ID: 1159540201

View in Genome Browser
Species Human (GRCh38)
Location 18:69765005-69765027
Sequence CAGAAGGACAGGATGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 0, 2: 1, 3: 63, 4: 470}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159540193_1159540201 27 Left 1159540193 18:69764955-69764977 CCAGAAGGCATTTGACGCTCACG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1159540201 18:69765005-69765027 CAGAAGGACAGGATGGAAATAGG 0: 1
1: 0
2: 1
3: 63
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159540201 Original CRISPR CAGAAGGACAGGATGGAAAT AGG Intronic
900077378 1:828079-828101 GAGCAGGACAGGTTGAAAATAGG - Intergenic
900811750 1:4807724-4807746 CAGAAAGGGAGGATGGAAAGGGG + Intergenic
901495188 1:9617021-9617043 CAGAAGATCAGGAAGGAATTTGG + Intergenic
901669074 1:10843818-10843840 CAGAAGAAGAGGATGGAGATGGG - Intergenic
902830699 1:19010495-19010517 TGGAAGGAGAGGAGGGAAATGGG + Intergenic
903067254 1:20707099-20707121 AAAAAGGACAGGAAGGAACTTGG + Intronic
903361232 1:22778684-22778706 CAGAAGGACTGGAAGTAAATGGG - Intronic
905234764 1:36538331-36538353 AGGAAGGACAGGATGGGGATGGG + Intergenic
905321628 1:37121370-37121392 CAGAAGGAGAGGTTGGGAAGGGG - Intergenic
905776012 1:40667582-40667604 CAGAAGGACTGGATGGGAGGTGG + Intergenic
905808736 1:40896561-40896583 CTGAAAGACAGAAAGGAAATTGG - Intergenic
906193117 1:43911447-43911469 TAGAAGGACAGGTTTGAATTTGG - Intronic
906505957 1:46379811-46379833 CAGAAGAACAGAAGGGAAAAGGG + Intergenic
906689210 1:47781636-47781658 GAGAAGGAGAGAATGGGAATTGG - Intronic
906801703 1:48743493-48743515 CAGAGAAACAGGATGAAAATGGG + Intronic
907351753 1:53837950-53837972 CGGATGGACTGAATGGAAATTGG - Intronic
908119963 1:60976769-60976791 AAGAAGGAAAGGGAGGAAATAGG - Intronic
908806480 1:67937920-67937942 CAGAAGGACAGGAAGGAGCCAGG - Intergenic
908907999 1:69038364-69038386 CAGAAGGAGAGAATGGCAAGTGG + Intergenic
909217933 1:72915553-72915575 TAGAAGTAGAGGAGGGAAATAGG - Intergenic
910565515 1:88638581-88638603 CAGAAGCAAAGGGTGGAAATGGG - Intergenic
911002948 1:93185626-93185648 CATAAGGAGAGGAGGGAAGTGGG + Intronic
911596553 1:99804660-99804682 TTGAAGGACAGGAAGGAATTGGG - Intergenic
912282805 1:108334512-108334534 AAGAAAGGCAGGATGGAGATAGG + Intergenic
913088920 1:115463106-115463128 CAGAAGGAAAAGATGGAAAGAGG + Intergenic
913176460 1:116277076-116277098 CAGAAGGAGAGGGTGGGAACGGG + Intergenic
914767514 1:150651865-150651887 CAGAAGGAAAGGAGAGAAAGAGG + Intronic
915435056 1:155898306-155898328 CAGAAGGATAGAAAGGAATTTGG - Intronic
915978251 1:160404594-160404616 CATAGAGACAGGATGCAAATTGG - Intronic
916206346 1:162319492-162319514 CAGAAGGACTGGTGGGAGATGGG - Intronic
916429011 1:164709902-164709924 CAGAAGGAAAGCATGGAGATGGG + Intronic
917027397 1:170659292-170659314 CAGAAGGAATGGTTGGAAAGTGG + Intergenic
917875133 1:179279644-179279666 CAGAAGGAGAGGATAGAGAAAGG - Intergenic
918121517 1:181545184-181545206 CAGAAGGAGGGGATGAAAACAGG + Intronic
918171178 1:181998863-181998885 CAGCAGGACAGGACAGGAATAGG + Intergenic
918316275 1:183325119-183325141 CAGCAGATCAGGATGGATATTGG - Intronic
918493243 1:185105666-185105688 CAGAAGGAGAGGAGGGAAAGGGG + Intergenic
920761596 1:208788332-208788354 CAGAAGGAAGGGATGCAAATAGG - Intergenic
921949640 1:220915845-220915867 CAGAAGGAGAGGGTGGGGATAGG - Intergenic
922095085 1:222436463-222436485 CAGAGGTAAAGGATGGAAAAGGG + Intergenic
922341287 1:224657148-224657170 CTGAAGGACAGGATGGACCCAGG - Intronic
922689567 1:227677548-227677570 CAGAAGGTCAAAATGGAAACTGG + Intergenic
922729573 1:227942652-227942674 CAGAAGGGCAGGGAGGAAAGGGG - Intronic
922936507 1:229426898-229426920 TAGAAGGACTGCAGGGAAATGGG - Intergenic
923335231 1:232963545-232963567 CAGAAGGAAATGCTGGAAATGGG - Intronic
924300856 1:242636464-242636486 CAGAAGGTGAGCATGGAAGTAGG - Intergenic
924805466 1:247358138-247358160 CAGAAGGTCAAAATGGAAACTGG + Intergenic
1064188596 10:13185660-13185682 ATGAAGGAAAGGATGGAAAATGG + Intronic
1064981017 10:21166717-21166739 CAGTAGGCCAGGATGGAGCTAGG + Intronic
1065445306 10:25792268-25792290 AATAAGGACAGGAAGGCAATTGG - Intergenic
1066071719 10:31822358-31822380 CAGAAGGACTTGATGGAAAAGGG + Intronic
1066073611 10:31848105-31848127 CACAAGGAGAGTATTGAAATGGG - Intronic
1066450721 10:35527114-35527136 CACAATTACAGTATGGAAATAGG - Intronic
1067395468 10:45912765-45912787 CAAATGCACAGGATGGAAAATGG - Intergenic
1067404649 10:46010598-46010620 AAGAAGGAAAGGATAAAAATGGG - Exonic
1067665144 10:48271195-48271217 CAGAAGGACAGGAGGCAAGGGGG - Intronic
1067671880 10:48331341-48331363 CAGAAGGTCAAAATGGAAACTGG - Intronic
1067720719 10:48725752-48725774 GAGAAGGACAGGATTGAATGGGG - Intronic
1067838498 10:49656746-49656768 AAGAAGGACTGGTTGGAATTGGG + Intronic
1067911067 10:50347508-50347530 CAGAAGGTCAGGAAGAAAAGGGG + Intronic
