ID: 1159541885

View in Genome Browser
Species Human (GRCh38)
Location 18:69788250-69788272
Sequence TGCCAGTTCTAGTACCTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159541885_1159541886 9 Left 1159541885 18:69788250-69788272 CCAACAAGGTACTAGAACTGGCA 0: 1
1: 0
2: 0
3: 23
4: 249
Right 1159541886 18:69788282-69788304 TTGTGTGTGTTAATGTCTTTAGG 0: 1
1: 0
2: 1
3: 52
4: 643

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159541885 Original CRISPR TGCCAGTTCTAGTACCTTGT TGG (reversed) Intronic
901349507 1:8581104-8581126 TGCAAGTTCTCATACATTGTTGG - Intronic
905679121 1:39854296-39854318 TTCCAGTTCTAGAACTTTCTAGG + Intronic
906578708 1:46916035-46916057 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
910708236 1:90152674-90152696 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
911689489 1:100816270-100816292 TGTCAGTTCTAGTAGCTTTCTGG - Intergenic
913573172 1:120141912-120141934 AGCCAGCTCTGGTCCCTTGTAGG + Intergenic
914294429 1:146306709-146306731 AGCCAGCTCTGGTCCCTTGTAGG + Intergenic
914555473 1:148757492-148757514 AGCCAGCTCTGGTCCCTTGTAGG + Intergenic
917592184 1:176487683-176487705 GGCCTGGTCTAGGACCTTGTAGG + Intronic
917913247 1:179673928-179673950 TACCAGTTCTAGGAGCTTTTTGG + Intronic
924879811 1:248148191-248148213 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
924894521 1:248321489-248321511 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
1064513154 10:16117121-16117143 TGACAGTTCTCCTACATTGTTGG - Intergenic
1064867874 10:19902558-19902580 TACCAGTTCTAGGAGCTTTTTGG + Intronic
1065079642 10:22115265-22115287 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1065462780 10:25986469-25986491 TACCAGTTCTAGGAGCTTTTCGG - Intronic
1065960309 10:30728596-30728618 TTACAGTTTTATTACCTTGTAGG - Intergenic
1066651384 10:37659135-37659157 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
1067034882 10:42906826-42906848 TGCCAGTTCTAGGAGCGTTTTGG - Intergenic
1067184508 10:44015316-44015338 TGCCAGATGAAGTGCCTTGTAGG + Intergenic
1068396418 10:56467372-56467394 TATCAGTTCTAGTAGCTTTTGGG - Intergenic
1068809110 10:61235734-61235756 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
1069445090 10:68465526-68465548 TCATAGTTCTAGTACATTGTTGG - Intronic
1071015492 10:80992580-80992602 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1071799766 10:89045803-89045825 TGTCAGTTCTAGGACCCTTTGGG + Intergenic
1075824122 10:125339270-125339292 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1078948643 11:16102143-16102165 TACCAGTTCTAGGAGCTTTTTGG - Intronic
1080486116 11:32708789-32708811 TGCCAGTTCTAGGAGCTTTTTGG + Intronic
1080882605 11:36336618-36336640 TGCCTAATCTAGTACCTGGTAGG + Intronic
1081090742 11:38863283-38863305 TGCCAGTTCTAGGAGCTTTATGG + Intergenic
1083005407 11:59340406-59340428 TACCAGTTCTAGGATCTTTTTGG + Intergenic
1084622046 11:70279089-70279111 TGCCAGTTCAAGTACCTCTGCGG + Intronic
1086297931 11:85392051-85392073 TGCCAGTTCTAGGAGCTTCCTGG - Intronic
1086997520 11:93375169-93375191 TGTCAGTTCTAGGAGCTTTTTGG + Intronic
1087429458 11:98033987-98034009 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1087429469 11:98034150-98034172 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1087690186 11:101311960-101311982 TACCAGTTCTAGGAGCTTCTTGG + Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1087865870 11:103226090-103226112 TACCAGTTCTAGGAGCTTTTTGG + Intronic
