ID: 1159531481

View in Genome Browser
Species Human (GRCh38)
Location 18:69661118-69661140
Sequence CTGTTGTTTATAAGCATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159531481_1159531483 8 Left 1159531481 18:69661118-69661140 CCCTGGATGCTTATAAACAACAG 0: 1
1: 0
2: 1
3: 43
4: 225
Right 1159531483 18:69661149-69661171 GTCTCCCAGTCCCCGAAGCTAGG 0: 1
1: 0
2: 0
3: 9
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159531481 Original CRISPR CTGTTGTTTATAAGCATCCA GGG (reversed) Intronic
903441587 1:23391967-23391989 CTGTTGTTTATAAACTACCCAGG + Intronic
903737695 1:25540833-25540855 CTCGTTGTTATAAGCATCCAAGG + Intergenic
903777773 1:25804276-25804298 CTGTAGTTTAAAGGCATCCTGGG + Intronic
910835070 1:91500687-91500709 CTGTTTTTTAAGATCATCCACGG + Intergenic
910993906 1:93083750-93083772 CTTTTGATTATAACCATCCTAGG + Intronic
911834118 1:102594220-102594242 CTATTGTTTATAAGTTACCAAGG + Intergenic
913118724 1:115720182-115720204 CTGTTGTTTATAAGCTACCCAGG - Intronic
915272423 1:154763810-154763832 ATCTTCTTTTTAAGCATCCAGGG - Intronic
915805278 1:158842011-158842033 CTTTTTCTTATACGCATCCAAGG + Intronic
918149949 1:181789780-181789802 CAGTTGTTTAGAGGCCTCCAAGG - Intronic
920803300 1:209209103-209209125 CTGTAGCTTATAAGCAGCCCAGG - Intergenic
924895528 1:248334368-248334390 CTGTTGTTTATAAACTACCCAGG - Intergenic
1062785659 10:262612-262634 TTGTTGTTTATGATCATCCTTGG + Intergenic
1063036667 10:2292991-2293013 CAGTTGTTCATAAACATACAGGG - Intergenic
1064934101 10:20660824-20660846 CTGTTGTTAATAAGCCACCCAGG + Intergenic
1065327482 10:24561625-24561647 CTGTTGTTTATGAGCCACCGAGG + Intergenic
1065491273 10:26284152-26284174 CATTTGTTTATTGGCATCCAAGG + Intronic
1068098295 10:52519926-52519948 CGGATGTTTGTAAGCAGCCATGG - Intergenic
1068463169 10:57353177-57353199 CTGTTTTATATAAACATCCTTGG - Intergenic
1068517065 10:58038082-58038104 CTGTTGTTTTTAAGCCACCCAGG - Intergenic
1068524763 10:58115949-58115971 CTGTTGTTTATAAGCTAACGAGG - Intergenic
1069952120 10:72026187-72026209 CTGTTGTTTAAAAGCACCCAGGG + Intergenic
1070044893 10:72823285-72823307 CTGTATTTTCTAAGCATGCACGG - Intronic
1070833573 10:79434630-79434652 CTGTTTGTTATAAGCTTCCCAGG - Intronic
1071178037 10:82950133-82950155 CTGTTTTTTATTAGGCTCCAAGG + Intronic
1071679971 10:87695126-87695148 TTGTTTTTTATAAGCCACCAGGG - Intronic
1073144717 10:101272894-101272916 CTTTTCTTTCTAAGCATCCCTGG + Intergenic
1073470481 10:103719114-103719136 CTGTTGTTTATAAGCCACCCAGG + Intronic
1073807804 10:107118317-107118339 CTGTTGTTTATAAGCCACCCAGG + Intronic
1074832548 10:117259670-117259692 CTGTTGTCTTCTAGCATCCAGGG + Intronic
1075196456 10:120363746-120363768 CTGTTGTTTAAAAGCCTCCCAGG + Intergenic
1082172629 11:49024569-49024591 CTGTTGTTTATAAACAAAAATGG + Intergenic
