ID: 1159526451

View in Genome Browser
Species Human (GRCh38)
Location 18:69597747-69597769
Sequence AACGCCTGCTCAACCTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 1, 2: 2, 3: 8, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159526449_1159526451 10 Left 1159526449 18:69597714-69597736 CCTCAGCTGGAAGCGTGCACATC 0: 1
1: 1
2: 9
3: 26
4: 135
Right 1159526451 18:69597747-69597769 AACGCCTGCTCAACCTCAGCTGG 0: 1
1: 1
2: 2
3: 8
4: 82
1159526448_1159526451 19 Left 1159526448 18:69597705-69597727 CCTGCTCAACCTCAGCTGGAAGC 0: 2
1: 0
2: 1
3: 18
4: 202
Right 1159526451 18:69597747-69597769 AACGCCTGCTCAACCTCAGCTGG 0: 1
1: 1
2: 2
3: 8
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159526451 Original CRISPR AACGCCTGCTCAACCTCAGC TGG Intronic
902552306 1:17226389-17226411 AATGCCTGCTCCACCCCAGATGG - Intronic
902743701 1:18458675-18458697 AACACCTGCTCAGCCTCATGGGG - Intergenic
908354928 1:63319739-63319761 AGCGCCTGCACAACCTCCGGGGG - Intergenic
909203154 1:72718389-72718411 AATGCCTTCTCAAAATCAGCAGG - Intergenic
917346836 1:174037103-174037125 GAAGCCTGCTCAGCCTCAGGTGG - Intergenic
922633829 1:227143412-227143434 CTCTCCTGTTCAACCTCAGCTGG - Intronic
1063168368 10:3484284-3484306 AACCCCAGCTCCACCTCATCAGG - Intergenic
1064891013 10:20173515-20173537 AAAGCCTGATCAGCATCAGCAGG - Intronic
1069945863 10:71985195-71985217 AAGCTCTGCGCAACCTCAGCGGG - Intronic
1070322204 10:75362817-75362839 AACCACTGCTCAGCTTCAGCTGG + Intergenic
1075895536 10:125991341-125991363 GAAGCCTTCTCAACCTCAGGGGG + Intronic
1076111305 10:127861739-127861761 ACCCACTACTCAACCTCAGCAGG + Intergenic
1078265820 11:9755837-9755859 AAGTCCTGCTGGACCTCAGCTGG - Intergenic
1083387661 11:62323753-62323775 AACTCCTGCTCAACCTCACTTGG - Intergenic
1088770550 11:113031765-113031787 ATCGCCTGTTCAACAGCAGCTGG + Intronic
1095722067 12:45411742-45411764 AAGTCCTGCTGAGCCTCAGCTGG + Intronic
1098823271 12:75260366-75260388 AAAGCTTCCTCAACCTCTGCTGG + Intergenic
1104063084 12:125284439-125284461 AACCCCTGCTCCACGGCAGCGGG - Intronic
1104908424 12:132227967-132227989 AGCCCCTGCTCAACCTCAGCAGG - Intronic
1107897415 13:44979277-44979299 AAAGCCTGCTGAACATCAGGAGG + Intronic
1107972627 13:45658553-45658575 AATTACTGCTCATCCTCAGCAGG - Intergenic
1110946750 13:81430837-81430859 TAAGACTGCTCAGCCTCAGCTGG - Intergenic
1111426192 13:88086509-88086531 AAATCCTGCTCACTCTCAGCTGG - Intergenic
1114885207 14:26841323-26841345 GACGACTGCTAAAACTCAGCAGG + Intergenic
1119920681 14:78443200-78443222 AAGGTGTGCTCAAACTCAGCAGG + Intronic
1121107783 14:91292406-91292428 AGCACCTGCCCAACCTCTGCTGG + Intronic
1121639865 14:95478102-95478124 CCCGCCTGCTCAACCCCACCGGG - Intergenic
1124098355 15:26670169-26670191 AACGCGGGCTCAAGCCCAGCGGG + Intronic
1124364009 15:29059112-29059134 AAGCCTTGTTCAACCTCAGCTGG - Intronic
1129604163 15:77016669-77016691 AACTCCAGCCCACCCTCAGCAGG - Intronic
1136371543 16:29839978-29840000 AACGCCTGCCAAATCTCATCTGG - Intronic
1144190651 17:12842485-12842507 TCAGCCTTCTCAACCTCAGCAGG - Intronic
1146591574 17:34132096-34132118 AAAGCCTGGCTAACCTCAGCTGG + Intronic
1146602781 17:34233133-34233155 ACTGCCTCCTCAACCTCTGCAGG - Intergenic
1147839203 17:43358632-43358654 AATGCCTGCTGAACCACAGCAGG + Intergenic
1152077845 17:78169692-78169714 CACGCCTGCTCCACCTCAGCAGG - Intronic
1155051695 18:22153565-22153587 TAGTCCTGTTCAACCTCAGCTGG - Intergenic
1155496795 18:26450789-26450811 AGCCCCTACTCAACCCCAGCAGG - Intergenic
1159467149 18:68798231-68798253 AACACATGCTGTACCTCAGCAGG - Intronic
1159526447 18:69597701-69597723 ATCGCCTGCTCAACCTCAGCTGG + Intronic
1159526451 18:69597747-69597769 AACGCCTGCTCAACCTCAGCTGG + Intronic