1089405385 11:118193391-118193413 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1093690973 12:22108276-22108298 TACCAGTTCTAGGAGCTTTTTGG - Intronic
1096471062 12:51876009-51876031 TCCCGCATCTAGTACCTTGTCGG - Intergenic
1097083771 12:56452699-56452721 TTCCAGTTCTAATACGTTATCGG - Intronic
1102029206 12:109730370-109730392 TGCCAGAAGTAGTACCTTGTAGG - Intronic
1106391902 13:29342536-29342558 TGTCAGTTCTAGGAGCTTTTAGG + Intronic
1108420812 13:50247341-50247363 TACCAGTTCTAATCCCTTGCTGG - Intronic
1108831995 13:54490857-54490879 TGCCAGTTCTAGGAACTTTTTGG - Intergenic
1109077838 13:57860862-57860884 TGCCATGTCTAGTACATTGAGGG + Intergenic
1112139227 13:96619952-96619974 TGCCAATTCACCTACCTTGTAGG - Intronic
1112332848 13:98489975-98489997 TGCCACTTCTAGAACCGTTTTGG - Intronic
1113183155 13:107655262-107655284 TACCAGTTCTAGGAGCTTTTTGG - Intronic
1117103465 14:52374536-52374558 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1120736011 14:88053623-88053645 TACCAGTTCTAGGAGCTTCTTGG + Intergenic
1124348340 15:28937247-28937269 TGCCTCTTCTAGTTCCTTGTGGG + Intronic
1125167181 15:36720822-36720844 TTCCAGTTCTAGATCCTTGAGGG + Intronic
1126190906 15:45877560-45877582 TACCAGTTCTAGGACTTTTTTGG - Intergenic
1126977628 15:54201927-54201949 TACCAGTTCTAGAAGCTTTTTGG - Intronic
1127961381 15:63893460-63893482 TCCCAGTTCTGGCACCTTCTTGG - Intergenic
1129046652 15:72740990-72741012 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
1131687806 15:94789448-94789470 TGCCCTTTCTACTACATTGTGGG - Intergenic
1134440023 16:14293926-14293948 TGCCAGGTCTAGCACATGGTGGG - Intergenic
1135640824 16:24118504-24118526 TGCCTGTAGTAGTTCCTTGTAGG + Intronic
1137069504 16:35889181-35889203 AGCCAGTTCTAGTTCCATGAGGG + Intergenic
1138274501 16:55723556-55723578 TGTCAGTTCTAGTAGCCTTTTGG - Intergenic
1139951892 16:70676472-70676494 TGCCAGGCCTAGCACCGTGTGGG - Intronic
1140188249 16:72793400-72793422 TGCCAGTCCAAGGACCTCGTTGG + Exonic
1144616460 17:16779368-16779390 TACCAGTTCTAGAAGCTTTTTGG - Intronic
1144896236 17:18536285-18536307 TACCAGTTCTAGAAGCTTTTTGG + Intergenic
1145135977 17:20407929-20407951 TACCAGTTCTAGAAGCTTTTTGG - Intergenic
1153175967 18:2373646-2373668 TACCAGTTCTAGGAGCTTTTGGG + Intergenic
1155565958 18:27134522-27134544 TGCCACTGCTAGTAGCATGTAGG + Intronic
1155893258 18:31292479-31292501 TGCAAGATCTAGTAACTTGCAGG - Intergenic
1156081086 18:33337283-33337305 TACCAGTTCTAGGAGCTTTTTGG + Intronic
1157509313 18:48258336-48258358 TACTAGTTCTAGTAGCTTTTTGG - Intronic
1159473779 18:68890675-68890697 TGTCAGTTCTAGAACTTTATAGG + Intronic
1159541885 18:69788250-69788272 TGCCAGTTCTAGTACCTTGTTGG - Intronic
1160180456 18:76630611-76630633 TACCAGTTCTAGGAACTTTTTGG + Intergenic
1164152453 19:22566608-22566630 TGACAGTCCTAGGAACTTGTTGG - Intergenic
1165646721 19:37445561-37445583 TGCCAGTTCTAGGAGCTTTTGGG - Intronic
1166428773 19:42704154-42704176 TGTCAGTTCTAGGAGCTTTTTGG + Intronic
924992525 2:324940-324962 TGCCAGTTCTAGGAGCTTTTTGG + Intergenic
926560529 2:14412277-14412299 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
927024757 2:19055138-19055160 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
927069575 2:19513003-19513025 TCCCAGTTCTAGGAGCTTTTTGG + Intergenic
927722438 2:25393495-25393517 TACCAGTTCTAGGAGCTTTTTGG - Intronic
928473329 2:31596604-31596626 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
930638128 2:53828279-53828301 TACCAGTCCTCGTCCCTTGTTGG - Intergenic
