ID: 1159532421

View in Genome Browser
Species Human (GRCh38)
Location 18:69671514-69671536
Sequence GGAATATTTATGCAACCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159532421 Original CRISPR GGAATATTTATGCAACCTGA AGG (reversed) Intronic
900527820 1:3137695-3137717 GGAATATTTCATCAACCTGCTGG - Intronic
905333286 1:37224255-37224277 GGAATAGTTATGTATCTTGATGG + Intergenic
905767777 1:40616436-40616458 GAAAGACTTATGCTACCTGATGG - Intergenic
908061820 1:60358388-60358410 GAATTATTAATGCAACCTTAAGG - Intergenic
909897775 1:81094799-81094821 TGTATATTTATGCAACCACACGG - Intergenic
910137756 1:83992743-83992765 TTAATATTTATGAAACCAGATGG - Intronic
910572561 1:88722279-88722301 TGAATATGTATGCGACCTAATGG + Intronic
912197045 1:107410243-107410265 AGAATATGTATGTAAACTGATGG - Intronic
918201283 1:182269509-182269531 TAAATATTTATGAAACCTGAAGG + Intergenic
921164902 1:212499930-212499952 AGAATCTGTATGCAGCCTGAAGG + Intergenic
924632805 1:245757911-245757933 GAAATATATATGGAACCTCAAGG - Intronic
1066976554 10:42373605-42373627 TGTATATTTTTGAAACCTGATGG - Intergenic
1069835999 10:71308516-71308538 GGAGAATTGCTGCAACCTGAGGG - Intergenic
1084933837 11:72576521-72576543 GGAATGTTTCTGCAACCCTAAGG - Exonic
1086157924 11:83688436-83688458 TGAAGATTTATGCATCCAGAAGG + Intronic
1086249945 11:84800924-84800946 GGAATATTTTTGCCACCACATGG + Intronic
1086722365 11:90136391-90136413 GGAATATTTTTGTAGCATGATGG - Intronic
1087726382 11:101721716-101721738 GGAATAAATTTGCAACCTCATGG + Intronic
1089738334 11:120564682-120564704 GGAATACTAATGCACCCTAAAGG + Intronic
1091629380 12:2147968-2147990 AGAATATTTATGCAACTTCTAGG + Intronic
1092793269 12:12087569-12087591 GGAATGTTTTTTCAACCTGCTGG - Intronic
1092913627 12:13170223-13170245 AGAATATCTATGAAACTTGAAGG + Intergenic
1094024338 12:25946576-25946598 GGTACATTTCTGCTACCTGATGG - Intergenic
1094351118 12:29526066-29526088 GGTACATTTCTGCTACCTGATGG - Intronic
1094412283 12:30179274-30179296 GTAAAATTTATGCTACTTGAGGG - Intergenic
1097912782 12:64988666-64988688 GGTAAATTTCTGCTACCTGATGG + Intergenic
1098711881 12:73773116-73773138 GGCATATTTTTGCTACCTGATGG + Intergenic
1105810848 13:23993808-23993830 GCAGTATTTATGCAGGCTGAGGG + Intronic
1107255560 13:38422166-38422188 GGTATATCTCTGCTACCTGATGG - Intergenic
1107629430 13:42328096-42328118 AGAATATTTGTCAAACCTGAAGG - Intergenic
1108230443 13:48333879-48333901 TGAATATGTAAGCATCCTGAAGG - Intronic
1115978708 14:39025070-39025092 TTAATATTTCAGCAACCTGATGG + Intergenic
1118678915 14:68218967-68218989 GGAAAATTTCTGCAGCCTGATGG + Intronic
1120624548 14:86808365-86808387 AGAAGATTTATTCAATCTGATGG + Intergenic
1127634207 15:60853657-60853679 GGAATATTAATGGAACCACATGG - Intronic
1131404965 15:92156734-92156756 GGAATCTCTATTCAACCTGGTGG - Intronic
1131416931 15:92268239-92268261 GGAATAGCTGTGCAACCTCAGGG + Intergenic
1133190704 16:4131731-4131753 GTCACATTTATGCCACCTGAGGG + Intergenic
1137040300 16:35605385-35605407 GGTACATTTATGCTACCTGATGG - Intergenic
1137258871 16:46805135-46805157 AGAAAATTTTTCCAACCTGAAGG - Intronic
1137355172 16:47755532-47755554 GGAATATTTCTGGAACCAGAAGG - Intergenic
1143646974 17:8236573-8236595 GGAATATTTATGTATTTTGAAGG - Intronic
1143709494 17:8724580-8724602 GGATTATGTCAGCAACCTGAAGG + Intergenic
