTATGG - Intergenic
1139519334 16:67471560-67471582 TGTTAAATACAGTCACCCTATGG + Intronic
1140264681 16:73410078-73410100 TGTTGACTTTAGTCACCTTATGG - Intergenic
1141222690 16:82085935-82085957 TTTTTATTATAGCCATCTTAGGG - Intronic
1142440132 16:90092693-90092715 AATTAATTATAGTCACTTTTTGG - Intergenic
1143991651 17:10968570-10968592 TGTTGATTATTTTCCCCTTAGGG - Intergenic
1147007046 17:37411728-37411750 TGCTATTAATAGTCACCTGAAGG - Intronic
1147158788 17:38559051-38559073 TGCTAATTATCCTCACCTGACGG + Intronic
1148817957 17:50344337-50344359 TGTTAATGATGATCATCTTAAGG + Intergenic
1149346091 17:55737804-55737826 TCTTATTTATAGTTACCTTTAGG - Intergenic
1151034397 17:70781289-70781311 TGTTAACTATATTCACCCTATGG - Intergenic
1151394761 17:73815320-73815342 TGTTAACTGTAGTCATCCTATGG - Intergenic
1152000017 17:77639422-77639444 TTTTACTTAAAGTCAGCTTATGG - Intergenic
1152957422 18:50868-50890 AATTAATTATAGTCACTTTTTGG + Intronic
1153169271 18:2296404-2296426 TGTTAACTATAGTCATTCTATGG - Intergenic
1155777966 18:29792170-29792192 TGTTAATTATAGAAACCACAGGG + Intergenic
1157879907 18:51311650-51311672 TGTTGATTGTAGTCACCCTATGG - Intergenic
1158966346 18:62625406-62625428 GTTTGATTATAGTCTCCTTAAGG + Intergenic
1159525247 18:69580731-69580753 TGTTAATTATAGTCACCTTATGG + Intronic
1166285474 19:41824104-41824126 TGTTAAATATAGTCATCCTACGG - Intergenic
1168184776 19:54692822-54692844 TGTTAACTATAGTCACCCTACGG - Intronic
925016459 2:529378-529400 TTCAAATTATACTCACCTTAAGG - Intergenic
926103101 2:10133134-10133156 TGTGAATTATAATCACCTGGGGG + Intergenic
927017791 2:18984628-18984650 TGTTCAGTATATTCACATTATGG + Intergenic
927622188 2:24673207-24673229 TCTTAATTATACTCATTTTATGG - Intronic
927703783 2:25284750-25284772 TGTTAATAATGGGTACCTTAGGG - Intronic
928543964 2:32312067-32312089 TGATAATTATAGTCTCTTCATGG + Exonic
929174765 2:38965211-38965233 CTTAAATTATAGTCACCTCAAGG + Intronic
929195913 2:39183974-39183996 TGTTTATCATAATCACCTAAGGG + Intronic
929326457 2:40617493-40617515 TATTGACTATAGTCACCCTATGG + Intergenic
929638772 2:43553794-43553816 TTTAAATTATAGTCATCCTATGG + Intronic
930214068 2:48674799-48674821 TGTTTCTTATAATAACCTTATGG + Intronic
930772752 2:55144174-55144196 TGTTAACTATAGTCACGATGTGG - Intergenic
931436019 2:62247377-62247399 TGTTAACTATAATCACCCTAGGG + Intergenic
931698001 2:64886339-64886361 TTTTAATTATAGCCATCCTAAGG + Intergenic
932704991 2:74017289-74017311 TGTGAATTATAGTTGCCCTATGG + Intronic
933647567 2:84824942-84824964 TGGTGACTATAGTCACCTTTAGG - Intronic
935461332 2:103338464-103338486 TGTTAACTATAGTCACAATAGGG + Intergenic
936891945 2:117381227-117381249 TGTTAACTACAGTCATCCTACGG + Intergenic