1068106726 10:52627189-52627211 CAGAGGTACAAGATGGAACTGGG + Intergenic
1068862376 10:61860452-61860474 CAGCAGAACAGCATGGAAAGAGG - Intergenic
1068914095 10:62409603-62409625 CTGAAGCACAAGAAGGAAATGGG - Intronic
1069142971 10:64851397-64851419 CAGAAAGATAGAAAGGAAATAGG - Intergenic
1069667642 10:70174163-70174185 CAGAAGGAGTGGTAGGAAATGGG + Intergenic
1069862571 10:71480797-71480819 AAGAAGGACATGATGGAGATGGG + Intronic
1070513954 10:77186426-77186448 TAGAAAGACAGCATGGAATTTGG + Intronic
1070536879 10:77385719-77385741 AAGAAGGACAGGTTGGAAAGAGG + Intronic
1072530764 10:96316609-96316631 CAGAAGGACAGGGAGGAGAATGG - Intronic
1074200960 10:111234792-111234814 CAAATGCACAGGATGGAAAGTGG + Intergenic
1074728018 10:116334945-116334967 GACTAGGACAGGATAGAAATAGG - Intronic
1075007132 10:118839279-118839301 GACAAGGACAGAGTGGAAATGGG + Intergenic
1075744241 10:124715505-124715527 GAGAAGGACAGGGTGGCAGTGGG - Intronic
1076008989 10:126971812-126971834 AAAAAGGAAAGGATGAAAATTGG - Intronic
1076476074 10:130752315-130752337 CAAAAGGACATTATGGAAATGGG + Intergenic
1079220886 11:18560014-18560036 TGGAAGGACAGGATGGGCATAGG + Intronic
1080285376 11:30605578-30605600 GAGAATGACAGGATCGAAGTAGG - Intergenic
1080836642 11:35945688-35945710 GAGAAGGACAGTATGGAAGCTGG + Intronic
1082204994 11:49422414-49422436 CTGAAGGATAGAATGGAATTTGG + Intergenic
1082626877 11:55497072-55497094 CAGAAAGAGAGGCTGGAAAGGGG - Intergenic
1083311414 11:61785818-61785840 CGGAAGGACAGGATGGTTATTGG - Exonic
1085146449 11:74202625-74202647 AAGAAGAATAGGTTGGAAATTGG + Intronic
1086052505 11:82610121-82610143 CAGAAGGAAAGGAGGGAAAGAGG + Intergenic
1086390842 11:86361160-86361182 CCCAAGGACAGGATAGAGATTGG + Intergenic
1086650099 11:89278128-89278150 CTGAAGGACAGAATGGAATTTGG - Intronic
1086961526 11:92983546-92983568 TAGAAGGACAGGAAGGGAAGGGG + Intronic
1087641598 11:100760762-100760784 AAGAAGGACAGGATGGAGAAAGG + Intronic
1088270026 11:108024900-108024922 CAGAAAGACAGGGTGGTAACAGG - Intronic
1088449875 11:109969942-109969964 CATCATGACTGGATGGAAATGGG - Intergenic
1088601680 11:111484705-111484727 AAGAAAGACAGGAAGGAAAGAGG + Intronic
1089611074 11:119669536-119669558 CAGAGGGAAAGGATGGAATCAGG - Intronic
1089740619 11:120579432-120579454 CAGATGGCCAGGGTGGACATAGG + Intronic
1091709133 12:2725171-2725193 CAAAAGGAGAGGATTGCAATGGG + Intergenic
1092041909 12:5392825-5392847 GAGAAGAACAGGACAGAAATTGG - Intergenic
1092333039 12:7603075-7603097 CAGAAGGTCAAAATGGAAATTGG + Intergenic
1092387698 12:8048686-8048708 CAGAAGGAAAGGCTGTAAAGAGG - Exonic
1092702908 12:11252909-11252931 CAGAAAGTCAGGAGGGAGATTGG - Intergenic
1093012605 12:14124959-14124981 CAGAATGACATGATTCAAATGGG - Intergenic
1093088029 12:14888337-14888359 CAGAAGAAAAGAATGGAAGTAGG + Intronic
1093476300 12:19558471-19558493 CAGGAGGAAAGGGTGGAAAGCGG - Intronic
1094101072 12:26763655-26763677 CAGAAGGAAACAATGGAAGTGGG - Intronic
1094282306 12:28753795-28753817 AAGAAGGGCAGAATGGATATTGG - Intergenic
1096263704 12:50107989-50108011 CAGGATGAGTGGATGGAAATGGG - Intronic
1096545874 12:52340007-52340029 ACCAAGAACAGGATGGAAATGGG - Intergenic
1097406757 12:59198628-59198650 CAGAAGGTGAGGAAGGAAAGTGG - Intergenic
1097776424 12:63651972-63651994 CAGAAAGGCTGGATGGAAAGTGG - Intronic
1098080848 12:66784061-66784083 CAGAGGGACAGCAGGGAAAATGG + Intronic
1099100295 12:78431556-78431578 CAGAATGAACTGATGGAAATGGG - Intergenic
1099317240 12:81099802-81099824 GAAAAGGGAAGGATGGAAATTGG + Intronic
1099585899 12:84513324-84513346 CAGGAGTACAGTATGGAAAGGGG - Intergenic
1100095572 12:91030696-91030718 CAGAAGGAGAGAATAGATATTGG + Intergenic
1100350176 12:93773731-93773753 CAGAAGGCCAGGCTGGAGGTAGG + Intronic
1100587870 12:95996148-95996170 CAGCAGGTCTGGATGGAAAGTGG - Exonic
1100722033 12:97369341-97369363 CAGGGGGAAAGGATGGAAAAGGG + Intergenic
1100811979 12:98347527-98347549 CAGAAGGAAAGGATCCAAACAGG + Intergenic
1101155628 12:101924950-101924972 CAGAAGAAAAGGGTGGAAATGGG + Intronic
1101157918 12:101944963-101944985 CAAAGGGACAGGATAGAAAAGGG - Intronic
1102743470 12:115229125-115229147 CAGAATCCCAGAATGGAAATGGG + Intergenic
1102820753 12:115907346-115907368 CAGAAGGAAAGGGTGGGAAGGGG + Intergenic
1105299017 13:19116883-19116905 CAGAAGGAGAGGCTGGACTTTGG - Intergenic
1105632720 13:22187057-22187079 GGAAAGGACAGGCTGGAAATGGG - Intergenic
1105956732 13:25290269-25290291 AGAAAGGACAGGAGGGAAATAGG - Intergenic
1106634363 13:31511324-31511346 CATAAGGGAAGGCTGGAAATAGG + Intergenic
1106925646 13:34610250-34610272 TAGAGGGAAAGGATGGAAGTGGG + Intergenic
1107295238 13:38900835-38900857 CAGCAGGATGGAATGGAAATGGG - Intergenic
1107554124 13:41502571-41502593 CAGAAAGAAAGAATGAAAATAGG - Intergenic
1107784558 13:43941988-43942010 CTGATGGAAAGGATAGAAATAGG - Intergenic