1082178816 11:49093941-49093963 CTGAGGATTATTAGCATCCAAGG - Intergenic
1082863810 11:57880022-57880044 CACTTGGTTATCAGCATCCATGG - Intergenic
1082983266 11:59143443-59143465 CTGTTCTTTTTAAGTTTCCAGGG - Intronic
1084794992 11:71499504-71499526 CTGTCGTTTCTAAGTAGCCAGGG + Intronic
1085451259 11:76635353-76635375 CTGTGCTTTGTAAGCATTCATGG + Intergenic
1086485867 11:87300983-87301005 CTGTTCTTTATCAGCAACAAGGG - Intronic
1086686458 11:89738892-89738914 CTGAGGATTATTAGCATCCAAGG + Intergenic
1086693136 11:89811483-89811505 CTGTTGTTTATAAACAAGAATGG - Intergenic
1086712669 11:90028174-90028196 CTGTTGTTTATAAACAAGAATGG + Intergenic
1087221960 11:95556161-95556183 CTGATGTTTATAAGAAAGCAGGG + Intergenic
1090506692 11:127322405-127322427 CTGTTGTTTATAAGCCACCTAGG - Intergenic
1091760392 12:3083670-3083692 CTTTTGTTTGTCAGCAGCCAAGG + Exonic
1091924308 12:4332204-4332226 CTTTTGTGTATAAGCATTCAAGG + Intronic
1092908289 12:13122380-13122402 CTGCTGTTTATAAGCCACCCAGG - Intronic
1092932706 12:13331931-13331953 CTATTGTTTATAAGCCACCCAGG - Intergenic
1095574537 12:43720663-43720685 CTATTCTTTTAAAGCATCCATGG - Intergenic
1096018487 12:48301010-48301032 CTGTTGTTTATAAGCCACCTAGG + Intergenic
1097561610 12:61213749-61213771 CTATTGTTTATAAGCGGCCTAGG - Intergenic
1098492250 12:71095215-71095237 CTTTTGTTTATAAGCCACCTAGG - Intronic
1099638674 12:85253456-85253478 CTGTTATTTAGAACCATCTAAGG + Intronic
1100068523 12:90681340-90681362 CTGTTGTATAGAATCACCCATGG + Intergenic
1101613997 12:106318535-106318557 CTATTGTTTATAAGCCACCCAGG - Intronic
1101740278 12:107495023-107495045 CTGTTGCTTCTCAGCAACCAGGG + Intronic
1102231782 12:111267594-111267616 CTGTTGTTTTAAGGCATCCATGG - Intronic
1103269534 12:119661523-119661545 CTGTTTTTTAAAAGTCTCCATGG + Intergenic
1104397346 12:128445690-128445712 CTGGTGTTTACAAACCTCCAGGG + Intronic
1105690179 13:22829863-22829885 CAGTTGTCTCTCAGCATCCATGG + Intergenic
1105810345 13:23989997-23990019 CTGTTGTTTATAAGCCACCCAGG + Intronic
1106324931 13:28679952-28679974 CTGATTCCTATAAGCATCCAGGG - Intergenic
1108057012 13:46495169-46495191 CTGTTGTTTATAAGCCACCTAGG - Intergenic
1108431949 13:50362104-50362126 CTGATGGTTGTCAGCATCCAGGG - Intronic
1111406017 13:87807901-87807923 CTGTTATCTATGAGCATGCATGG - Intergenic
1113371169 13:109726864-109726886 CTCTTCTTTGCAAGCATCCAGGG - Intergenic
1113763796 13:112868325-112868347 CTGATGTATAAAAACATCCACGG - Intronic
1116856304 14:49955312-49955334 ATGTTGTTTATAAGCTCCTAAGG - Intergenic
1117748640 14:58897867-58897889 CTGTTGTTTATAAGCCACCCAGG - Intergenic
1117946036 14:61022397-61022419 ATGTTGTTTGCAAGCATACATGG - Intronic
1118815545 14:69311103-69311125 CTGTTGTTTATAAGCCACCCTGG - Intronic
1119660304 14:76446571-76446593 CTGTTTTTTCTATGCCTCCAGGG - Intronic