937006152 2:118517417-118517439 TGTTCATTTTGGTCATCTTAGGG - Intergenic
937225179 2:120364595-120364617 TGTTAACTGTGGGCACCTTATGG - Intergenic
937614934 2:123911106-123911128 TATTATTTATAATCACATTATGG + Intergenic
938321020 2:130363956-130363978 TTTTAATTATAGCCATCCTAGGG + Intronic
938831935 2:135059676-135059698 TGTTAACTAAAGTCACTCTAAGG + Intronic
938957491 2:136312455-136312477 TGCTAACTATAGTCACTCTATGG + Intergenic
939209118 2:139148865-139148887 TTTTAATTATAGAGACTTTATGG - Intergenic
939466690 2:142565565-142565587 TGATAAATATACTGACCTTAAGG + Intergenic
940570232 2:155422779-155422801 TGTTAACTATACTCATCCTACGG + Intergenic
941018475 2:160383690-160383712 TGTTAACTATAGTCATTCTATGG + Intronic
941058859 2:160822181-160822203 TGTTGATTATAGTCACCCTGTGG + Intergenic
941065490 2:160898136-160898158 TGTTAATTATAGTTATTTTAAGG + Intergenic
941714556 2:168749945-168749967 TTTTAATTACATTCACATTAAGG + Intronic
941742600 2:169051392-169051414 TGTCAATTTTAGTCACTTTTAGG - Intergenic
941992001 2:171566674-171566696 TGTAAAGTACAGTCACTTTATGG + Intergenic
946565498 2:220960063-220960085 TGTTCATTTGAGTCAACTTAGGG - Intergenic
947700065 2:232226249-232226271 TGTTAATCATAGTCAGCCTTAGG + Intronic
948114083 2:235480858-235480880 TGTTAAGTATATTCACGTTGTGG - Intergenic
1169360119 20:4941212-4941234 TGTTAATTATAGGCACAGTGTGG - Intronic
1169579062 20:6998324-6998346 TGTCAATCAAAGTCACCTTGTGG - Intergenic
1170801562 20:19594499-19594521 TGTTTATTATAGTCTTCTTTGGG + Intronic
1171900818 20:30854652-30854674 AATTAATTATAGTCACTTTTTGG - Intergenic
1172879143 20:38187129-38187151 TTTTAATTACAGTCACCAAAGGG - Intergenic
1173483926 20:43426572-43426594 TGTTAATAATGGTCATCTCATGG + Intergenic
1173532020 20:43777178-43777200 TGTTAATTATGATCTCCTTGTGG + Intergenic
1177464666 21:21459810-21459832 TATTAATTATAGTCACAATGCGG - Intronic
1177664958 21:24143475-24143497 TATTAATTATAGTCAAGTTAAGG + Intergenic
1177958610 21:27633034-27633056 TGTTAACTATAGTCATTTTATGG - Intergenic
1177996733 21:28109002-28109024 TGTTAATTCTACTCACATTTGGG + Intergenic
1178296787 21:31416846-31416868 TGTTAATTTGATTCACTTTAGGG - Intronic
1180320852 22:11320105-11320127 AATTAATTATAGTCACTTTTTGG + Intergenic
1180569954 22:16705115-16705137 TGATAATTATAGTCACCCTGTGG - Intergenic
1181391247 22:22583181-22583203 TGTTAACCATAGTCACATTGCGG + Intergenic
1181632555 22:24158915-24158937 TGGGAATCAGAGTCACCTTAGGG + Intronic
1181848330 22:25731216-25731238 TGTTGTCTATAGTCACTTTATGG + Intergenic
1181892276 22:26073996-26074018 TCTTAATTAAAGTCTCCTTATGG - Intergenic
1181971415 22:26693176-26693198 TGATAGTTGTAGTTACCTTATGG + Intergenic
1182065193 22:27426093-27426115 TATTAACCATAGTCACCTTGTGG - Intergenic