930764891 2:55075189-55075211 TACCAGTTCTAGGAGATTGTTGG - Intronic
931536198 2:63279722-63279744 TACCAGTTCTAGGAGCTTTTTGG - Intronic
931834983 2:66089517-66089539 TACCAGTTCTAGTAGCTTTCTGG - Intergenic
938996758 2:136687448-136687470 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
939449544 2:142355703-142355725 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
939767671 2:146272307-146272329 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
940423358 2:153504261-153504283 TACCAGTTCTAGAAGCTTTTTGG + Intergenic
941593611 2:167449472-167449494 TACCAGTTCTAGGAACTTTTTGG + Intergenic
942341533 2:174953538-174953560 TACCAGTTCTAGGAGCTTTTTGG - Intronic
943521751 2:188960444-188960466 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
944609631 2:201389186-201389208 TGACAGTTCCAGAACCTTCTTGG + Intronic
944611837 2:201417828-201417850 TGCTAGTTTTAGTAACTTTTTGG - Intronic
945657459 2:212642967-212642989 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
946401907 2:219472684-219472706 TGCCTGTACTGGTACCTTGTTGG + Intronic
946801973 2:223427504-223427526 TACCAGTTCTAGGAGCTTTTCGG + Intergenic
947689090 2:232118053-232118075 GGCCAGATCCAGTTCCTTGTGGG + Intronic
1170086586 20:12539491-12539513 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
1170726584 20:18933357-18933379 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1170741379 20:19060693-19060715 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
1171375185 20:24688445-24688467 TGCCAGTTCTAGGAGCTTTTTGG + Intergenic
1171721359 20:28566426-28566448 TACCAGTTCTAGTAGCTTTTGGG - Intergenic
1171756711 20:29117131-29117153 TACCACTTCTAGTAGCTTTTGGG + Intergenic
1171785557 20:29460791-29460813 TACCAGTTCTAGTAGCTTTTGGG - Intergenic
1171862757 20:30416394-30416416 TACCAGTCCTAGTAGCTTTTGGG + Intergenic
1173568720 20:44062227-44062249 TACCAGTTCTAGGAGCTTTTTGG - Intronic
1174623556 20:51895648-51895670 TGCCAGTTTTCTTTCCTTGTGGG + Intergenic
1174953215 20:55066461-55066483 TCCCAGTTCTATGCCCTTGTTGG + Intergenic
1175029915 20:55942007-55942029 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1177586007 21:23096751-23096773 TGTAAGTTCAACTACCTTGTTGG + Intergenic
1180173525 21:46074953-46074975 TGTCAGTTCTAGTAGCTTTTTGG - Intergenic
1180294901 22:10925087-10925109 TACCAGTTCTAGTAGCTTTTGGG - Intergenic
1180413764 22:12640974-12640996 CACCAGTTCTAGTAGCTTTTGGG + Intergenic
1183853864 22:40616189-40616211 TGTTAGTTCTAGTATATTGTTGG - Intronic
1185121065 22:48970538-48970560 TGCCAGTTCTAGGAGCTTTTTGG - Intergenic
1185261524 22:49867711-49867733 TGCCAGATCTAATACCATCTAGG + Intronic
950006643 3:9695764-9695786 TTCCAGTTCTAGCAGCTTGTGGG - Intronic
950938411 3:16866993-16867015 TGCCGGCTCTAGAACCTTATAGG + Intronic
952062334 3:29525553-29525575 TGCCAGTTCTCTTTCCTTTTTGG + Intronic
952995342 3:38875468-38875490 TGCCAGTTCTAGGAGTTTTTTGG - Intronic
953495610 3:43384032-43384054 TACCAGTTCTAGGAACTTTTTGG - Intronic
956023722 3:64959686-64959708 TGCCAATTTTGTTACCTTGTAGG + Intergenic
956664351 3:71628076-71628098 TGCCAGTTCCAGTTCCTTTCTGG - Intergenic
958070455 3:88604080-88604102 TGTCAGTTCTAGGAACTTTTTGG - Intergenic
958741383 3:98077560-98077582 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
959324647 3:104921173-104921195 TAACATTTCTAGTACCTTATTGG - Intergenic
959424155 3:106165524-106165546 TGCCAGTTCTAGGAGCTTTCTGG - Intergenic