1108591796 13:51919025-51919047 GAGAAGGAAAAGATGGGAATAGG - Intergenic
1108792404 13:53987264-53987286 CAGTAGGACAGGATGATAATGGG - Intergenic
1109798094 13:67342547-67342569 CAAAAGGTCAGAATGGAAATTGG - Intergenic
1110797430 13:79656547-79656569 CAGAAGTAGAGGAAGGATATTGG - Intergenic
1111265707 13:85809356-85809378 AACAAGGGCAGGATTGAAATAGG + Intergenic
1111586722 13:90291605-90291627 CAGAAGGTAAGAATGGAAACTGG + Intergenic
1112182867 13:97102613-97102635 CAGAAGGAAAGGAAGGACAGGGG + Intergenic
1112215797 13:97430695-97430717 CAGAAAGAAAGGATGGACTTGGG + Intergenic
1112408119 13:99138631-99138653 CAGAAGAACAGGATGGACTTGGG - Intergenic
1114934808 14:27520859-27520881 CAAAAGGAGAGGAAGGAAAGAGG + Intergenic
1115431283 14:33321541-33321563 CAGAAAGACAGCATGGGATTTGG + Intronic
1116987209 14:51233361-51233383 CAGAAGGAAAGGAGGGAGAAAGG + Intergenic
1117079123 14:52133265-52133287 CATAGGGACAGGATGGACATGGG - Intergenic
1117525582 14:56599235-56599257 CAGAGGGACAGGAGGGCAAAAGG - Intronic
1117769475 14:59118568-59118590 AAGCAGGACAGTATTGAAATGGG - Intergenic
1117795031 14:59384097-59384119 CAGGAAGACAGGAAGGAAAAAGG - Intergenic
1118448978 14:65880093-65880115 AAGAAGGAAAGGATAAAAATGGG - Intergenic
1118488334 14:66234831-66234853 TCAAAGGACAGGCTGGAAATGGG + Intergenic
1119381359 14:74231081-74231103 AGGAAGGAGAGGGTGGAAATTGG + Intergenic
1119521087 14:75285681-75285703 CAGGAGGCAAGGATGGGAATGGG - Intergenic
1119860516 14:77932739-77932761 CAAAAGGACATGATGAAAACTGG - Intronic
1119998702 14:79279562-79279584 AAGAAGGACTGGAGGGAAAGAGG - Intronic
1122972838 14:105159292-105159314 TAGGAGCACAGGATGGAAGTGGG + Intronic
1123191999 14:106580356-106580378 AAGGAGGACAGCATGGAAAGTGG - Intergenic
1123538281 15:21261415-21261437 CAGAAGGAGAGGCTGGACTTTGG - Intergenic
1123871997 15:24585115-24585137 AAAAAGAAGAGGATGGAAATGGG + Intergenic
1125602777 15:40924628-40924650 CAGAAGGAAATGAAGGAAAAAGG - Intergenic
1125615739 15:41010741-41010763 CAGAATGAAAGGTTGGTAATAGG - Intronic
1126775102 15:52093832-52093854 CTGAGGCACAGGATGGAAACTGG + Intergenic
1127013374 15:54655236-54655258 CAGAAGAACAGGAGGGTAAGAGG + Intergenic
1127522082 15:59753191-59753213 CAGAAGGCGAGGAAGGAAAACGG - Intergenic
1127966960 15:63929715-63929737 CTGAAGAGCAGGATGGAGATGGG - Intronic
1129367802 15:75067596-75067618 CAGAAGGTCAAAATGGAAACTGG + Intronic
1129390839 15:75220241-75220263 CAGAAGGTCAGGCTGGACAAGGG - Intergenic
1129653951 15:77510537-77510559 CAGGAGGTCAGGCTGGAAACTGG - Intergenic
1129886356 15:79040515-79040537 CAGAAGGCCAGAATGGTAAGAGG - Intronic
1130249176 15:82285707-82285729 CAGAGAGATAGGGTGGAAATGGG - Intergenic
1131439996 15:92452508-92452530 CAGGAGGAAAGGATGGACAATGG + Intronic
1132437154 15:101817234-101817256 AATAAGTACAGGATTGAAATAGG + Intronic
1133417100 16:5615503-5615525 CATGAGGACAGGAGGGACATTGG + Intergenic
1133912443 16:10078425-10078447 CACAAGGACATGCTGGAAAGAGG - Intronic
1134566108 16:15253216-15253238 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134645872 16:15865383-15865405 CACAAAAACAGGATGGGAATGGG - Intergenic
1134736386 16:16503482-16503504 CAGTGGGACAGGATGGAAGCTGG - Intergenic
1134931129 16:18208686-18208708 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1135504885 16:23027694-23027716 CAGAAGTCCAGGAGGGAGATGGG - Intergenic
1135922022 16:26659455-26659477 GAGAAGGATAGAATGGAAAATGG - Intergenic
1135935605 16:26777282-26777304 GAGGAGGAGAGCATGGAAATGGG - Intergenic
1135956366 16:26959725-26959747 GAGAAGGAGAGGAGGGAGATAGG - Intergenic
1136014700 16:27388623-27388645 AAGAAGGACAAGATGGAAGCTGG + Intergenic
1136949147 16:34693979-34694001 CAGAAAGACAGGAAGGATGTGGG - Intergenic
1137674967 16:50299623-50299645 GAGAAGGACAGGCTGGAACACGG - Intronic
1137948065 16:52753618-52753640 CAGGAGGAAAGGAAGCAAATAGG + Intergenic
1138699682 16:58849162-58849184 CAGTAGGACACCATGGACATTGG + Intergenic
1139246172 16:65446605-65446627 CAGCTGGAAAGGATGAAAATAGG + Intergenic
1141055256 16:80807794-80807816 CAGAATTACATGATGGGAATCGG + Intergenic
1141892109 16:86933199-86933221 AAGAAGGGAAGGAGGGAAATGGG + Intergenic
1141909791 16:87050822-87050844 GAGAAGGTCAGCATGGAAAGGGG + Intergenic
1141976941 16:87523030-87523052 AAGAATGAGAGGATGGATATTGG + Intergenic
1142113967 16:88346888-88346910 CAGAACCACAGAATGAAAATCGG + Intergenic
1142187300 16:88700725-88700747 CACCAGGACAGGATGGACATGGG + Intronic
1142366051 16:89650342-89650364 CAGAAGGAGAGGAGGGATCTAGG - Intronic
1142568161 17:854018-854040 CACAACTACAGAATGGAAATTGG - Intronic
1143040455 17:4031916-4031938 CAAAAAGACAGCATGGAAAGGGG + Intronic
1143272037 17:5683049-5683071 CAGAGGGACAGGAGGGAGAGGGG - Intergenic
1143862801 17:9903332-9903354 CAGGAGGACAGTATGGACAGGGG + Intronic
1145091248 17:19987933-19987955 CAGATGGTCAGGATTGAACTTGG - Intergenic