1183025283 22:35060965-35060987 TATTAACTATAGTCACCATGTGG - Intergenic
949203831 3:1413959-1413981 TGCTAATTGTAGTTACCTTGTGG - Intergenic
950225379 3:11229209-11229231 TGTTTACTATTGTCTCCTTATGG - Intronic
950588538 3:13916546-13916568 TTTTTATTATAGTCACCTAGTGG - Intergenic
951728724 3:25787108-25787130 TGTTAATCAAAATCACCTGAAGG - Intronic
953280825 3:41554647-41554669 TGTTAACTGTAGGCACCATATGG - Intronic
953463866 3:43103032-43103054 TGTTACTTAGACTCTCCTTAGGG - Intronic
954805691 3:53218728-53218750 TGTTAATTATGGTCAGCCTACGG - Intergenic
954952058 3:54484152-54484174 TGTTATTTAAAGTTACATTAAGG - Intronic
957582680 3:82094795-82094817 TCTTATTTAAAATCACCTTATGG + Intergenic
957951989 3:87139384-87139406 TGTTATTTAATGTCACTTTAGGG + Intergenic
958439717 3:94141278-94141300 TGTTAACTATAGTCATCCTATGG - Intergenic
958588387 3:96120248-96120270 TAGTAATTATAGACACCTCAGGG - Intergenic
958603869 3:96333021-96333043 TGCTAATTTTAGTCTCCTCATGG - Intergenic
958734311 3:97990868-97990890 TGTTAAGTATATTCACATTGTGG - Intronic
958850061 3:99314180-99314202 TGATAATTATATATACCTTAAGG - Intergenic
958972449 3:100626971-100626993 TATTAATTATAGTAACTTTTTGG + Intronic
959337414 3:105083421-105083443 TGTTAATTGTTGTTCCCTTAAGG + Intergenic
960261231 3:115570847-115570869 TGTTAACTATAGTCATCTTAAGG - Intergenic
961953691 3:130777381-130777403 TGTTAACTATAGTTACCCTACGG - Intergenic
962041079 3:131708065-131708087 AGATAATTATAGTCACCTATTGG + Intronic
962427963 3:135290091-135290113 TCTTAATTATTGTTGCCTTATGG + Intergenic
963505022 3:146173555-146173577 TTTTAATTCTATTCACTTTATGG - Intergenic
963556805 3:146801418-146801440 TGGTAACCATAGTCACCATAGGG + Intergenic
964240150 3:154583260-154583282 TGTTATTTATAGTCATCTTAAGG - Intergenic
965086207 3:164101719-164101741 TGTTAATCATCGTCATCCTACGG + Intergenic
967078666 3:186028346-186028368 TGTTAATTGTGATCACCTTGTGG + Intergenic
968856561 4:3128518-3128540 TGTTTATAATAGGCTCCTTAAGG - Intronic
970074964 4:12207711-12207733 TGTTAATTATAGTCACAAGAAGG + Intergenic
970173804 4:13316114-13316136 TGTTAACTATAGTCACTCCAAGG + Intergenic
971920092 4:32927435-32927457 TGCATATGATAGTCACCTTATGG + Intergenic
974019093 4:56677121-56677143 TCTCCATTATAGTAACCTTAAGG + Intronic
974068642 4:57103903-57103925 TATTAATTATAGTCATCATGAGG + Intronic
974512268 4:62858639-62858661 TGTTAAATATATTCATATTATGG + Intergenic
974651724 4:64762665-64762687 TCTTTATTATAGTCATCATAGGG + Intergenic
974783757 4:66590234-66590256 TGTTAATTACAGTCACCTTATGG + Intergenic
977155734 4:93570791-93570813 TTATAATTATAGACATCTTATGG + Intronic
977782907 4:100999260-100999282 TGTTAATTATAGTCATCCAATGG + Intergenic