1121272462 14:92647385-92647407 CAGTTGATTACAAGCGTCCAAGG + Intronic
1122581292 14:102773311-102773333 CATTTGTTTACAAGCATCCCTGG + Intergenic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1123451910 15:20372630-20372652 CAGATGTTTACAAGCATCCCTGG - Intergenic
1124642606 15:31405495-31405517 CTGCTGTTTATAACCAACCCTGG + Intronic
1124642724 15:31406422-31406444 CTGTTGTTTATAACCAACCCTGG + Intronic
1125983991 15:44031373-44031395 CTGTTGTTTATAAGCCACCCAGG - Intronic
1126741176 15:51777818-51777840 CTGTTGTTTCCTTGCATCCAAGG - Intronic
1131382071 15:91972558-91972580 CTGTTGTTTATAAGCCACCCAGG + Intronic
1134306504 16:13037832-13037854 AAGTTCTTTATAAGCATCAAGGG + Intronic
1134564216 16:15237052-15237074 CTGTTGTATAAAAGCTGCCATGG + Intergenic
1134600422 16:15529330-15529352 TTGTTGTTTATAAGCCACCTAGG + Intronic
1134738278 16:16519647-16519669 CTGTTGTATAAAAGCTGCCATGG - Intergenic
1134929223 16:18192516-18192538 CTGTTGTATAAAAGCTGCCATGG + Intergenic
1135846397 16:25922477-25922499 CTATTGTTTATAAGCTACCCAGG + Intronic
1138090370 16:54168839-54168861 ATGGTGTTTAACAGCATCCATGG - Intergenic
1140982880 16:80127493-80127515 CTGTTTTTTTTCAACATCCATGG - Intergenic
1141874457 16:86813071-86813093 CTGTTGTATATACCCATCTAAGG + Intergenic
1147836716 17:43338076-43338098 CTGTTGCTTATGAGCAGCCATGG + Intergenic
1148354418 17:46965955-46965977 CTGCTGTTTATAATGATGCAGGG + Intronic
1148921154 17:51035945-51035967 CTGTGGTAAATAACCATCCAAGG - Intronic
1151106953 17:71626126-71626148 CTGTTGTTTATAAGACACCCAGG + Intergenic
1151824830 17:76518409-76518431 CTATTGTTTATAAGCAGTCCAGG + Intergenic
1153967239 18:10192914-10192936 CTGTCATTTATAAAGATCCAGGG - Intergenic
1154331847 18:13436439-13436461 CTGTGGTTTGAAAGGATCCAAGG - Intronic
1156243930 18:35279543-35279565 CTGTTGTTTATAAGCTACCCAGG - Intronic
1156418971 18:36929851-36929873 CTGTTGTTTGTAAGCCACCCGGG + Intronic
1156681004 18:39588510-39588532 CTGTCTTTTATATGTATCCATGG + Intergenic
1156869341 18:41927445-41927467 CTGTTGTTTATAAGCCACCCAGG + Intergenic
1157136486 18:45061944-45061966 CTTATGTTTATAAACAGCCAGGG + Intronic
1158876679 18:61740626-61740648 CTTTTGTTTATTAGCATACTGGG - Intergenic
1159472720 18:68878719-68878741 CTCTTGTTTATAAGCTACCCAGG + Intronic
1159531481 18:69661118-69661140 CTGTTGTTTATAAGCATCCAGGG - Intronic
1159861731 18:73657121-73657143 CTGTTCTTTTTAAGCATGCATGG - Intergenic
1160128325 18:76200679-76200701 GTTTTGTTTTCAAGCATCCATGG + Intergenic
1160346589 18:78137345-78137367 CTGTTTTTTATAAGCCACCTAGG + Intergenic
1161669387 19:5596753-5596775 GTGTTGTTTAAAAGCTTCCTGGG - Intronic
1166007977 19:39920115-39920137 GTGTTGTTTATAAGCCTCCCAGG + Intronic
925213545 2:2072540-2072562 CTGTTATTTGTAAGCTACCAAGG - Intronic
926367240 2:12144629-12144651 CTTATGTTTAGAAGCATACAAGG + Intergenic
