ID: 1159534013

View in Genome Browser
Species Human (GRCh38)
Location 18:69692109-69692131
Sequence TCACCGTGGAAAGACGGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159534002_1159534013 20 Left 1159534002 18:69692066-69692088 CCCTGGAAAAGTCAAAAGCAAAA 0: 1
1: 0
2: 6
3: 66
4: 653
Right 1159534013 18:69692109-69692131 TCACCGTGGAAAGACGGTGATGG 0: 1
1: 0
2: 0
3: 3
4: 101
1159534003_1159534013 19 Left 1159534003 18:69692067-69692089 CCTGGAAAAGTCAAAAGCAAAAG 0: 1
1: 1
2: 4
3: 58
4: 595
Right 1159534013 18:69692109-69692131 TCACCGTGGAAAGACGGTGATGG 0: 1
1: 0
2: 0
3: 3
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159534013 Original CRISPR TCACCGTGGAAAGACGGTGA TGG Intronic
900991345 1:6099758-6099780 TCTCCCTGGAAAGACGGGCAGGG + Exonic
907873628 1:58465555-58465577 GCTTCGTGGAAAGATGGTGAAGG + Intronic
914255225 1:145957234-145957256 TCACAGAGGAAAGACTGAGAGGG + Intronic
914716233 1:150257230-150257252 TCACCGTGGGAAGGGGGTGGTGG + Exonic
916037179 1:160932680-160932702 AGACCGTGGAAAGCCGGAGAAGG - Intergenic
916486663 1:165265564-165265586 TCACAGTGGAAAGACGTGCAGGG - Intronic
917859729 1:179134743-179134765 AGACCGTGGAAAGAGGGAGAGGG - Intronic
920564460 1:206962331-206962353 TCTCTGTGGAAAGTCTGTGAGGG + Exonic
923059276 1:230455646-230455668 TCATGGTGGAAAGACCCTGAAGG + Intergenic
923136923 1:231127863-231127885 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
1063282785 10:4648843-4648865 TCCCACTGGAAAGACGGTCAAGG + Intergenic
1064118043 10:12595655-12595677 TCACCCTGGAAACATGGTCAAGG - Intronic
1065055175 10:21836899-21836921 AGACCGTGGAGAGACGGAGAGGG - Intronic
1069705918 10:70458956-70458978 GCACCGCGGTAAGGCGGTGATGG - Intergenic
1072772232 10:98151966-98151988 AGACCGTGGAAAGAGGGCGAGGG - Intronic
1077080965 11:724579-724601 TCACCGTGGAGAGAGGCTGCAGG - Intronic
1081733030 11:45384824-45384846 ACACCTCCGAAAGACGGTGATGG + Intergenic
1081824979 11:46041043-46041065 TCACCATGAAAAGTCAGTGAGGG - Intronic
1083168688 11:60908802-60908824 GCACCCAGGAAAGACGGAGATGG + Intergenic
1084586718 11:70066744-70066766 CCACCGTGGAGTTACGGTGATGG - Intergenic
1084839089 11:71830840-71830862 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
1086017042 11:82181191-82181213 AGACCGTGGAAAGACGGAGAGGG - Intergenic
1086792663 11:91062869-91062891 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
1089145996 11:116330060-116330082 TCACCAGGGAGAGACGGTGTGGG - Intergenic
1089467480 11:118694747-118694769 TCACTGTAGGAAGAGGGTGAAGG + Intergenic
1099942124 12:89200776-89200798 TCACTGTGTAAGGACAGTGAGGG + Intergenic
1100577781 12:95908433-95908455 AGACCGTGGAAAGAGGGAGAGGG + Intronic
1108813409 13:54259846-54259868 TCACAGTGGACAGAAGATGATGG + Intergenic
1202854612 14_GL000225v1_random:42834-42856 TCTCCGCGGAAAGCCGGGGACGG + Intergenic
1124241060 15:28027872-28027894 TCAGCTTGGAAAGACGGAGTCGG + Exonic
1127153928 15:56109059-56109081 AGACCGTGGAAAGAGGGAGAGGG - Intronic
1131967457 15:97859376-97859398 TAACCATAGAAAGACGATGAAGG - Intergenic
1132626683 16:894728-894750 ACACGGTGGGAAGAGGGTGAGGG + Intronic
1134398670 16:13889091-13889113 AGACCGTGGAAAGCCGGAGAAGG - Intergenic
1138566583 16:57837838-57837860 TCACCGTGTAAAGGCAGTGGAGG + Intronic
1140732146 16:77866005-77866027 TCACCTTTGAAGGAAGGTGAGGG - Intronic
1147126000 17:38369182-38369204 CCACCATGGTAAGACTGTGAGGG - Intronic
1151075678 17:71269607-71269629 TCAATGTGGAAAGAGGGGGAAGG - Intergenic
1153320689 18:3771382-3771404 CCCCCGTGGAAGGACGGTGGGGG + Intronic
1155171697 18:23271437-23271459 CCACGGTGGAAAGCCTGTGAGGG + Intronic
1155733432 18:29191196-29191218 GCAGGGTGGAAAGAGGGTGAAGG - Intergenic
1156554291 18:38049621-38049643 TCATGGTGAAAAGAGGGTGAAGG - Intergenic
1157824704 18:50802349-50802371 TCACCTTGGAAAGAAAGAGAGGG - Intronic
1159534013 18:69692109-69692131 TCACCGTGGAAAGACGGTGATGG + Intronic
1160545755 18:79652459-79652481 TCATTGTGGAAAGACGGTTTGGG - Intergenic
1162500388 19:11050217-11050239 GCAGCTCGGAAAGACGGTGACGG + Intronic
1165199215 19:34131902-34131924 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