978171026 4:105670314-105670336 TTTTAATTATAGCCATCTTGTGG + Intronic
980239259 4:130152329-130152351 TGTTAACTATAGTCATCTTATGG - Intergenic
980664816 4:135917668-135917690 TGTCAACTATAGTCATCCTACGG - Intergenic
981434697 4:144706778-144706800 ATTTAATTATTGCCACCTTATGG - Intronic
982963427 4:161870673-161870695 TGTTAATAATACTTACCTTAAGG + Intronic
983100278 4:163617320-163617342 TGTTAGCTATATTCACTTTATGG - Intronic
983184570 4:164687093-164687115 TGTAAATTTTAGTCACAATACGG - Intergenic
983497917 4:168464759-168464781 TGTTAATTATATCCACCCTATGG + Intronic
983975321 4:173926844-173926866 TCCTAATTATAGTCACCCTGTGG - Intergenic
985441693 4:189986175-189986197 AATTAATTATAGTCACTTTCTGG + Intergenic
986160047 5:5219284-5219306 TGTTAACTATCGTCACCCTATGG + Intronic
986837317 5:11653166-11653188 TGTTAATAATAGTCAAGATATGG - Intronic
987413668 5:17640207-17640229 TGTTAACTATAGTCACCATGTGG + Intergenic
987512666 5:18860444-18860466 TGTAAATTTTAATCACCATAGGG + Intergenic
987912529 5:24167202-24167224 TGTTCATTATAGATACTTTATGG + Intronic
987971098 5:24945634-24945656 TGTTAACTATAGTCACATTACGG + Intergenic
988111585 5:26829461-26829483 TGTCAACTGTAGTCACCCTATGG - Intergenic
988258708 5:28854151-28854173 TATTAACTATAGTCACCCTGTGG - Intergenic
988310061 5:29544791-29544813 TATTAACTATAGTCACCATGCGG + Intergenic
990100544 5:52180264-52180286 TATTGGTTATAGTCACTTTAAGG - Intergenic
990783031 5:59387849-59387871 TGTTAACTATAGTCACCCTGAGG + Intronic
992020241 5:72616146-72616168 TGTTAATTATTGTAGCTTTATGG - Intergenic
995170014 5:109097251-109097273 TGTTCTTAATAGTCAGCTTATGG - Intronic
995192331 5:109330814-109330836 TGGTAGCTAAAGTCACCTTAGGG + Intergenic
995942023 5:117598209-117598231 TGTTAATTATCATGGCCTTATGG - Intergenic
996062347 5:119046131-119046153 TATTAATTATACTTACCTTCAGG + Intronic
996373512 5:122777886-122777908 TGTTAATTTTAGTCAATGTATGG + Intronic
997593261 5:135088632-135088654 TATTAATTATAGTCACCTTATGG + Intronic
998718340 5:144911681-144911703 TTTTAATTATACTTACCTTCTGG - Intergenic
1000399352 5:160809592-160809614 TGTTAACAATAGTCATCTTACGG + Intronic
1000573112 5:162939443-162939465 TGTTCACTATAGTCCCCCTACGG - Intergenic
1002982241 6:2149775-2149797 AGTTAAATATAGTCACCGTTGGG - Intronic
1004641996 6:17524592-17524614 TTTTAATTATAGGCAAATTAAGG + Intronic
1005530239 6:26697263-26697285 TATTAACTGTAGTCACCATACGG - Intergenic
1005540557 6:26804383-26804405 TATTAACTGTAGTCACCATACGG + Intergenic
1006074496 6:31522487-31522509 TATTAAGTTTAGTCACCATAAGG - Intergenic
1009011371 6:57846480-57846502 TATTAACTGTAGTCACCATACGG + Intergenic
1009994466 6:70883027-70883049 TTTTAATAATAGCCACCTAATGG - Intronic