1145268294 17:21391085-21391107 CTGGAGGACATGATGGAGATGGG - Intronic
1145293361 17:21567958-21567980 CTGAAGGACAGGATGGACACAGG - Intronic
1145298707 17:21614254-21614276 CAGAAGGAGAGGTTGGACTTTGG + Intergenic
1145351572 17:22089036-22089058 CAGAAGGAGAGGTTGGACTTTGG - Intergenic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1145386614 17:22417981-22418003 CTGAAGGGCAGGATGGACACAGG + Intergenic
1145723192 17:27090990-27091012 CAGAAGGAGAGGCTGGACTTTGG + Intergenic
1145834218 17:27941734-27941756 CAGTAGCAAAGGATGGAAGTTGG + Intergenic
1146450677 17:32971644-32971666 CAGAAGGTCAAAATGGAAACTGG + Intronic
1146536079 17:33653331-33653353 CTGAAGGACAGAAAGGAGATAGG - Intronic
1146975704 17:37109767-37109789 CAGAAGGACTGGATGGTGAGGGG - Intronic
1148087053 17:45000624-45000646 GGCAGGGACAGGATGGAAATAGG + Intergenic
1148907273 17:50919457-50919479 CAGAAGGAGAGGCTGGGATTCGG - Intergenic
1149121916 17:53179541-53179563 CAGGAGGAAAGGATGGGAAGGGG - Intergenic
1149269501 17:54961189-54961211 GAGAAGGACAGGATGAATACTGG + Exonic
1149999420 17:61424349-61424371 CAGTAGGTCAGGATGGAACTTGG - Intergenic
1150504034 17:65680491-65680513 AAGAAGGACGGGATGGAAAGAGG - Intronic
1152408267 17:80109553-80109575 CAGAAGGCAGGGATGGAAACAGG - Intergenic
1152909326 17:82990112-82990134 CAGAAGCACAGCATGGAAGACGG - Intronic
1153297695 18:3563366-3563388 AAGAAGGAGAGGATGGAGAAAGG - Intronic
1154094868 18:11403654-11403676 CAGAAGAACAGAAAGGTAATGGG + Intergenic
1155001798 18:21694953-21694975 AAGAAGGGAAGGATGGATATTGG - Intronic
1155156092 18:23158889-23158911 CAGAAGGAAAGGAAGGGAAATGG - Intronic
1155918903 18:31583455-31583477 CAGAACAACAGGATGGAAACTGG - Intergenic
1156341607 18:36214721-36214743 CAGAAGGAGAGGGAGGAGATAGG + Intronic
1157390137 18:47294959-47294981 CACAAGGTCAGGTTGAAAATGGG + Intergenic
1158758939 18:60360982-60361004 GAGAAGGAAAGGAAGAAAATTGG - Intergenic
1159034885 18:63267271-63267293 CAGGAGGACAGGTTGGAGAGAGG + Intronic
1159540201 18:69765005-69765027 CAGAAGGACAGGATGGAAATAGG + Intronic
1159759079 18:72402289-72402311 AAGAATGAAAGGAAGGAAATGGG - Intergenic
1160060785 18:75527101-75527123 CAGAAAGACAGGAGGGAGAGAGG - Intergenic
1160107704 18:75993991-75994013 CAGAAAGAGAGGAGGGAAAAGGG - Intergenic
1161777804 19:6273259-6273281 CAGAAGGAGTGGCTGGAAAAAGG + Intronic
1166908933 19:46137121-46137143 CAGATGTACAGGAATGAAATGGG + Intergenic
1167676129 19:50887227-50887249 CAGAGGCTCAGGATGGCAATGGG + Intergenic
1168126950 19:54289578-54289600 CAGGAGCACAGGATGGGAACAGG - Intergenic
1168173501 19:54606882-54606904 CAGGAGCACAGGATGGGAACAGG + Intronic
1168332858 19:55579939-55579961 CAGAAAGACAGGATGGTGAAAGG + Intronic
925146810 2:1587697-1587719 CAGAGGGACAGGATGGGGACAGG - Intergenic
925146871 2:1587906-1587928 CAGAGGGACAGGATGGGGACAGG - Intergenic
925173532 2:1767166-1767188 CAGAAGGGCAGGATGGAGTGTGG - Intergenic
925606946 2:5669323-5669345 AAGAAGGAAAGGAGGGAAAAGGG + Intergenic
926138587 2:10355020-10355042 CAGAAGGACAGGAAGCAAAGTGG + Intronic
926881009 2:17543318-17543340 CAGCAGGGAAAGATGGAAATGGG - Intronic
927993192 2:27462668-27462690 AAGAGGGACAGGATGGAAGAGGG - Intronic
928033528 2:27800985-27801007 CTGCAGGACAGGATGGGAACAGG + Intronic
928591427 2:32819702-32819724 TACAAGGACAGGGTGCAAATGGG - Intronic
928738237 2:34318522-34318544 TGGAAGAACAGGATGGAAAAGGG - Intergenic
929796066 2:45059134-45059156 CTGAAGGAGAGTATGGAAACTGG - Intergenic
929803813 2:45127388-45127410 CAGAAGGACTAGATGTATATCGG - Intergenic
930025871 2:47028853-47028875 CAGGAGGAGATGATGAAAATGGG - Intronic
931401720 2:61937437-61937459 CTGAAGGACAGGATGGACCAGGG - Intronic
932104191 2:68927919-68927941 CAGAAGGTCAGGCTGGAGTTTGG + Intergenic
932433022 2:71686677-71686699 GAGAAGGAAATGATGGAAGTGGG - Intronic
932599035 2:73111757-73111779 CAGAGGGACAGGATGGGGGTGGG + Intronic
935649002 2:105366237-105366259 GAGAAAGACTGAATGGAAATTGG + Intronic
936499886 2:113058791-113058813 AAGAAGGAAAGGAAGGAAAGAGG + Intronic
936906312 2:117538651-117538673 GAGAAGGTGAGAATGGAAATGGG + Intergenic
938312551 2:130302399-130302421 CAGAAGGAGAGGCTGGACTTTGG + Intergenic
938676929 2:133645977-133645999 AAGAAGGACAGAATGGATGTAGG + Intergenic
940346063 2:152630353-152630375 GAGAAAGACTGAATGGAAATAGG + Intronic
940560960 2:155296213-155296235 TGGAAGGACAGGAAGGAAGTGGG + Intergenic
940936934 2:159506296-159506318 CAGGATGACAGGAGGGAAACTGG + Intronic
941000094 2:160193665-160193687 CAGAAGGAAAGGAGGAAAATAGG - Intronic
941200536 2:162503125-162503147 GAGAAGCACAGCATGGCAATGGG - Intronic
941336162 2:164246188-164246210 GAGAAGGAGAGGATGGAAATGGG + Intergenic
941526843 2:166616706-166616728 GAGAATGCCAGGAAGGAAATTGG - Intergenic
942150307 2:173069846-173069868 TAGAAGGAAAGCATGGAAATTGG + Intergenic