926485061 2:13443675-13443697 CAGATGTTTACAAGCATCCCTGG + Intergenic
927662950 2:25008315-25008337 CTGTCGTTTATAAGTACCCAGGG - Intergenic
927819219 2:26247886-26247908 CTGTTGTTCCTCAGTATCCAAGG - Intronic
928326825 2:30325806-30325828 CTGTTGTTGATAAGCCACCCAGG + Intergenic
929189100 2:39123158-39123180 GTGATGTTTATAACCAGCCAAGG - Intronic
930625374 2:53691210-53691232 CTTTTGTTTATAAACTACCATGG + Intronic
931940354 2:67245216-67245238 CTGCTGTATATAAAGATCCATGG + Intergenic
932396118 2:71449566-71449588 TTGTTGTTTTTAAGCCACCATGG - Intergenic
932943934 2:76204547-76204569 CTGTTGGTTATAAGCTACCTAGG + Intergenic
934066357 2:88345599-88345621 CTGTTGTTGAAAAGCATGCTTGG - Intergenic
935176523 2:100653973-100653995 CTGTTGTTTATAAGCCACTGTGG - Intergenic
938586392 2:132694893-132694915 CTCTTGTTTATAAGCTACCCAGG - Intronic
940122165 2:150278776-150278798 CTCTTGTTTATAAGCCACCCAGG + Intergenic
940340020 2:152570502-152570524 CTTTTGTGTACAAGCATCCAGGG + Intronic
940424771 2:153517841-153517863 CTGTAGTTGATGAGCATCCTAGG - Intergenic
942216768 2:173728802-173728824 CTGTTGTTTATAAGCCACCCAGG + Intergenic
942789595 2:179744838-179744860 CTGGTGTTTCTAAGCATGAATGG - Intronic
943366532 2:186972283-186972305 CTGTTGTTTGTAAGGCACCATGG + Intergenic
943877441 2:193089317-193089339 GTGTTGTGTCTAAACATCCAAGG + Intergenic
943981333 2:194555050-194555072 CTGTTATTTATACCCACCCATGG + Intergenic
944217803 2:197273253-197273275 TTGTTGTCTATCAGAATCCATGG - Intronic
947336555 2:229091690-229091712 CTGTTGTTCATAAGCTACCCAGG + Intronic
947444600 2:230154490-230154512 CTGTTGTTTAAATGCTCCCAAGG - Intergenic
948963565 2:241358320-241358342 CTGTTTTTTGTAAATATCCAGGG - Intronic
1169477695 20:5947625-5947647 CTGTTGTATGTAAGTATCTAGGG - Intronic
1170122845 20:12928774-12928796 CCGTTGTTTATAAGCCACCCAGG - Intergenic
1170743773 20:19080613-19080635 CTGTTGCTTATAAGCCACCCAGG - Intergenic
1170765680 20:19288421-19288443 CTGTTCTTTAAAAGCAGCCCAGG + Intronic
1171890980 20:30715024-30715046 CTTTGGTCTATAAGCATCTAGGG + Intergenic
1175184371 20:57170056-57170078 CTGTTGTTAAGAAGCACCAATGG - Exonic
1175759021 20:61548722-61548744 CTGTTCTTTAAAACCTTCCAAGG - Intronic
1177707018 21:24719769-24719791 CTGTTGTTTATAAACTACCCAGG - Intergenic
1178726119 21:35053270-35053292 CTGCTGTCTAGAAACATCCAGGG - Intronic
1178762437 21:35416402-35416424 CTATTATTTAAAAGCATCCTAGG - Intronic
1179239295 21:39574886-39574908 CTGTTGTTTATAAGCCACCCCGG - Intronic
1180318934 22:11303335-11303357 CTGCTGCTTATAAGCCTCCTAGG - Intergenic
1181591261 22:23886385-23886407 CTGTTGTTTATAAGCCACCCAGG - Intronic
1181665606 22:24394208-24394230 CTGTTGTTTATAAGCCACCCAGG - Intronic
1181842110 22:25672503-25672525 CTATTGTTTATAAGGAAGCATGG - Intronic
1184540569 22:45121279-45121301 CTGTTGATGAGAAGAATCCATGG - Intergenic