1010156705 6:72802586-72802608 TGTTAGTTATAGTCTCATTTTGG + Intronic
1010556935 6:77293858-77293880 TGTTAATTATAACCTTCTTAGGG + Intergenic
1010632479 6:78215063-78215085 TTTTAACTATAGTCACCCTATGG + Intergenic
1011140848 6:84154443-84154465 TGTTAATTAAGGTCACATCAAGG - Intronic
1011176296 6:84564560-84564582 TGTTGATTATAGTCACTCTGTGG - Intergenic
1011377874 6:86709689-86709711 TGTCAATTATAAACACCCTAAGG + Intergenic
1012230653 6:96757357-96757379 TATTAACTATAGTCACCATGTGG - Intergenic
1012713282 6:102635908-102635930 TTTTAATTAGACTCACCATAAGG - Intergenic
1014106227 6:117565114-117565136 TGTTATTTATATTAACCTTCTGG - Intronic
1014173754 6:118308684-118308706 TGGTTATTATGGTCACCTGATGG + Intronic
1014934174 6:127366716-127366738 TGTTAATTATATTAAAATTAAGG + Intergenic
1015002451 6:128234950-128234972 TGTTAACTATAGTCACCCTATGG - Intronic
1016624522 6:146150610-146150632 TGTTAACTATAGTCACCCTGTGG + Intronic
1016642953 6:146371519-146371541 TATTGACTATAGTCACCCTACGG + Intronic
1016682142 6:146843526-146843548 TGTAAAATATAGTTACCTTGTGG - Intergenic
1017078178 6:150639449-150639471 TGTTAATTACAGTCATCCTCTGG + Intronic
1018688529 6:166323202-166323224 TGATAATTATAGTCTCCTTTAGG + Intronic
1019481542 7:1269315-1269337 TGTTATTTAAAGTCAGGTTAAGG - Intergenic
1020053118 7:5096292-5096314 TGTCAATTATAGTCACCCTATGG + Intergenic
1021831270 7:24613641-24613663 TGTCAACTATGGTCACCTTATGG + Intronic
1022085238 7:27061247-27061269 TGCGAATTATAGTCATCTTAAGG - Intergenic
1022124715 7:27344550-27344572 TATTAACTATAGTCACCCTGTGG + Intergenic
1023137472 7:37066577-37066599 TATTAACTATAGTCATCCTACGG - Intronic
1023152600 7:37215806-37215828 TGTTAATTATAGTTCCCCAAAGG - Intronic
1023223209 7:37942511-37942533 TGTTAAATATATTCACATTGTGG - Intronic
1023462278 7:40411709-40411731 TGTTAACTATAGTCAACCAACGG - Intronic
1023659976 7:42461239-42461261 TGGTAATAATAGTCACATTCAGG + Intergenic
1024415341 7:49098793-49098815 TATTGATTATAGTCACCTGTTGG - Intergenic
1026395918 7:69954232-69954254 TGTTAACTATAGTCACTATGTGG - Intronic
1027240298 7:76323205-76323227 TGTTATTTTTAATCACCTTTCGG + Intergenic
1027749798 7:82128377-82128399 TGCTATTTATATTCACCTTGTGG - Intronic
1028205943 7:88017208-88017230 CGTTAAATATATTCACCCTACGG - Intronic
1028210269 7:88065461-88065483 TGTTTATTATAGACATTTTAAGG + Intronic
1028338475 7:89687929-89687951 TGTTAACTATAGTCAGCTCGTGG + Intergenic
1028717255 7:93985374-93985396 TATTACTAATACTCACCTTAAGG + Intronic
1030672626 7:112353869-112353891 TGTTACCTATAGTCATCCTACGG + Intergenic
1031584658 7:123519736-123519758 TGTTAACTATAGTCACCGTACGG - Intronic
1031623006 7:123958428-123958450 TGTTATATATAGTCAAGTTATGG - Intronic