959745409 3:109770620-109770642 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
960999014 3:123359781-123359803 TTCCTGTTCTAGTCCTTTGTCGG + Intronic
964300659 3:155281624-155281646 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
964393963 3:156225684-156225706 TACCAGTTCTAGGAGCTTTTTGG - Intronic
965390526 3:168097364-168097386 TGACAGCTCTAGGACCTTTTAGG + Intergenic
966153373 3:176890673-176890695 TACCAGTTCTAGTAGTTTTTTGG - Intergenic
967461445 3:189751364-189751386 TTCCAGTTCTAGATCCTTGAGGG + Intronic
967768269 3:193306039-193306061 TTTCAGTTCTTGTACCTGGTGGG + Intronic
970718027 4:18951115-18951137 TGAGAATTCTATTACCTTGTTGG + Intergenic
972806868 4:42537529-42537551 TACCAGTTCTAGGAGCTTTTTGG - Intronic
973342678 4:49021930-49021952 TACCAGTTCTAGGAGCTTTTTGG + Intronic
973578702 4:52319067-52319089 AGCCAGTTCTAGTAGCTTAATGG - Intergenic
975301221 4:72793401-72793423 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
977510835 4:97960462-97960484 TACCAGTTCTAGGAGCTTTTTGG - Intronic
977694172 4:99948926-99948948 TGCCAGTTCAAGTACCTAAAAGG + Exonic
978158160 4:105513132-105513154 TTTCAGTTCTAGTAGCTTTTTGG + Intergenic
978757547 4:112319921-112319943 TACCAGTTCTAGGAGCTTTTTGG + Intronic
978762175 4:112365323-112365345 TACCAGTTCTAGAAGCTTTTTGG - Intronic
978916457 4:114131604-114131626 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
980409645 4:132400133-132400155 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
980644770 4:135629271-135629293 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
981680608 4:147393347-147393369 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
981938661 4:150258890-150258912 TGCCAATTCTATTACCCTGGAGG - Intergenic
982531645 4:156552194-156552216 TGCCAGTTCTAAGAGCTTTTTGG + Intergenic
982950247 4:161685639-161685661 TGTCAGTTCTAGAAGCTTTTTGG + Intronic
983036187 4:162868901-162868923 TATCAGTTCTAGTACTTTTTTGG - Intergenic
983729589 4:170976741-170976763 TCCCAGTTCTAGGAGCTTTTTGG - Intergenic
985356084 4:189120933-189120955 TGTCAGTTCTAGGAGCTTTTAGG - Intergenic
986634377 5:9806010-9806032 TTCCAGTTCTAGAAGCTTTTTGG - Intergenic
987176517 5:15316368-15316390 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
987440307 5:17947663-17947685 TACCAGTTCTAGTTGCTTTTTGG + Intergenic
987527743 5:19075236-19075258 TACCAGTTCTAGAAGCTTTTTGG - Intergenic
988420783 5:31003520-31003542 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
988929370 5:36021306-36021328 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
989072835 5:37529702-37529724 TACCAGTTCTAGGAGCTTTTTGG + Intronic
989694033 5:44178542-44178564 TGCCACTTCTAGGAGCTTTTTGG + Intergenic
990918355 5:60935414-60935436 TACCAGTTCTAGGAGCTTTTTGG + Intronic
992599506 5:78384332-78384354 TACCAGTTCTAGGAGCTTTTTGG + Intronic
992967422 5:82017291-82017313 TACCAGTTCTAGGAGCTTTTTGG + Intronic
993601123 5:89926085-89926107 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
993948221 5:94140421-94140443 TACCAGTCCTAGTAGCTTTTTGG + Intergenic
996198171 5:120635882-120635904 TACCAGTTCTAGAAGCTTTTTGG - Intronic
996875056 5:128231480-128231502 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
997003751 5:129794129-129794151 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
999067313 5:148703015-148703037 TATCAGTTCTAGTAGCTTTTTGG + Intergenic
1003465294 6:6374361-6374383 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