927865160 2:26583433-26583455 AACAACAGCTCAACCTCAGAGGG - Intronic
929915853 2:46134868-46134890 AATGCCTGCTTCCCCTCAGCAGG + Intronic
933870161 2:86558248-86558270 AAGGCATCCTCATCCTCAGCAGG + Intronic
935242718 2:101192377-101192399 AACTCGTGCTCAAGCTGAGCTGG - Intronic
938680432 2:133684265-133684287 AACACTTGCTCAACATCAGACGG - Intergenic
942089146 2:172471645-172471667 CAGTCCTGCTCAACCTCCGCTGG - Intronic
942728424 2:179036284-179036306 AACTCCTGCTCAACCTGAACCGG + Intronic
948257737 2:236580049-236580071 ATGGCCTGCTCACTCTCAGCAGG - Intronic
1173168284 20:40701479-40701501 AATGGCTGCACAATCTCAGCAGG + Intergenic
1174393022 20:50229505-50229527 AAGGCCAGCCCAACCTCAGTTGG - Intergenic
1175041564 20:56056672-56056694 TACACCTGCTCAACCACAGAGGG + Intergenic
1175910626 20:62403665-62403687 AGCACCTGCTCAAACCCAGCTGG + Intronic
1175959207 20:62626500-62626522 AACACATGCTCAACGTCAGGAGG - Intergenic
1180729559 22:17971369-17971391 GAGGCCTCCTCAGCCTCAGCAGG + Intronic
1183703601 22:39463516-39463538 AACGCCTGCTCAATGTCACCTGG + Intronic
1183769918 22:39915328-39915350 AATGCCTGCTCAACCACAAGTGG - Intronic
950456820 3:13097611-13097633 AACGCCTGATAAACCTCCTCTGG + Intergenic
951177845 3:19622790-19622812 AACACCAGCTCAGCCACAGCAGG - Intergenic
957588191 3:82159714-82159736 TAGGGCTGCTCAACCGCAGCAGG - Intergenic
969152946 4:5186031-5186053 AACTCCTGCTCATCCTCCACAGG + Intronic
973236814 4:47914497-47914519 ACCGCCTCCTCAGCCTCTGCGGG + Exonic
976079835 4:81343823-81343845 AAAGCCAGCTCATCCTCAGGTGG + Intergenic
985586728 5:743452-743474 AATCCCTGCTGAACCCCAGCAGG - Intronic
985601311 5:835639-835661 AATCCCTGCTGAACCCCAGCAGG - Intronic
988587493 5:32520459-32520481 AACAGCTGCTCAACATCATCCGG + Intergenic
995238975 5:109864080-109864102 AACGCCTGATCATCCTCACTAGG - Intronic
999449185 5:151665616-151665638 AGCCCCTGCTCAGCCTCAGATGG - Intronic
1005883032 6:30074772-30074794 GACCCCTCCTCACCCTCAGCTGG + Intronic
1015657730 6:135538926-135538948 AACTGCTGTTCAAACTCAGCAGG - Intergenic
1017626239 6:156351935-156351957 AACAGCACCTCAACCTCAGCCGG + Intergenic
1022359891 7:29647859-29647881 AGCTCCTGCTCAGCCCCAGCTGG + Intergenic
1024158647 7:46651692-46651714 AAACCCTTATCAACCTCAGCAGG - Intergenic
1032024660 7:128431430-128431452 AACTGCTGCTCAACCCCTGCAGG + Intergenic
1032349767 7:131150026-131150048 AGAGCATGCTCCACCTCAGCTGG + Intronic
1034752502 7:153584015-153584037 AAGGTCTGCTCAAGGTCAGCAGG + Intergenic
1035718252 8:1770435-1770457 AATGCCTTCTCAACAGCAGCAGG - Intronic
1041200190 8:55446263-55446285 AACATGGGCTCAACCTCAGCAGG + Intronic
1041441397 8:57900855-57900877 CACTCCAGCTCACCCTCAGCTGG - Intergenic
1048026482 8:130591977-130591999 AAAGTCTGCTCGACCACAGCTGG + Intergenic
1049236087 8:141513123-141513145 AAGGCCTGCTCAGCCCCAGCAGG - Intergenic
1053218693 9:36293714-36293736 AAAACCTGTTCAACATCAGCAGG + Intronic
1053503573 9:38621492-38621514 AACCCCTGCTCAACCCCATCCGG - Intergenic
1055654394 9:78438772-78438794 CAGGCTTCCTCAACCTCAGCAGG + Intergenic
1057152555 9:92808405-92808427 AACCCCTGCTCAACCCCATCCGG + Intergenic
1059452011 9:114376587-114376609 ACCTCCTGCACAATCTCAGCTGG + Exonic
1187564887 X:20439364-20439386 AGCCCTTGTTCAACCTCAGCTGG - Intergenic
1192393351 X:70753746-70753768 AATACCAGCTCAACCACAGCAGG + Intronic
1194835144 X:98672592-98672614 AACACCAGCTCAACCACAGCAGG - Intergenic
1195382365 X:104282993-104283015 AACTCCTGCTCAAGCTCTGTGGG - Intergenic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic
1198022168 X:132669835-132669857 AAGGCCTGCTTAATCTCATCAGG + Intronic
1199076265 X:143530069-143530091 AATACCAGCTCAACCGCAGCAGG - Intergenic