1033725870 7:144117928-144117950 TGTAAATTACAGTCACCATCAGG - Intergenic
1036089057 8:5645329-5645351 TGTTAACTATAGCCATCTTACGG - Intergenic
1038645418 8:29357586-29357608 TGTTAACTATATTCACCCTACGG + Intergenic
1039108685 8:34018490-34018512 TGTTAATTATAGTTATCATATGG + Intergenic
1039318482 8:36400149-36400171 TGTTAACTGTAGTCACCCTATGG - Intergenic
1039360099 8:36866807-36866829 TATTAACTATAGTCACTTTACGG - Intronic
1039687282 8:39817424-39817446 TGTTAACTATAGTCACCCTATGG - Intronic
1040016446 8:42704241-42704263 TTTTAAATATAGTCACGTTGGGG + Intronic
1040061296 8:43105234-43105256 TGTTAATTATAGTCATCCTATGG + Intronic
1040748726 8:50679435-50679457 TTATAATTATAGCCACATTATGG + Intronic
1042627544 8:70775200-70775222 TCTTAATTCTAGTCACTTTTTGG + Intronic
1042938646 8:74085948-74085970 TGTTAACTAGAGTCACCCTGCGG + Intergenic
1043115400 8:76246876-76246898 TGTTAACTATATTCACTGTATGG - Intergenic
1043957501 8:86378058-86378080 TTTTAATTATTTTCACTTTATGG + Intronic
1045110082 8:98932080-98932102 TGTTAATTATTGTTACCATCAGG - Intronic
1045122947 8:99058376-99058398 TGTTAATTATAATTATATTATGG - Intronic
1045356208 8:101391386-101391408 TGATAATAATAGTTACCTCAAGG - Intergenic
1046889879 8:119411211-119411233 TGTTGACTATAGTCACCCTATGG + Intergenic
1048505385 8:135016122-135016144 TGATAATTATAGTGACCTAGTGG + Intergenic
1049921006 9:364246-364268 TATTAAGAATAGTCACATTAGGG + Intronic
1050098770 9:2096141-2096163 AGTTAATGGTAGTCACCCTAGGG + Intronic
1050202794 9:3164543-3164565 TTTTAATTATAGTGACTTTGTGG + Intergenic
1051025889 9:12610293-12610315 AAATAATTATAGTCACCTCAAGG - Intergenic
1051448352 9:17165918-17165940 TGTTAACTATAGAGACCTTTGGG + Intronic
1051559147 9:18420785-18420807 TTTTAATTTTAAGCACCTTAAGG - Intergenic
1052077859 9:24166366-24166388 TATTAATGGTAGTCACCATATGG + Intergenic
1052135707 9:24907324-24907346 TGTCAGTTTTAGTCAGCTTATGG - Intergenic
1053945402 9:43303977-43303999 TCTTAATTATATACATCTTACGG + Intergenic
1055082896 9:72284621-72284643 TTTTAATTATAGTCATCCTAGGG + Intergenic
1055484443 9:76743809-76743831 TGTTAACTTTAGTTACCTTGGGG + Intronic
1056632049 9:88302034-88302056 TGTCAATTACAGTCACCTTCTGG + Intergenic
1059551789 9:115236514-115236536 TCCTAATTATAGTCTCCTTTTGG + Intronic
1059614645 9:115935754-115935776 TTTTAACTATAGTCACCGTATGG + Intergenic
1059804611 9:117785082-117785104 TCTTAATTATAGTCACCAGGTGG + Intergenic
1059958182 9:119540269-119540291 TGGCAGTTATTGTCACCTTAAGG + Intergenic
1060164251 9:121396169-121396191 TGTTAATTATAGTCATCCTATGG + Intergenic
1062621748 9:137425924-137425946 TGTTAATAATAGTTACCTCTGGG - Intronic
1062740723 9:138173705-138173727 AATTAATTATAGTCACTTTTTGG - Intergenic