943004472 2:182372873-182372895 CAGAGGGACAGGCTGGAACAAGG + Intronic
943317428 2:186407594-186407616 GAGTCGGACAGGATGGTAATGGG - Intergenic
943633888 2:190283880-190283902 GAGAAGCACAGGACAGAAATAGG + Intronic
943953281 2:194157162-194157184 CAGAAGGTCAAAATGGAAACTGG - Intergenic
944138977 2:196434322-196434344 CAGAAAGTCAGGATGGCAAGGGG - Intronic
944384880 2:199153084-199153106 CACAAGGACAGCATGGAACGAGG - Intergenic
946283955 2:218688535-218688557 GAGAAGGAAAGCAGGGAAATAGG - Intronic
947870662 2:233436095-233436117 CACAGGGACAGGATGGAGCTCGG - Intronic
947935054 2:233997471-233997493 CAGAGGGACAGGATGGGAAGGGG + Intronic
948157252 2:235793244-235793266 CAGAAGGCCTGGCTGGGAATGGG + Intronic
948286045 2:236786195-236786217 TAGAAGGACAGGGTGGAGAAGGG - Intergenic
948615728 2:239197521-239197543 CAGAAGGAGAGAATGGGAAAGGG - Intronic
948726898 2:239939699-239939721 GAGAAGGAAAGGATGCAAACAGG + Intronic
1168812876 20:717692-717714 CGGAAGGACAGAATGGAATAGGG - Intergenic
1169181464 20:3572404-3572426 CAGGATGAAAGGATGGAATTTGG + Intronic
1170172711 20:13433311-13433333 CATAAGCAGAGGATGGACATGGG - Intronic
1171211963 20:23324161-23324183 CAGAAGGAGAGGCTGGAGTTAGG - Intergenic
1172446238 20:34994930-34994952 CAGCTGGACAGTAAGGAAATGGG + Intronic
1172590781 20:36116457-36116479 CAGGAGGAAAGGAAGGAAATGGG - Intronic
1172964449 20:38824467-38824489 CAGAAGGAGAAGAAGGAACTGGG - Intronic
1173234091 20:41228000-41228022 CAGAAGGAGAGGAAGGAATGGGG - Intronic
1174609498 20:51787510-51787532 CAGAAGGCCATGGTGGGAATAGG + Intronic
1175329712 20:58155195-58155217 CAGCAGGAGGGGATGGAGATGGG + Intronic
1175663851 20:60841509-60841531 AAGAAGGACAAAATGGATATTGG - Intergenic
1175709320 20:61206453-61206475 CAGAAGAACAGGAAGGAAGGAGG + Intergenic
1176213414 20:63936922-63936944 TGGAAGCAGAGGATGGAAATGGG - Intergenic
1176649435 21:9531313-9531335 CAGAAGGAGAGGTTGGACTTTGG + Intergenic
1177797345 21:25792810-25792832 CACCAGGACATGATGGAAAATGG + Intergenic
1178122064 21:29478938-29478960 CAGATGGACACAATGGAAAGAGG + Intronic
1178924408 21:36762797-36762819 CTGGAGGCCAGGATGGAAGTGGG - Intronic
1179040920 21:37801627-37801649 CAGAAGGAGAGGATGAGAAGTGG - Intronic
1179371787 21:40812574-40812596 CAGAGGGAGAAGATGGAACTTGG + Intronic
1180645705 22:17337146-17337168 AAGAAGGAGAGGATGGATGTTGG - Intergenic
1181021145 22:20103698-20103720 CAGAAGGGCAGGACAGATATAGG + Intronic
1181157639 22:20934024-20934046 CACACGGAAAGCATGGAAATAGG + Exonic
1181481908 22:23205241-23205263 CATAAGGACAGGAAGGATACCGG + Intronic
1182819341 22:33201628-33201650 CAGAGGGACAGGAGGGAATTTGG + Intronic
1182824600 22:33253884-33253906 AAGAAGGAAAGAATGAAAATTGG - Intronic
1182919699 22:34067916-34067938 CAGAATGAAAGGATAGAAAGCGG - Intergenic
1183010212 22:34940121-34940143 AAGAAGGAGAGAATGGATATTGG + Intergenic
1183421718 22:37715662-37715684 CAGAAGGAAGGGAAGGGAATTGG - Intronic
1183664963 22:39241959-39241981 CAGGACGCCAGGAAGGAAATGGG + Intronic
1184117492 22:42430833-42430855 CAAAGGGAAAGGATGGGAATTGG + Intronic
1184248423 22:43247173-43247195 AAGAAGGAAAGGATGGAAAGTGG + Intronic
1184490742 22:44807347-44807369 CAGCAGGGCAGGATGGAACGTGG + Intronic
1184562009 22:45268875-45268897 AAGAAGGCCAGGATGGAGTTGGG + Intergenic
950340457 3:12239660-12239682 ATACAGGACAGGATGGAAATGGG - Intergenic
951595718 3:24316355-24316377 AGGAAGGAAAGGATGGAAAGAGG - Intronic
952314763 3:32223111-32223133 GAGAAGGACAGGCTTGAATTGGG + Intergenic
952831887 3:37571865-37571887 CAGAAGGGCAGGATGAATAAAGG - Intronic
952986443 3:38789405-38789427 CAGAAGGACATTTTGGAAAAGGG - Intronic
953704994 3:45224876-45224898 AAGACGGAGAGGAGGGAAATGGG - Exonic
954857119 3:53653742-53653764 CAGAAGGAGAGGAGAGAAAGAGG + Intronic
955207371 3:56908427-56908449 CTGAAGGACAGAGTGGAAAGGGG + Intronic
956033887 3:65069399-65069421 AAAAAGATCAGGATGGAAATTGG - Intergenic
957207869 3:77221219-77221241 CATAAGGACAGCAAGGAATTGGG - Intronic
957350363 3:79016996-79017018 CAGAAGGAGAAGCTGGAAGTGGG + Intronic
957611422 3:82472164-82472186 GAGAAGGACAGGAGGGAGACAGG + Intergenic
958259611 3:91365159-91365181 GAGGAGGACAGGATGGTAGTGGG - Intergenic
960360410 3:116704233-116704255 CAGAAGGACAGGAGAGAAACAGG + Intronic
963542876 3:146616945-146616967 CAGAAGTAGAGGAAGAAAATAGG - Intergenic
964849906 3:161084454-161084476 CTGAATTACAGGATGGAAAAAGG - Exonic
965559550 3:170048260-170048282 CAGAAGGGCAGGATGGGAAGGGG + Intronic
966238175 3:177726043-177726065 ATGAAGGAGAGGAGGGAAATGGG - Intergenic
966863774 3:184244995-184245017 GAGGAAGACAGGATGGAAAGAGG + Intronic
968971608 4:3798509-3798531 CCTTAGGACAGGATGGAAATTGG + Intergenic
969348408 4:6583438-6583460 AAGAAGGACAGAATGTATATCGG + Intronic
970202737 4:13626600-13626622 CAGAAAGAGAGGCTGGAAAGGGG - Intronic