1167826101 19:51974738-51974760 TTTCCGTGGAAGGACTGTGAAGG + Intronic
927629991 2:24764783-24764805 TCATCTTGGGAAGAAGGTGAAGG + Intronic
929577935 2:43063990-43064012 AGACCGTGGAAAGAGGGAGAGGG + Intergenic
938323531 2:130381686-130381708 TCACAGTGAAAAGACGGACAAGG + Intergenic
941760837 2:169241197-169241219 TCACAGTGGAAATATGATGAAGG + Exonic
941847598 2:170149051-170149073 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
942301038 2:174562653-174562675 TCATCGTGGAAACTCGGGGATGG + Intronic
943323278 2:186472262-186472284 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
948865082 2:240771102-240771124 TCACTGTGGAGAGAGGGTCAGGG + Exonic
1172575214 20:36002379-36002401 AAACCGTGGAAAGAGGGAGAGGG + Intronic
1172735656 20:37125233-37125255 AGACCGTGGAAAGAGGGAGAGGG - Intronic
1173273335 20:41556234-41556256 AGACCGTGGAAAGAGGGAGAGGG + Intronic
1174006752 20:47416931-47416953 TCACAGTGAAAAGTGGGTGAAGG - Intergenic
1175261911 20:57680031-57680053 TCACCTTGCAAAGATGGTCAAGG - Intronic
1175776080 20:61654407-61654429 AGACCGTGGAAAGAGGGAGAGGG + Intronic
1175961846 20:62641416-62641438 TCACCGTGGAGAGACGAAGGAGG - Exonic
1182982601 22:34685257-34685279 AGACCGTGGAAAGAGGGAGAGGG + Intergenic
950742231 3:15061229-15061251 AGACCGTGGAAAGAGGGAGAGGG - Intronic
953242518 3:41162204-41162226 TCACAGTGAATAGAAGGTGAGGG + Intergenic
955626676 3:60926980-60927002 GCACCGTGGAAAGCGGGAGACGG - Intronic
968430025 4:551394-551416 AGACCGTGGAAAGAGGGAGAGGG + Intergenic
972456162 4:39257723-39257745 AAACCGGGGAAAGAGGGTGAGGG - Intronic
976771489 4:88657973-88657995 TCACCGTGGACACAGTGTGATGG + Intronic
978881694 4:113711734-113711756 TCACCGTGGAGAGTTAGTGAAGG - Intronic
979702364 4:123684336-123684358 AGACCGTGGAAAGCCGGAGAGGG - Intergenic
981570674 4:146147530-146147552 ACACCGAGGCAAGACGGTGAAGG - Intergenic
983254626 4:165384076-165384098 GCCCCGTGGTAAGACGGTAAGGG - Intronic
987225795 5:15840139-15840161 TCTCCGAGGAAAGACTGGGATGG - Intronic
988918432 5:35919486-35919508 TCAGGGTGGAAAGATGGTGCCGG + Intronic
988990530 5:36666072-36666094 TCACCCAGGAAAGGCAGTGAGGG - Intronic
993346367 5:86788356-86788378 TCACTGAGGAAAGATGGAGATGG + Intergenic
993934512 5:93985402-93985424 AGACCGTGGAAAGAGGGAGAGGG - Intronic
998067271 5:139169855-139169877 AGACCGTGGAAAGAGGGAGAGGG - Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1005867286 6:29945617-29945639 TCAGCGTGGGAAGAGGGTCATGG - Exonic
1013637936 6:112047091-112047113 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
1014558249 6:122859325-122859347 TGACCCTGGAAAGATGCTGATGG + Intergenic
1017063326 6:150506981-150507003 AGACCGTGCAAAGACGGAGAGGG - Intergenic
1022005231 7:26261278-26261300 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
1022258485 7:28682309-28682331 TCACAGTGGACAGAGGATGAGGG - Intronic
1026009804 7:66628284-66628306 TCCCGGTGGAAAAACGGTCACGG + Intergenic
1030288141 7:107847566-107847588 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
1032157073 7:129477157-129477179 AGACCGTGGAAAGAGGGAGAGGG + Intronic
1037361215 8:18076022-18076044 TTACCATGGAAAGATGATGAAGG - Intronic
1037756430 8:21712989-21713011 AGACCGTGGAAAGAGGGAGAGGG + Intronic
1041921017 8:63180956-63180978 AGACCGTGGAAAGAGGGAGAGGG + Intronic
1042047797 8:64673386-64673408 TCACAGTGGAAAGTCGTTAATGG - Intronic
1045120616 8:99029771-99029793 AGACCGTGGAAAGAGGGAGAGGG + Intronic
1047323836 8:123817395-123817417 TCACTGTGGAAACTGGGTGATGG - Intergenic
1048031876 8:130640798-130640820 TCAACATGGAAAGACAGAGAAGG - Intergenic
1049239653 8:141530702-141530724 TCTCCCTGGAATGAGGGTGATGG - Intergenic
1059660761 9:116397656-116397678 TCACCCTGGAAAGGAGTTGAGGG + Exonic
1060243802 9:121926961-121926983 GCACGGTGGAAAGAGGGTGAAGG + Intronic
1061992273 9:134165977-134165999 TCACCCTGCAATGACGGTCAAGG + Intergenic
1190466759 X:50732184-50732206 TCACCCTGGAATGACTGTGGTGG - Intronic
1191009703 X:55747856-55747878 AGACCGTGGAAAGAGGGAGAGGG - Intronic
1192768354 X:74165724-74165746 AGACCGTGGAAAGAGGGAGAGGG - Intergenic
1193295876 X:79830463-79830485 TCACTGTGGAAAACCGGTGGAGG + Intergenic