ID: 1159527560

View in Genome Browser
Species Human (GRCh38)
Location 18:69612635-69612657
Sequence CTCCCATAGTACCCTAAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159527554_1159527560 8 Left 1159527554 18:69612604-69612626 CCCTCACGCTGCTTAGTGTCTTT 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1159527560 18:69612635-69612657 CTCCCATAGTACCCTAAAGCGGG 0: 1
1: 0
2: 0
3: 9
4: 69
1159527553_1159527560 9 Left 1159527553 18:69612603-69612625 CCCCTCACGCTGCTTAGTGTCTT 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1159527560 18:69612635-69612657 CTCCCATAGTACCCTAAAGCGGG 0: 1
1: 0
2: 0
3: 9
4: 69
1159527551_1159527560 21 Left 1159527551 18:69612591-69612613 CCTGCTTTGTTCCCCCTCACGCT 0: 1
1: 0
2: 1
3: 15
4: 152
Right 1159527560 18:69612635-69612657 CTCCCATAGTACCCTAAAGCGGG 0: 1
1: 0
2: 0
3: 9
4: 69
1159527555_1159527560 7 Left 1159527555 18:69612605-69612627 CCTCACGCTGCTTAGTGTCTTTG 0: 1
1: 0
2: 2
3: 11
4: 110
Right 1159527560 18:69612635-69612657 CTCCCATAGTACCCTAAAGCGGG 0: 1
1: 0
2: 0
3: 9
4: 69
1159527552_1159527560 10 Left 1159527552 18:69612602-69612624 CCCCCTCACGCTGCTTAGTGTCT 0: 1
1: 0
2: 1
3: 21
4: 295
Right 1159527560 18:69612635-69612657 CTCCCATAGTACCCTAAAGCGGG 0: 1
1: 0
2: 0
3: 9
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159527560 Original CRISPR CTCCCATAGTACCCTAAAGC GGG Intronic
915356118 1:155255875-155255897 CTCCCAGTTTACACTAAAGCCGG + Intergenic
917686510 1:177422054-177422076 ATCTCATAGTACCTTAAGGCTGG + Intergenic
920696965 1:208188269-208188291 CTTCTATCCTACCCTAAAGCAGG - Intronic
921326920 1:213994820-213994842 CTTTCATGATACCCTAAAGCAGG + Intronic
923070819 1:230562880-230562902 CTCCCATCTTTCCCTAAAGCTGG + Intergenic
1070799250 10:79235441-79235463 CTCTCCTAGCACCCTACAGCAGG + Intronic
1074981181 10:118621102-118621124 CTACCCTAGTACCCTGAAGGTGG + Intergenic
1077937313 11:6801605-6801627 GTCCCACAGATCCCTAAAGCAGG + Intergenic
1078985554 11:16592414-16592436 ATCACATAGTAACCTATAGCTGG - Intronic
1085813410 11:79708433-79708455 CACCTACAGTACCATAAAGCAGG - Intergenic
1089196496 11:116696554-116696576 CTGCCAGTGTAGCCTAAAGCTGG + Intergenic
1089905522 11:122033917-122033939 CTACCGTCATACCCTAAAGCTGG + Intergenic
1091070312 11:132556894-132556916 CTTCCAAAGTACCCTGAACCTGG + Intronic
1093093604 12:14947749-14947771 CTCCCCTAGTACCCCCAAGCTGG - Intronic
1096326017 12:50662812-50662834 CTACCAAAGTGACCTAAAGCGGG + Intronic
1099899481 12:88690477-88690499 CTCCCTTAGTACCCAGAAGAAGG + Intergenic
1106296755 13:28421074-28421096 CCCCCATAGTACTCTACTGCTGG + Intronic
1107637366 13:42406216-42406238 CTCCCAGGGTAGCCTAAAGTGGG - Intergenic
1113526413 13:110981460-110981482 CTGCCCTTCTACCCTAAAGCAGG + Intergenic
1117524552 14:56584554-56584576 GTCCCATACTACCCTAAAACTGG - Intronic
1118692695 14:68354969-68354991 CTCGGATAGTACCCTAATACTGG - Intronic
1121269814 14:92630694-92630716 CTCCCAGGGTACCCTTAAGGAGG + Intronic
1121550292 14:94794414-94794436 CTCCCACTGTACCCTATAACAGG + Intergenic
1202906382 14_GL000194v1_random:75963-75985 TCCCCATAGTACCTTTAAGCAGG + Intergenic
1143407869 17:6690006-6690028 TTTCCATACTACCCTGAAGCTGG + Intronic
1143793292 17:9315661-9315683 CTCCGATAGAAACCAAAAGCAGG - Intronic
1149916076 17:60610774-60610796 TTCCCCTAGTACACTAGAGCAGG - Intronic
1152020935 17:77779884-77779906 GGCCCATAGTTCCCTTAAGCGGG - Intergenic
1158388911 18:57027108-57027130 CTCCCACAATGCCCTCAAGCTGG + Exonic
1158830442 18:61271797-61271819 CTCCTTTAGTACACCAAAGCTGG + Intergenic