1003582376 6:7352146-7352168 TGTCAGTTCTAGGAGCTTTTGGG - Intronic
1004104268 6:12650925-12650947 TGCCACTTCATGCACCTTGTGGG - Intergenic
1005401640 6:25440114-25440136 ATCCATTTCCAGTACCTTGTTGG + Intronic
1005840687 6:29743021-29743043 TGTCAGTTCTGGTTCCCTGTGGG - Intergenic
1005849961 6:29813843-29813865 TGTCAGTTCTGGTTCCCTGTAGG - Intergenic
1006060264 6:31413774-31413796 TGTCAGTTCTGGTTCCCTGTGGG + Intronic
1006105602 6:31714399-31714421 TGCCAGCTTTACTACCTTGGAGG + Intronic
1007524771 6:42482042-42482064 TGACAGTTTTAGTATCATGTTGG + Intergenic
1008041942 6:46811348-46811370 TACCAGTTCTAGGAGCTTTTTGG + Intronic
1010518036 6:76798724-76798746 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1010817193 6:80372340-80372362 TGCCAGTTCTAGGAGCTTTTCGG + Intergenic
1011290670 6:85773306-85773328 TGTCAGTTCTAATAGCTTTTTGG + Intergenic
1011360784 6:86522451-86522473 TGCCAGTTCTAGGAGCCTTTTGG + Intergenic
1012027961 6:94021938-94021960 TGCCTGTTCTAGGAGCTTTTTGG + Intergenic
1012357179 6:98329297-98329319 TACCAGTTCTAGAAGCTTTTTGG + Intergenic
1012537932 6:100322139-100322161 TATCAGTTCTAGTAGCTTTTTGG + Intergenic
1012786544 6:103635720-103635742 TGCCAGTTCTAGGAGCTTTTTGG - Intergenic
1013090095 6:106892663-106892685 AGCCCTTTCTAGTACCATGTGGG + Intergenic
1014506932 6:122270677-122270699 TTCCAGTTCTAGATCCTCGTGGG + Intergenic
1015849353 6:137555694-137555716 TGTCAGTTCTAGGAGCTTTTTGG + Intergenic
1016103678 6:140134931-140134953 TGCCAGTTCTAATAGTTTTTTGG - Intergenic
1016484698 6:144524567-144524589 TACCAGTTCTAGGAGCTTTTTGG + Intronic
1016661963 6:146592117-146592139 TATCAGTCCTAGTTCCTTGTAGG + Intergenic
1018168400 6:161123107-161123129 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1020348702 7:7194052-7194074 TGCCAGTTCTAGGAGCTTTTTGG + Intronic
1020608900 7:10371021-10371043 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
1020686950 7:11308211-11308233 TTCCAGGTTTAGTATCTTGTTGG + Intergenic
1020987432 7:15154142-15154164 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
1020995784 7:15262243-15262265 TACCAGTTCTAGGAGCTTTTTGG - Intronic
1021339937 7:19452709-19452731 TACCAGTTCTAGAAACTTTTTGG + Intergenic
1021779559 7:24089569-24089591 TGTCAGTTCTAGGAGCTTTTTGG + Intergenic
1023144761 7:37139334-37139356 TGCCAGTTTTAGGAGCTTATTGG - Intronic
1024417381 7:49122511-49122533 TACCAGTTCTAGGAACTTTTTGG - Intergenic
1024518745 7:50284334-50284356 TGGCAGCTCTAGAACCTTGGAGG + Intergenic
1024741754 7:52362695-52362717 TGCCAGCTCTAGTTCCGGGTGGG + Intergenic
1028198131 7:87931002-87931024 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
1028502224 7:91531750-91531772 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
1028529314 7:91820859-91820881 TACCAGTTCTAGAAGCTTTTTGG + Intronic
1028823009 7:95234290-95234312 TACCAGTTCTAGGAACTTTTTGG - Intronic
1031006042 7:116473306-116473328 TACCAGTTCTAGGAGCTTTTTGG - Intronic
1031655101 7:124345335-124345357 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1033502336 7:141964815-141964837 TACCAGTTCTAGGAGCTTTTTGG + Intronic
1033530726 7:142260939-142260961 TTCCAGTTCTAGGAGCTTTTTGG + Intergenic
1034716040 7:153243040-153243062 TGCCAGTTCTAGGAGCTTTTTGG + Intergenic
1038909094 8:31941655-31941677 TACCAGTTCTAGGAGCTTTTTGG - Intronic
1040670765 8:49687576-49687598 TGTCAGTTCTAGTAGCTATTTGG + Intergenic
1041211221 8:55553027-55553049 TGGCAGATTTAGTGCCTTGTGGG + Intergenic