1185097574 22:48819833-48819855 CTGTTGTTTGTCTGCATCCACGG + Intronic
950798840 3:15532979-15533001 CTGTTGTTTATAAGCCACCCAGG - Intergenic
953260287 3:41331837-41331859 CTGCTGTTTATAAGGCACCAAGG - Intronic
955023345 3:55142891-55142913 CTGTTGTTTCAAATCATACAGGG - Intergenic
955202749 3:56865862-56865884 CTGTTGTTTATAACCCACCCAGG + Intronic
955802511 3:62700854-62700876 CTGTTGTTTATAAGCCACCCAGG - Intronic
955932803 3:64074703-64074725 CATTTGTTTAAAAGCTTCCAAGG + Intergenic
956312209 3:67893777-67893799 CTGTTGTTTGTAAGCTTCGGAGG - Intergenic
956619679 3:71208985-71209007 TTGTTGTTTATAAGCAAACATGG - Intronic
957748923 3:84386218-84386240 CTGGTGTTTATGAGAATCTATGG + Intergenic
958758937 3:98283986-98284008 ATGTTATTCAAAAGCATCCAAGG + Intergenic
959581961 3:107991738-107991760 CTGTACTTTATAATCACCCAAGG + Intergenic
959958886 3:112273471-112273493 CTGTTGTCCATAAGCCTCAAAGG + Intronic
961077243 3:123993348-123993370 CTGTTCGTTTTAAGCACCCAAGG + Intergenic
961557585 3:127707136-127707158 CTGTTCTTTATAAGTACCCTGGG - Intronic
961801613 3:129454728-129454750 CTGGTGTTTATAAGCATAGCAGG + Intronic
962488922 3:135871964-135871986 GTTTTGTTTATAAGGATCCCTGG + Intergenic
962948277 3:140194150-140194172 CTGTTGTTTATTAGCCACCTAGG - Intronic
963404754 3:144848564-144848586 CTGTTGTTTATAAGCTACCCAGG + Intergenic
964015869 3:151945728-151945750 CTGTTGTTTATAACCTACCCTGG + Intergenic
965279634 3:166733436-166733458 CTGTTGTTTATAAACCACCCAGG - Intergenic
965840100 3:172894920-172894942 CTGTTGTTCATAAGCTACCCAGG + Intronic
970284386 4:14493693-14493715 CTGTTGTTTATAAGCCATCCAGG + Intergenic
972396047 4:38660770-38660792 CTGTTGCTTAAAAGCACTCAGGG + Intergenic
973971042 4:56214079-56214101 CTGTTGTTTATAAGCCACCCAGG - Intronic
974404283 4:61445734-61445756 CTGTAGTTTAAAAGCATTTAAGG - Intronic
974844302 4:67332637-67332659 CTGCTGTATATAATCATTCAGGG + Intergenic
977240258 4:94560049-94560071 TGGTGGTTTAGAAGCATCCAAGG + Intronic
977377010 4:96218314-96218336 ATGTTCTTTATAACCATTCATGG - Intergenic
977513018 4:97985371-97985393 ATGTTTTTAATATGCATCCAGGG + Intronic
978844010 4:113250672-113250694 GTGTTGTATTTAAGGATCCAAGG - Intronic
980834158 4:138170140-138170162 CTGTTATTTATAAACATCTAAGG - Exonic
981746057 4:148053395-148053417 CTGTGGTTTATAATTATCTATGG + Intronic
981978408 4:150760480-150760502 CTTTTGTTTAAAATCTTCCAAGG + Intronic
982962506 4:161858291-161858313 CTGCTGTTTATAAGCCACCCAGG + Intronic
983331594 4:166335560-166335582 AAGTTCTTTAAAAGCATCCAGGG + Intergenic
986257842 5:6115493-6115515 CTGTTGTTTGTAAGCTGCCTAGG + Intergenic
987317208 5:16734858-16734880 CTGCTGTTTATCAGCCACCACGG + Intronic
988283210 5:29176289-29176311 CTGTTTTTTATCTGCACCCATGG - Intergenic
988777931 5:34493959-34493981 CTATTGTTTATAAGCCACCTAGG + Intergenic