1145826379 17:27880085-27880107 AGAATATAAATGCAACCAGAAGG + Intronic
1150301081 17:64047464-64047486 TTAATATTTATTGAACCTGAGGG + Intronic
1153431567 18:5023076-5023098 GCAAAATTTATGTACCCTGAAGG + Intergenic
1155067646 18:22281539-22281561 AGAATATTTGTGCAAGGTGAGGG - Intergenic
1155823223 18:30404723-30404745 GGAATAGTTCTGCAAATTGAAGG - Intergenic
1157357117 18:46946069-46946091 TGAATATTTTTGTATCCTGAAGG + Intronic
1158091500 18:53719316-53719338 GGAATATTTCTCCAAACAGATGG - Intergenic
1159220674 18:65459795-65459817 GGAGCATTTATGGAACCTGTGGG + Intergenic
1159246877 18:65817372-65817394 GGATTCTTTTTGCAACCTGTAGG - Intronic
1159532421 18:69671514-69671536 GGAATATTTATGCAACCTGAAGG - Intronic
1162276963 19:9663467-9663489 GGAAAATTTATGCAGTCTGGAGG - Intronic
926174826 2:10581444-10581466 GAAGTATTTATGCAGCCAGAAGG + Intronic
926677839 2:15641220-15641242 GGAATATTTATTTTACTTGAAGG + Intergenic
930065698 2:47325869-47325891 GGTAGATTTATTCAACCTAAAGG + Intergenic
932174052 2:69583458-69583480 GGCACATTTTTGAAACCTGAAGG + Intronic
933743261 2:85551704-85551726 GGAATGTTTTTGAAACCTAAGGG - Intronic
935850993 2:107218544-107218566 GGTATATTTCTGCTACGTGATGG + Intergenic
935865526 2:107383790-107383812 GGAAAGTTTAGCCAACCTGATGG + Intergenic
942836937 2:180311616-180311638 GGAAGAGTTATGCAACATGCTGG - Intergenic
946580707 2:221125561-221125583 GGAATATTTCTGCAAAATGCTGG - Intergenic
1173491009 20:43481595-43481617 GGTATATTTCTGCTACCTGATGG - Intergenic
1175412826 20:58782679-58782701 GGAATATTTATGCAGGCTGGTGG + Intergenic
1175431896 20:58910979-58911001 GGAACATCTAAGCAAGCTGAAGG - Exonic
1177661970 21:24096269-24096291 AGGAAATTTATGCATCCTGAAGG - Intergenic
1177833409 21:26165300-26165322 TTAATATATATGTAACCTGATGG - Intronic
1178373238 21:32044922-32044944 GGAATATTTATAGATGCTGAGGG + Intergenic
1179079453 21:38157261-38157283 GAAATATGAATGCAACCTCAGGG + Intronic
1181731766 22:24852336-24852358 GGAATAATTCTGTATCCTGATGG - Intronic
1181820177 22:25469336-25469358 GGAATAATTAGGCAAACTGGGGG - Intergenic
950320372 3:12046868-12046890 GGAACATTGAAGGAACCTGAAGG + Intronic
950629096 3:14269709-14269731 GGAATAGTTCTACAGCCTGATGG - Intergenic
952306761 3:32153744-32153766 AGAATGTTTATGTAACCTGCAGG + Intronic
955936957 3:64111154-64111176 GGAATAATCATACAACCTAAGGG + Intronic
956047803 3:65215011-65215033 GGAATACTTATCCACCCTCATGG + Intergenic
959750181 3:109825329-109825351 AGATTATCTATGCAACCTAAAGG - Intergenic
962667304 3:137667689-137667711 GGAACATTTATGCGTGCTGATGG - Intergenic
964153062 3:153551183-153551205 CGAATATTTAAGCAATCAGATGG - Intergenic
965224981 3:165976727-165976749 GCAATATTTATGCATCATGGAGG - Intergenic
966986313 3:185183517-185183539 AGAATATTTATGAAAACTGATGG + Intergenic
967080234 3:186043102-186043124 GGAATATTTATGGAACAACAAGG - Intergenic
969890590 4:10256281-10256303 GGAATACTGATGCTGCCTGATGG - Intergenic
973268359 4:48233956-48233978 GGAAAATTTCTTCAAACTGAAGG + Intronic
977484764 4:97628881-97628903 GGAATCTATACACAACCTGAGGG + Intronic
977707129 4:100084599-100084621 GGAATGTTTATACACGCTGATGG - Intergenic
980565000 4:134528101-134528123 GGTGTATTTCTGCCACCTGATGG - Intergenic
982410372 4:155069441-155069463 GTGATATGTATGCAACATGAAGG - Intergenic
982613448 4:157608223-157608245 GGAAGAAATATGAAACCTGAAGG + Intergenic