1159527560 18:69612635-69612657 CTCCCATAGTACCCTAAAGCGGG + Intronic
1166145156 19:40829187-40829209 CTCCCATCTTACCCTCAAGTAGG + Intronic
933945765 2:87284943-87284965 CTCCCACAGTAGCCAAAAACTGG - Intergenic
936334448 2:111576643-111576665 CTCCCACAGTAGCCAAAAACTGG + Intergenic
937465271 2:122126864-122126886 GTCCCATAGATCCCTAGAGCAGG - Intergenic
937686041 2:124698611-124698633 CTCACATAGTACCCTGAACTGGG + Intronic
938571994 2:132569642-132569664 GTCCCATCGTTCCCTAGAGCTGG + Intronic
946612628 2:221475881-221475903 TTCCTTTAGTGCCCTAAAGCAGG - Intronic
1174565885 20:51464172-51464194 CTCCCGTAGTTCTGTAAAGCAGG - Intronic
1176625727 21:9090762-9090784 TCCCCATAGTACCTTTAAGCAGG + Intergenic
951800882 3:26595083-26595105 CTCCTACAGTACCCAAAAGCTGG + Intergenic
952512336 3:34070038-34070060 CTCCCATAGTTTCCTAAATGGGG - Intergenic
954799248 3:53177689-53177711 CTCCCTAAGTACCCTATTGCTGG - Intronic
955875224 3:63482145-63482167 CTCACATTGTATCCTTAAGCAGG - Intronic
959468834 3:106723566-106723588 CATGCATAGTTCCCTAAAGCAGG + Intergenic
963494897 3:146046066-146046088 GTTCCATAGATCCCTAAAGCAGG + Intergenic
963858178 3:150278264-150278286 CTCCCTGAGAACCCTAAAGCTGG + Intergenic
965210976 3:165788426-165788448 CTCAAATAATACCCTAAAGCAGG - Intronic
976794608 4:88918578-88918600 GTCCCAAAGTAAACTAAAGCAGG + Intronic
981946094 4:150345920-150345942 CTCCCACAGCACCCAATAGCTGG + Intronic
987914040 5:24188513-24188535 CTACCATAGTACACTGATGCAGG + Intergenic
995582197 5:113613863-113613885 TTCGCAGAATACCCTAAAGCTGG - Intergenic
997242231 5:132315767-132315789 CTCCCAGAGCACCCTATAACAGG - Intronic
1004301778 6:14465116-14465138 CTCCCTTTCTACCCAAAAGCTGG + Intergenic
1004418138 6:15444122-15444144 CTCCAGAAGTACCATAAAGCAGG + Intronic
1010450854 6:76001096-76001118 ATACCATAGAACACTAAAGCTGG - Intronic
1011996448 6:93595069-93595091 ATTCCATATTACCCTAAATCTGG + Intergenic
1013279289 6:108620484-108620506 CTCCCATATTACTTTATAGCTGG + Intronic
1017737124 6:157375526-157375548 CTCCCAGAGTCCCCTAGAGCAGG + Intergenic
1025996683 7:66531664-66531686 TTCCCAGAGTCCCCTCAAGCTGG - Intergenic
1026119873 7:67527385-67527407 CTCCCAAAGTACTGTTAAGCTGG - Intergenic
1026585695 7:71654323-71654345 CTCCCATAAAACCCTCCAGCCGG - Intronic
1026603482 7:71796219-71796241 CTCATATAGTACCCAAAAGGTGG - Intronic
1026988738 7:74571067-74571089 TTCCCACAGTCCCCTCAAGCTGG - Intronic
1032737379 7:134704752-134704774 TTCCCAGAGTACCCTAGAGAGGG + Intergenic
1037211728 8:16396517-16396539 CTGCCACACTACCCCAAAGCTGG - Intronic
1039862361 8:41469636-41469658 CTTACATTTTACCCTAAAGCAGG - Intergenic
1039953778 8:42191832-42191854 CTCCCACAGGACCCTACAGCGGG - Intronic
1040987208 8:53308543-53308565 CTCACATAGTAACCTATGGCTGG + Intergenic
1044729687 8:95219961-95219983 CTTCCAGAGCACCCTAGAGCAGG + Intergenic
1048691730 8:136972849-136972871 CTCTCATAGTACTCACAAGCTGG - Intergenic
1050679652 9:8095568-8095590 CTCCCAGAGTACCCTTAGGCAGG - Intergenic
1058360107 9:104135447-104135469 TTCCCTTAGAACACTAAAGCTGG - Intronic
1059621158 9:116007084-116007106 CTCACATACTAAACTAAAGCTGG - Intergenic
1062205342 9:135333425-135333447 CTCCAAGAGGCCCCTAAAGCAGG - Intergenic
1203748901 Un_GL000218v1:61183-61205 TCCCCATAGTACCTTTAAGCAGG + Intergenic
1186478013 X:9873771-9873793 GTCCCATAAGACCCTGAAGCTGG + Exonic
1188433412 X:30132898-30132920 CTAACACAGTACCCTGAAGCAGG + Intergenic
1201162260 Y:11176189-11176211 TCCCCATAGTACCTTTAAGCAGG + Intergenic