989481393 5:41934575-41934597 CTGTTTTTTCCAAGCACCCAGGG + Intronic
989854557 5:46266052-46266074 CTGGTTTTTATAATCAGCCAAGG - Intergenic
991036638 5:62134302-62134324 CTATTGTTTATAAGCCACCCAGG - Intergenic
991173504 5:63657305-63657327 TTTTTGTTAAGAAGCATCCAGGG + Intergenic
992157920 5:73972939-73972961 CTGTTGTTTATAAGCTACCCAGG - Intergenic
992940993 5:81761228-81761250 CCGTTGTTTCTAAGAATACAAGG - Intergenic
995126477 5:108581747-108581769 CTGCTGTTTATAAGCCCCCTAGG - Intergenic
996170781 5:120288065-120288087 CTGCTGTTTATAATCCTTCAAGG + Intergenic
997385819 5:133471643-133471665 CTGTTGTTTATCAGCTACCCAGG + Intronic
998559688 5:143159726-143159748 CTATTTTATATAAGAATCCAGGG + Intronic
999945920 5:156595410-156595432 CTGTTGTTTATAAGCCACCCAGG + Intronic
1000702627 5:164472491-164472513 CTGATGTTTATAAGGACACAAGG - Intergenic
1002864174 6:1106863-1106885 CTGTTGTTTATAAGCATTTGTGG + Intergenic
1007069835 6:39028282-39028304 CTGTTGTTTTTAGCCACCCAAGG - Intronic
1008652268 6:53575561-53575583 CTGTTGTTTATAAGCTACCCAGG + Intronic
1009690268 6:67021669-67021691 CTCTTGTTTATCAGCACACATGG + Intergenic
1010687642 6:78871074-78871096 CTGTTGTTTATAAGCTACCCAGG - Intronic
1011698941 6:89937502-89937524 ATGTTGATTATGAGCATCTATGG - Intronic
1012354586 6:98298007-98298029 GTGTTGTTGAGAAGCTTCCAAGG - Intergenic
1020891705 7:13886352-13886374 GTGTTCTTTCTGAGCATCCATGG + Intergenic
1021531582 7:21652557-21652579 CTGTTGGTTATAAACATACAGGG - Intronic
1023359617 7:39401667-39401689 CTGCTGTTTCTAGGCATCCACGG + Intronic
1023662197 7:42481222-42481244 CTGATTTTTTTAAGCAACCAAGG - Intergenic
1023900746 7:44476605-44476627 CTGTTGTTTATAAGCCACCCAGG + Intronic
1023973061 7:45005986-45006008 CTATTGTTTATTAGCACCAATGG + Intronic
1024267794 7:47620007-47620029 CTGTTGTCTATAAGCCACCCAGG + Intergenic
1024319206 7:48048410-48048432 CTGTTGGTTACCAGCATTCATGG + Intronic
1027214400 7:76174472-76174494 CTGATGTTTCTCAGAATCCACGG - Intergenic
1028032929 7:85940628-85940650 CTTTTGATTAATAGCATCCATGG - Intergenic
1029366602 7:100120327-100120349 CTTTTGTTTATGAGCTTCAAAGG - Intronic
1030800035 7:113838321-113838343 CTCTTCTTTATAAGGAACCAGGG + Intergenic
1031866875 7:127047188-127047210 CTGTGGCTTAAAAGCAGCCATGG - Intronic
1032510065 7:132465444-132465466 CTGGGGCTTATAAGAATCCAGGG + Intronic
1033841401 7:145378720-145378742 CTGTTGTTCATAACCAGCCATGG + Intergenic
1034715797 7:153240160-153240182 CTGTTGTGCAAAAGCAGCCATGG + Intergenic
1035071092 7:156145566-156145588 CTGTAGTTTATAATAATGCATGG + Intergenic
1036388081 8:8299079-8299101 GTATTGTTAATGAGCATCCAAGG - Intergenic
1036705084 8:11040556-11040578 CTGTTGTTTGTAAGCCTCCCAGG - Intronic
1041219636 8:55636099-55636121 CTGTTGTGTATAAGCCCCCCAGG + Intergenic
1042382401 8:68132581-68132603 CTGTTTTTAATAACCATCAAAGG - Intronic