1203369073 Un_KI270442v1:285879-285901 AATTAATTATAGTCACTTTTTGG + Intergenic
1203588537 Un_KI270747v1:32555-32577 TCTTAATTATATACATCTTACGG + Intergenic
1185829241 X:3283674-3283696 TGATAATTATTATCACCTTTAGG - Intronic
1187725013 X:22193185-22193207 TATTAATTATAATCACATTTAGG + Intronic
1187818045 X:23255016-23255038 TGTTGAATATAGTAACCCTACGG - Intergenic
1187919224 X:24184613-24184635 TTTTATTTATAGTCATCTTTAGG + Intronic
1188052141 X:25500908-25500930 TGTTAATTCTGGTTACCTTTTGG - Intergenic
1188287638 X:28347622-28347644 TGTTAACTATAGTCACCATGAGG + Intergenic
1188807259 X:34606902-34606924 AGTTAATTATATTCATCTTTTGG + Intergenic
1190898379 X:54643671-54643693 TGTTAACTATAGTCACCCTATGG + Intergenic
1191218538 X:57959966-57959988 TGTTAATTATAGTTACCCTATGG - Intergenic
1192865371 X:75125989-75126011 TATGAATTTTAGTCACCTCATGG - Intronic
1193211788 X:78815309-78815331 CCTTAACTATAGTCACCTTCCGG - Intergenic
1193609647 X:83614006-83614028 TGTTAACTATAGTCATCTTAGGG - Intergenic
1193988587 X:88276949-88276971 TGTCAAATATTGACACCTTATGG + Intergenic
1194096837 X:89651174-89651196 TGCTAATCAGAATCACCTTAAGG + Intergenic
1194232829 X:91345736-91345758 TGTTAGCTATAGTCATCCTATGG + Intergenic
1194363295 X:92982000-92982022 TATTGACTATAGTCACCTTGTGG - Intergenic
1194413656 X:93583880-93583902 TGTTGATACTAGTCACATTAAGG - Intergenic
1195906920 X:109853139-109853161 TGTTAATTATAGGGATTTTATGG - Intergenic
1196384714 X:115137095-115137117 TATTAACTATAGTCAACCTATGG + Intronic
1196942637 X:120792409-120792431 TATTTATTATAGTCACCATTTGG + Intergenic
1198453106 X:136787531-136787553 TGTTAAACATAGTTACCATATGG + Intergenic
1198759781 X:140019192-140019214 TTTTAATTATATTCAAATTAAGG + Intergenic
1198779004 X:140214858-140214880 TTTTAATTATATTCAAATTAAGG - Intergenic
1199102204 X:143815626-143815648 TTTTGACTATAGTCACCTTGTGG - Intergenic
1199866013 X:151850882-151850904 TATTAACTATAGTCACCATACGG - Intergenic
1199903608 X:152202448-152202470 TGTTAATTGTAGTTACCTAAAGG - Intronic
1200449857 Y:3312550-3312572 TGCTAATCAGAATCACCTTAAGG + Intergenic
1200671536 Y:6098249-6098271 TATTGACTATAGTCACCTTGTGG - Intergenic
1200738019 Y:6821468-6821490 TGTTATCTACAGTCACCGTAAGG + Intergenic
1201069211 Y:10129080-10129102 AATTAATTATAGTCACTTTTTGG - Intergenic
1202105969 Y:21366016-21366038 TGGTAACCATAGTCACCATAGGG - Intergenic
1202234031 Y:22689219-22689241 TGGTAATCGTAGTCACCATAGGG + Intergenic
1202305978 Y:23471532-23471554 TGTTCATTATACTCACCTTGTGG + Intergenic
1202309125 Y:23506939-23506961 TGGTAATCGTAGTCACCATAGGG - Intergenic
1202561676 Y:26163653-26163675 TGGTAATCGTAGTCACCATAGGG + Intergenic
1202564831 Y:26199057-26199079 TGTTCATTATACTCACCTTGTGG - Intergenic