970210269 4:13702593-13702615 CTGAGGCACAGGATGGAAAAGGG + Intergenic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971878730 4:32340292-32340314 CTGAGGGACAGGATGGACCTGGG + Intergenic
972906065 4:43748745-43748767 CAGAATGGCAGGAAGAAAATGGG + Intergenic
973828950 4:54738667-54738689 CAGAAAGACAGGATTGCAGTGGG - Exonic
975059883 4:69984695-69984717 CAGAAGGACAGGAGTGTAATGGG + Intergenic
975333849 4:73152479-73152501 CAGAAGGAGAGGAAGGGAAGGGG + Intronic
975468312 4:74734818-74734840 CAGAAGGAAAGGCTGGAGTTGGG - Intergenic
975499484 4:75069125-75069147 CAGAAGAATAAGATGAAAATAGG + Intergenic
976621307 4:87130273-87130295 CAAAAGGAAAGAATGAAAATAGG - Intronic
977436134 4:96997566-96997588 GAGAAGGACAGAATGAATATGGG - Intergenic
978690767 4:111506494-111506516 ATGAAGGAAAGGATGGCAATGGG + Intergenic
978948593 4:114528906-114528928 CAGCCCTACAGGATGGAAATGGG + Intergenic
979215016 4:118152932-118152954 CAGAAGGCCAGGACTGATATGGG - Intronic
979595508 4:122530163-122530185 AAGAATCACAGGGTGGAAATGGG - Intergenic
979667025 4:123323399-123323421 CAGGAGGAAAGGATGGGAAGCGG + Intergenic
981077801 4:140608153-140608175 CAGACGGACAGTTTGGAAATGGG - Intergenic
981517385 4:145624698-145624720 AAGAAGGAAAGGATAAAAATGGG - Intronic
981957101 4:150491000-150491022 CAGAAGGGCTGCATGGAAAATGG - Exonic
982321039 4:154077846-154077868 GAGAAGGGCAGGAGGGAAATGGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985583976 5:717706-717728 TAGGAGGAAAGGATGCAAATGGG + Intronic
985597480 5:802006-802028 TAGAAGGAAAGGATGCAAATGGG + Intronic
986223367 5:5790674-5790696 CAGTAAGACAGGGAGGAAATGGG + Intergenic
986404285 5:7410182-7410204 CAGCAGGAAGTGATGGAAATTGG + Intronic
986445284 5:7815964-7815986 CACAAGGAGAGGAAGGAAAGAGG - Intronic
986975363 5:13387787-13387809 CAGAGGGATAGGAGGGAAAATGG + Intergenic
987254518 5:16136814-16136836 CAGAAAGAAAGGATGGAAGGTGG + Intronic
988893289 5:35643563-35643585 TACAAGGACAAGATGGAAAGAGG + Intronic
989158807 5:38370548-38370570 CAGAAGGACAGCCTGGAAAAGGG + Intronic
989246696 5:39263435-39263457 CAGAAGGAGAGGATATGAATAGG + Intronic
990601913 5:57367522-57367544 CTGAAAGACAGGAAGGAGATTGG + Intergenic
990769953 5:59232097-59232119 CAGAAGTACCAGATCGAAATAGG + Intronic
991129761 5:63108896-63108918 CAGCAGTACAGGCAGGAAATAGG + Intergenic
992339573 5:75808773-75808795 CAGGAGGAAAGGGTGGAAAGGGG - Intergenic
992535806 5:77702032-77702054 CAGAGGGAAAGGGTGGGAATGGG + Intronic
993329354 5:86578123-86578145 CAGAAGGAAAGGATTGCTATTGG - Intergenic
993379000 5:87184041-87184063 CAGTAGGAATGAATGGAAATTGG - Intergenic
994910887 5:105905404-105905426 AAGAAGGACAGCATGGATATTGG - Intergenic
995418697 5:111938077-111938099 TAGAAGGACTGGATGGACACAGG - Intronic
995608473 5:113883986-113884008 CAGAAGGAGAAGAGAGAAATGGG - Intergenic
995780276 5:115767890-115767912 CAGGAGGAGAGGGAGGAAATGGG - Intergenic
998108189 5:139481736-139481758 CAGAAGGGCAGGAGGGCAAGGGG - Intronic
998110202 5:139495573-139495595 AAGAAGGAAAGGATAAAAATGGG + Intergenic
998207761 5:140171379-140171401 CAGAGGGACAGGATTGCATTTGG - Intergenic
998532073 5:142894612-142894634 CAGGTGGACAGAGTGGAAATGGG + Intronic
998802504 5:145884089-145884111 CAGCAGGACAGGAAGCAAAGTGG + Intergenic
999406913 5:151314677-151314699 CAGCAGGACAGAATGGAAGAAGG + Intergenic
999475882 5:151898596-151898618 CAGGAGGTCAGGATGGAAAAGGG + Intronic
999800747 5:155031789-155031811 CAGAGGGAAAGGATGGAAACGGG - Intergenic
999892382 5:155993151-155993173 CAGAAGGACTGAAGGGAAAATGG - Intronic
1000210293 5:159101486-159101508 GAGAAGGAACGAATGGAAATGGG + Intergenic
1000210616 5:159103911-159103933 CAGAAGGTCAGGGTGGGAGTGGG - Intergenic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001858977 5:175036706-175036728 CAGAGGGGCAGGAAGAAAATTGG + Intergenic
1003247889 6:4399715-4399737 AAGAAGGAAAGGAAGGGAATTGG + Intergenic
1003528673 6:6919870-6919892 CAGAAGCACTGGGTGGAAGTAGG - Intergenic
1004226280 6:13787500-13787522 TAGCAGGAGAGCATGGAAATCGG + Exonic
1004285985 6:14321404-14321426 CAGGAGGAAAGGGGGGAAATTGG - Intergenic
1005159929 6:22847569-22847591 GAGAAGGACAGGATTAAAATAGG + Intergenic
1005851957 6:29828877-29828899 CACAAGGAGAGGAGGAAAATGGG + Intronic
1006418655 6:33920043-33920065 CAGAGGGAGAGGATGGAAGAAGG + Intergenic
1007289204 6:40772403-40772425 CAGAATGACACGGTGGGAATGGG + Intergenic
1008014342 6:46501522-46501544 CAGAGAGACAGGATGGACAGTGG - Intergenic
1008044882 6:46841692-46841714 CAGAAGGAAAGGATGCAGATGGG - Intergenic
1008071458 6:47103029-47103051 CAGGAGGAAAGGAAGCAAATGGG + Intergenic
1008688923 6:53956204-53956226 CAGGAGGACAGCAAGGTAATAGG - Intronic
1008995621 6:57655203-57655225 GAGGAGGACAGGATGGTAGTGGG + Intergenic
1009184149 6:60553981-60554003 GAGGAGGACAGGATGGTAGTGGG + Intergenic
1009383282 6:63058711-63058733 AAGAAGGGGAGGATGGCAATTGG - Intergenic