1042634657 8:70860456-70860478 TTTTTGTTTATAAGCCACCAAGG + Intergenic
1042945960 8:74154673-74154695 CTGTTGTTTCCAAGCTTCAAGGG - Intergenic
1043157703 8:76805631-76805653 CTATTTTTTATAAGCATCAGAGG + Intronic
1044379276 8:91514815-91514837 ATATTGTTTATAAGCAACTATGG + Intergenic
1047896205 8:129369138-129369160 CTGTTGATTATAAGCCACCCAGG + Intergenic
1048250246 8:132860008-132860030 ATGTTCTTTTCAAGCATCCATGG - Intergenic
1048450689 8:134530984-134531006 CAGTTGTTCCTAGGCATCCATGG - Intronic
1048681088 8:136842681-136842703 CTGAGGTTTTTAAGGATCCAAGG - Intergenic
1050844596 9:10198659-10198681 CAGTTGTTTATCTGCTTCCAAGG - Intronic
1052117937 9:24671616-24671638 CTTTCCTTTATAGGCATCCAGGG + Intergenic
1052325671 9:27214791-27214813 TTGATGTTGATAAGCATGCAGGG - Intronic
1052806127 9:33014866-33014888 GTGCTCTTTATAAGCATCCCTGG + Intronic
1053488538 9:38481641-38481663 GAGTTGTTTATCAGCATCCCTGG - Intergenic
1056100294 9:83294323-83294345 CTGTTGTCTATAAGCCACCCTGG + Intronic
1056219261 9:84435358-84435380 CTATTGTTTATAAGCCACCTGGG - Intergenic
1056791847 9:89630981-89631003 CTGTTGTATATAAGCCACCTAGG + Intergenic
1056947717 9:91013922-91013944 CTGTTGTTGATGACCATTCAGGG - Intergenic
1057056301 9:91963830-91963852 CTGTTGTTTATAAGCCACTCAGG + Intergenic
1057082281 9:92181765-92181787 CTGTTGCTTCTAAGCCACCAAGG - Intergenic
1057477232 9:95412926-95412948 CTGCTGCTTTTTAGCATCCACGG - Intergenic
1057668894 9:97070942-97070964 GAGTTGTTTATCAGCATCCCTGG - Intergenic
1058337074 9:103843326-103843348 CTGTTTTCTATAAGCTTACATGG - Intergenic
1058783427 9:108362455-108362477 CTGTAATTTATAAGCCTCCCAGG + Intergenic
1060032294 9:120225456-120225478 CTGTTTTTAATAAGGGTCCAGGG + Intergenic
1060261408 9:122077762-122077784 ATGTTGTTTTCAAGCATACATGG + Intronic
1185636160 X:1553699-1553721 CTGTTGTTTCTAAGCCACCGAGG + Intergenic
1185849204 X:3469594-3469616 CTGTTGTTTGTAAGCCACCCAGG + Intergenic
1185969027 X:4641142-4641164 CTGTAGTTTATAAGCCACCCAGG + Intergenic
1186287452 X:8060772-8060794 CTGTTGTTCATAAGCCACCCAGG + Intergenic
1187451037 X:19396491-19396513 GTCTTGTTTCTAAGCATCCTTGG + Intronic
1192890475 X:75385171-75385193 TTGTTGTTTAGAAGCATCTGTGG - Intronic
1193622554 X:83773810-83773832 TTCTTGTTCATAAGCATACATGG + Intergenic
1196372130 X:114991030-114991052 TTGTTGTTTATAAGCCACCCAGG + Intergenic
1197005021 X:121485668-121485690 CTGCTGTTTCTATTCATCCAGGG - Intergenic
1201071532 Y:10151147-10151169 CTGTTGCTTATAAGCCCCCTAGG + Intergenic
1202282546 Y:23205041-23205063 CTGTTGTTTATAAGCCATCCAGG + Intergenic
1202283345 Y:23213478-23213500 CTGTTGTTTATAAGCCATCCAGG - Intergenic
1202434219 Y:24819426-24819448 CTGTTGTTTATAAGCCATCCAGG + Intergenic
1202435020 Y:24827864-24827886 CTGTTGTTTATAAGCCATCCAGG - Intergenic