987073005 5:14355441-14355463 GGAATATCAATGCCACCTAAAGG - Intronic
989296601 5:39835135-39835157 GGAATATGTTTGGAACCAGATGG - Intergenic
996563165 5:124852037-124852059 GCATTCTTTATGCAACCTGGAGG - Intergenic
998796597 5:145826416-145826438 GGCATATGTATGCAGCCTGTGGG - Intronic
999554590 5:152726772-152726794 GGTACATTTCTGCTACCTGATGG + Intergenic
1003638306 6:7854932-7854954 GGAAACTTTATACAAACTGACGG - Intronic
1003761289 6:9181359-9181381 GGAAAATTTAAGTAACCTTATGG + Intergenic
1005858598 6:29884010-29884032 GGAATTCTCATGCAATCTGATGG + Intergenic
1010448412 6:75975078-75975100 GGAACATATATGCTCCCTGAAGG + Intronic
1010593790 6:77740587-77740609 GCAATGTTTATGCCACCTGGTGG - Intronic
1012644852 6:101665987-101666009 GCATTATTTAGGCACCCTGAAGG + Intronic
1012743570 6:103053875-103053897 GGAATATTTATGCAAATTAATGG - Intergenic
1014479629 6:121920152-121920174 TGCATATCTATGCAACCTGTGGG + Intergenic
1014830768 6:126100230-126100252 GGATCATTTTTGCATCCTGAGGG + Intergenic
1014915178 6:127137741-127137763 GGAATGATTATGGAACTTGAAGG - Intronic
1017134679 6:151137701-151137723 GGAAGATTTATGAAACCTTTGGG + Intergenic
1018399811 6:163411594-163411616 GGAATATTTAAGGATCCAGACGG + Intergenic
1019654775 7:2185393-2185415 GGAAACTTTCTGCAGCCTGACGG + Intronic
1021384344 7:20009514-20009536 GGAATATTTTTGCACCATAAGGG + Intergenic
1021912150 7:25396981-25397003 GGAATATTTATGCACAAAGATGG - Intergenic
1022288629 7:28979268-28979290 GGAATAATATTGCAACCTGCAGG + Intergenic
1022862285 7:34379991-34380013 GGTATATTTCTGCTACCTAATGG - Intergenic
1023247303 7:38218840-38218862 CAAATATTTATGCAACAAGAAGG - Intronic
1027218322 7:76198355-76198377 GAAATATTCATGCAGCCAGAAGG + Intergenic
1027410689 7:77914528-77914550 GGAATATCTTTCCAAGCTGAGGG - Intronic
1029329574 7:99840853-99840875 GGAAAATTTCTGCAGGCTGAGGG - Intronic
1031741970 7:125444109-125444131 GGAAAATTGATGCAAACTCATGG - Intergenic
1032697240 7:134347915-134347937 GGAATAGTTATAAAACATGAAGG + Intergenic
1035815829 8:2539260-2539282 GGAACATTTATCCAGCCTGTTGG + Intergenic
1036747661 8:11421316-11421338 GGAAGATTTTTGCAACCAGATGG - Intronic
1036927291 8:12919437-12919459 GGAATATTGAGGCAATCTTAGGG - Intergenic
1039684872 8:39790067-39790089 GGAATTCTTATGCATGCTGATGG + Intronic
1046843471 8:118887289-118887311 GGATGATTTATTCAACATGAAGG + Intergenic
1051326964 9:15982529-15982551 GGATAATTCATGGAACCTGAGGG + Intronic
1051977361 9:22967326-22967348 GGTACATTTCTGCTACCTGATGG - Intergenic
1053104108 9:35395917-35395939 GGAATCTTGAGGCAAACTGAAGG - Intronic
1055036990 9:71828172-71828194 GAAATATTTATCCAATGTGAAGG - Intergenic
1056828624 9:89895111-89895133 AAAATGTTTAAGCAACCTGAAGG - Intergenic
1059370872 9:113833549-113833571 GGTATATTTATTTGACCTGATGG + Intergenic
1059578296 9:115515918-115515940 GGATTATTTGTACAACTTGAGGG + Intergenic
1186259642 X:7763219-7763241 GGAATATTTCTGTAGCCTGGTGG + Intergenic
1186546783 X:10458322-10458344 GGAATATTTTAACAACTTGAGGG - Intronic
1189664420 X:43338507-43338529 GGTATGTTTCTGCTACCTGATGG + Intergenic
1190386741 X:49889002-49889024 GGACTATCTCTGCAGCCTGAGGG + Intergenic
1192100855 X:68262892-68262914 GGTATATTTATGCAATGAGATGG - Intronic
1198202976 X:134440439-134440461 GGAATATATATGAAACCAGATGG - Intergenic
1198956617 X:142138332-142138354 CAAATATTAATGTAACCTGAGGG + Intergenic