1009738585 6:67712987-67713009 GCTAAGAACAGGATGGAAATAGG + Intergenic
1009931584 6:70182600-70182622 CAGAGAGACAGGAAGAAAATCGG + Intronic
1010123160 6:72403219-72403241 CAGAAGAAAAAGATGGAAAGAGG - Intergenic
1010438200 6:75860168-75860190 AAGATAGAAAGGATGGAAATAGG - Intronic
1010886519 6:81249798-81249820 CAGAGGGAAAGGATGGGAAGGGG - Intergenic
1011384937 6:86785614-86785636 CAGAATGACATGAGGCAAATGGG - Intergenic
1012380735 6:98616372-98616394 CAGAAGGTCAGGGTGAAACTAGG + Intergenic
1012813149 6:103986269-103986291 CAGAAGAATGGGCTGGAAATTGG - Intergenic
1012824396 6:104128426-104128448 CAGAAGGAAAGGAAGGGAAGGGG + Intergenic
1013094249 6:106929913-106929935 CAGGAGGACATATTGGAAATTGG - Intergenic
1013295471 6:108754694-108754716 GAGAAGGTGAGGATGGATATCGG - Intergenic
1013367504 6:109446978-109447000 GAGAGGCACAGGATGGAAACAGG - Intronic
1014506084 6:122258799-122258821 CAGAATAATAGAATGGAAATAGG - Intergenic
1014544819 6:122721629-122721651 CAGAACACAAGGATGGAAATAGG + Intronic
1015246806 6:131084195-131084217 CAGAAGGCCAGGATGGATCTGGG + Intergenic
1015336385 6:132044141-132044163 CAGAAGGAAAGAATGGAGACAGG + Intergenic
1015615092 6:135066258-135066280 CAGAAAGACAAGTTGGAAAATGG + Intronic
1017574551 6:155787584-155787606 CAGATGGACAGGAGGGAGACAGG + Intergenic
1018144998 6:160877453-160877475 CAGAAGTCCAGTATGAAAATAGG - Intergenic
1019235882 6:170612270-170612292 GAGCAGGACAGGTTGAAAATAGG + Intergenic
1020214789 7:6181705-6181727 CAGAAGGAGAGAATGGAAAGTGG - Intronic
1020469755 7:8522786-8522808 CAGAAGGACAGGGTGCACCTAGG - Intronic
1020882590 7:13780726-13780748 AAGAAGGACAAGAAGGAAGTGGG + Intergenic
1021079342 7:16344903-16344925 CAGAAGGACAGGACAGAGAAAGG + Intronic
1021288511 7:18814018-18814040 CAGATGAAGAGGCTGGAAATAGG - Intronic
1022533450 7:31081193-31081215 CATAAGAAAAGGGTGGAAATGGG + Intronic
1022885576 7:34639945-34639967 CAGAAAGCAAGGATGGTAATGGG - Intergenic
1023215752 7:37860990-37861012 GAGATGGAAAGGATGGAAAGAGG - Intronic
1023355620 7:39364412-39364434 CAGGAGGAAAGGGTGGAAAAGGG - Intronic
1023558603 7:41449172-41449194 CAGGAGGAGTGGATGGGAATAGG + Intergenic
1023910027 7:44547251-44547273 CACAAGGACAGGATGGGGAGGGG + Intergenic
1023979293 7:45057821-45057843 CATAAGGTGAGGATGGAAGTGGG - Intronic
1023981647 7:45073986-45074008 CAGCAGGGCAGGGTGGAAGTTGG - Intronic
1024584920 7:50833705-50833727 CCGAAGGACAGGATGGGACTGGG + Intergenic
1024789544 7:52948749-52948771 CAAACGGGAAGGATGGAAATGGG - Intergenic
1024937853 7:54729828-54729850 CAAATGGACAGCATGGAAACTGG - Intergenic
1025189587 7:56886532-56886554 CAGAAGGTCAGGGTAGAAAGAGG + Intergenic
1025275998 7:57581372-57581394 CAGAAGGAGAGGCTGGACTTTGG + Intergenic
1025682353 7:63690385-63690407 CAGAAGGTCAGGGTAGAAAGAGG - Intergenic
1026135570 7:67657741-67657763 CTGAGAGACAGGATGGAGATGGG - Intergenic
1027951887 7:84826686-84826708 CAGAAAGAGAGGACTGAAATAGG + Intergenic
1028253502 7:88563696-88563718 AATAAGGACAGGTTGGAATTAGG + Intergenic
1028474306 7:91236812-91236834 CAGAAGAGCAGGACTGAAATGGG + Intergenic
1029411033 7:100410831-100410853 CAGATGGAGAGGATGGTAGTGGG - Intronic
1030431962 7:109461099-109461121 CAAAGGAACAGGATGGAAAAAGG - Intergenic
1031507939 7:122609709-122609731 CAGAACTACAGGAAGGAAATAGG + Intronic
1031969736 7:128055409-128055431 CAGCAGGGGAGGAAGGAAATGGG + Intronic
1032089800 7:128905770-128905792 CACAAGGACAGGGTGGAGAGAGG - Intronic
1032092445 7:128917761-128917783 CACAAGGACAGGGTGGAGAGAGG + Intergenic
1032348319 7:131137159-131137181 TAGATGCACAGGATAGAAATAGG - Intronic
1032747056 7:134796552-134796574 AAGAAGGAAAGGCTGGAACTGGG - Intronic
1033011336 7:137625783-137625805 CAGAAGGACAAAATGTACATTGG - Intronic
1033099439 7:138457929-138457951 CGGAAGCACAGGATGGATATGGG + Intergenic
1035114606 7:156514195-156514217 CAAAGGGACAGGAGGGAATTTGG + Intergenic
1035515795 8:231803-231825 GAGCAGGACAGGTTGAAAATAGG + Intergenic
1037334672 8:17780471-17780493 CACTAGGACAAGAAGGAAATGGG - Intronic
1038144101 8:24877919-24877941 TACAAGAACAGGAGGGAAATGGG + Intergenic
1038646023 8:29363118-29363140 TAGAGGGAGAGGTTGGAAATGGG - Intergenic
1039545959 8:38411805-38411827 CTGAGGGACAGGATGGAGTTTGG + Exonic
1041772560 8:61487605-61487627 CTTAAAGACAGGATGGAATTTGG - Intronic
1042893349 8:73637191-73637213 CAGAAGGAGAGGAGGAAAAGGGG + Intronic
1044165529 8:88978288-88978310 TAGAAGGAAAGGAAAGAAATAGG - Intergenic
1044474733 8:92612732-92612754 CTGGAAGACAGGATGGATATAGG + Intergenic
1045189097 8:99865767-99865789 CAGAAGGACAGGCATAAAATGGG - Intronic
1045310239 8:100994830-100994852 CAGAAGGTCAGGATGTATCTGGG + Intergenic
1045680693 8:104656748-104656770 CAGATGTTAAGGATGGAAATAGG - Intronic
1045732991 8:105263528-105263550 CAGAGCAACAGGCTGGAAATTGG - Intronic