1042431741 8:68714390-68714412 TACCAGTTCTAGGAGCTTTTTGG - Intronic
1042565203 8:70103970-70103992 TGCCAGTTCAAGTACCTCTGCGG + Intergenic
1042977084 8:74481302-74481324 GGTCAGTTCTACTACCTTCTAGG + Intronic
1043763786 8:84103805-84103827 TACCAGTTTTACCACCTTGTCGG + Intergenic
1045813830 8:106256584-106256606 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1046250214 8:111621612-111621634 TACCAGTTCTAGTACCTTTGTGG + Intergenic
1047890110 8:129299126-129299148 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1047901487 8:129427234-129427256 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1048359952 8:133689209-133689231 TGCCACTTCTAGTCTCTTGGTGG - Intergenic
1048447257 8:134500737-134500759 TGCCAGCTCTTGTCCTTTGTAGG - Intronic
1048447513 8:134502950-134502972 TGCCAGTTTTAGTGCCTCCTGGG - Intronic
1049027150 8:140000828-140000850 TTCCAGTTCTAGATCCTTGAGGG - Intronic
1050331750 9:4552859-4552881 TGCCAGTTCAGGTACTTTATAGG - Intronic
1051089363 9:13387806-13387828 TGCCTTTTTTAGTCCCTTGTGGG + Intergenic
1051700929 9:19823051-19823073 TTCCAATTCTAGTCCCTTCTGGG + Intergenic
1052564920 9:30137266-30137288 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
1052708702 9:32024999-32025021 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1054450523 9:65401450-65401472 TGCCAGTCCTAGTCCCTCGGAGG + Intergenic
1056696528 9:88860115-88860137 TGCCAGTTCTAGGAGCTTTTTGG - Intergenic
1057835915 9:98445267-98445289 TGCCAGTTGCAGTAGCCTGTAGG - Intronic
1058160017 9:101559779-101559801 TACCAGTTCTAGCACCTTTCTGG + Intronic
1058233939 9:102465615-102465637 TGCCAGTTCTAGGATCTTCTTGG - Intergenic
1058646487 9:107135828-107135850 TCCCACTTCTAGTCCCTTGAGGG + Intergenic
1059674105 9:116520764-116520786 TACCAGTTCTAGGAGCTTTTTGG - Intronic
1202801783 9_KI270720v1_random:6208-6230 TACCAGTTCTAGTAGCTTTTGGG - Intergenic
1203446329 Un_GL000219v1:59955-59977 TACCAGTTCTGGTAGCTTTTGGG - Intergenic
1189218839 X:39352812-39352834 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1189945662 X:46175443-46175465 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1190973919 X:55380768-55380790 TACCTTTTATAGTACCTTGTAGG - Intergenic
1191888560 X:65916429-65916451 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1191961824 X:66711954-66711976 TTCCAGTTCTAGTACTTTAATGG + Intergenic
1192031703 X:67520693-67520715 TATCAGTTCTAGGAGCTTGTTGG - Intergenic
1193007134 X:76632890-76632912 TACCAGTTCTAGAAGCTTTTAGG + Intergenic
1193687756 X:84598990-84599012 TGCTAATTCTAGTACCCGGTAGG - Intergenic
1194469943 X:94281642-94281664 TACCAGTTCTAGGAGCTTTTTGG + Intergenic
1195556469 X:106230991-106231013 TTCCAGTTCTAGGAGCTTTTTGG - Intergenic
1196024494 X:111026418-111026440 TCCCAGTTCTAGGAGCTTTTTGG - Intronic
1196629054 X:117914538-117914560 TGCCTGCTGAAGTACCTTGTTGG - Intronic
1197956837 X:131959923-131959945 TACCAGTTCTAGGAGCTTTTTGG - Intergenic
1198180074 X:134198846-134198868 TACTAGTTCTAGTAGCTTTTTGG + Intergenic
1198325845 X:135571815-135571837 TGCAAGTTCTGGGACCTTTTGGG + Intronic
1198609953 X:138387253-138387275 TGTCAGTTCTAGTAGCCTTTTGG - Intergenic
1198665086 X:139011954-139011976 TACCAGTTCTAGGAGCTTTTTGG - Intronic
1199265959 X:145825681-145825703 TTCTAGTTCTAGGACTTTGTAGG + Exonic
1199392257 X:147294246-147294268 TGCTAGTTCTAGTAACTTTTTGG - Intergenic
1200333043 X:155318319-155318341 TACCAGTTCTAGGAGCTTTTTGG - Intronic
1200380488 X:155832496-155832518 TATCAGTTCTAGTAGCTTTTTGG - Intergenic