1045772279 8:105756923-105756945 CAGAATGACAGAATGGGAACAGG + Intronic
1046775231 8:118157414-118157436 CAGAAGGTCAGGAATGGAATTGG + Intergenic
1048064163 8:130950629-130950651 GAGAAGTACATGAGGGAAATGGG - Intronic
1048250859 8:132865766-132865788 CAGGAGGACAAGCTGGAAAGTGG - Intergenic
1048552270 8:135444589-135444611 TAGAAGGAAATGATGGAAATGGG + Intergenic
1049820678 8:144631321-144631343 CAGAAGGACAGGCAAGAAATGGG - Intergenic
1051075581 9:13230747-13230769 CAGAGGGAGAGGAGGGAAACGGG + Intronic
1051432874 9:16998501-16998523 CTGACGGACAGCATGGAAACAGG + Intergenic
1051803968 9:20970294-20970316 CAGAAGGATAGGAGAGAAAGGGG - Intronic
1052848781 9:33362604-33362626 AAGAGGGACAGGGTGGAAAAGGG + Intronic
1053016112 9:34663239-34663261 CAGAAGAAATGGATGGGAATGGG + Intronic
1053652677 9:40185064-40185086 CAGAAGGAAAGGATGCAGATGGG + Intergenic
1053903080 9:42814371-42814393 CAGAAGGAAAGGATACAGATGGG + Intergenic
1054531904 9:66191157-66191179 CAGAAGGAAAGGATGCAGATGGG - Intergenic
1055466174 9:76568999-76569021 CTGAAGGACAGCAAAGAAATGGG + Intergenic
1056269617 9:84934133-84934155 AACAAAGACAGAATGGAAATTGG - Intronic
1056436370 9:86578923-86578945 CATGAGGACAGCTTGGAAATGGG - Intergenic
1056587395 9:87937767-87937789 CAGAAGGAGAGGCTGGACTTTGG - Intergenic
1056609482 9:88115175-88115197 CAGAAGGAGAGGCTGGACTTTGG + Intergenic
1057476670 9:95408705-95408727 GAGAAGGACAGAACGGATATTGG + Intergenic
1057854374 9:98591318-98591340 CAGGAGCACAGGATGGAGAAGGG + Intronic
1058179686 9:101781509-101781531 CAGAAGTACAGGAAGAAAGTAGG - Intergenic
1059246411 9:112853296-112853318 CAGACACACAGGATGGAAAAAGG - Intronic
1060988600 9:127835642-127835664 CAGTAGGACTGGATGGCCATGGG - Intronic
1061695515 9:132370340-132370362 CTGGAGGAAAGGATGGAAACAGG + Intergenic
1203627176 Un_KI270750v1:34861-34883 CAGAAGGAGAGGTTGGACTTTGG + Intergenic
1185707207 X:2276778-2276800 GAGAAGGAGAGGGAGGAAATAGG + Intronic
1185872007 X:3672539-3672561 CAGAAGAACCGCATGGACATGGG - Intronic
1186179905 X:6963298-6963320 CAGAAAGGGAGGCTGGAAATGGG + Intergenic
1186981301 X:14960510-14960532 CAGAAGGTCAGGACTGCAATGGG - Intergenic
1187000267 X:15169451-15169473 CAGAAGAATAGTATGGAACTGGG - Intergenic
1187438251 X:19292401-19292423 CAGTTGGACAGGCTGGAAATAGG - Intergenic
1188396643 X:29692957-29692979 CAGAAAGACAGGCTGGATATTGG - Intronic
1188470159 X:30529182-30529204 CAGGTGGACAGGATGTATATAGG - Intergenic
1188929409 X:36088013-36088035 CAGAAAGACATCAGGGAAATGGG - Intronic
1189122302 X:38407745-38407767 CAGAAGCAGAGGATGGAGGTGGG + Intronic
1189527074 X:41834182-41834204 CAAAAGGACAGTTTGAAAATTGG - Intronic
1189699887 X:43707398-43707420 CAGAAGGATATGAAGGCAATGGG + Intronic
1190049608 X:47140024-47140046 CAGAAGGCAAGGATGGGTATGGG + Intergenic
1190211441 X:48451748-48451770 AAGAAGGAAAGGCTGGAAAATGG + Intergenic
1190791833 X:53707760-53707782 CAGAAGCACAGGTTCAAAATGGG + Intergenic
1191200922 X:57780353-57780375 CTGAGGGACAGGATGGACATGGG - Intergenic
1191960767 X:66699342-66699364 CAGTGGGAAAGGATGGAAATGGG - Intergenic
1192032100 X:67524819-67524841 CAGAATAACAGGATAGAAAATGG - Intergenic
1192065602 X:67881414-67881436 CGGAAGGACAGGATGGGCCTGGG - Intergenic
1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG + Intergenic
1193151290 X:78127380-78127402 TAAAAGGACAGGAAAGAAATAGG - Exonic
1193234789 X:79093608-79093630 CAGCAGGACCTGATGGAGATAGG + Intergenic
1193678519 X:84486932-84486954 CAGGAGGACAGGAGAGAGATTGG - Intronic
1194661812 X:96636144-96636166 CAGAAAGCCAGGAATGAAATGGG - Intergenic
1194743369 X:97602492-97602514 AAAAAGGAGAGAATGGAAATTGG + Exonic
1194993558 X:100570187-100570209 CAGAAGGTCAAAATGGAAACTGG - Intergenic
1195922813 X:110000479-110000501 CAGAAGCTCAGCATGGAAATTGG + Intergenic
1196062346 X:111424020-111424042 CTGAAGGACAGGAAGTAGATAGG + Intergenic
1196166776 X:112544013-112544035 CAAAAGGAGATGATGGAAAAAGG - Intergenic
1196193343 X:112816060-112816082 CAGAAGGTCAGGCTGGAAAAGGG - Intronic
1196203249 X:112909971-112909993 CAAAAGAACAGTATGGAAAGTGG - Intergenic
1196322403 X:114356704-114356726 CAGAAGAAAAGGAGGGAAAAAGG + Intergenic
1197364041 X:125542235-125542257 CAGAGGGAAAGGATGGGAAGAGG + Intergenic
1197832599 X:130660607-130660629 CAAAATGCCAGGATGGAAAATGG - Intronic
1197834046 X:130675736-130675758 TAGAAGGACAGGATTGCAAAAGG + Intronic
1199107812 X:143891865-143891887 CAGAAGCACTGGATTCAAATTGG + Intergenic
1199367308 X:147002326-147002348 CCGAGGGACAGAATGGACATGGG + Intergenic
1199712487 X:150480024-150480046 CAGAAGCACAGGATGGGGAGGGG - Intronic
1201458958 Y:14201452-14201474 CTGGAGGAGAGGAGGGAAATGGG + Intergenic
1201716417 Y:17048917-17048939 AAGAATGCCAGGATGGAATTTGG + Intergenic
1201953536 Y:19593525-19593547 CAGCAGGAGAACATGGAAATGGG + Intergenic
1202583964 Y:26405859-26405881 CAAAAGGAGAGGCTGGACATTGG - Intergenic