ID: 1159547800

View in Genome Browser
Species Human (GRCh38)
Location 18:69862226-69862248
Sequence ACATTTTTACAGTTGTAGTA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159547800_1159547802 13 Left 1159547800 18:69862226-69862248 CCATACTACAACTGTAAAAATGT 0: 1
1: 0
2: 0
3: 18
4: 264
Right 1159547802 18:69862262-69862284 TACACTAATCATTGAGAATTTGG 0: 1
1: 0
2: 1
3: 11
4: 191
1159547800_1159547803 20 Left 1159547800 18:69862226-69862248 CCATACTACAACTGTAAAAATGT 0: 1
1: 0
2: 0
3: 18
4: 264
Right 1159547803 18:69862269-69862291 ATCATTGAGAATTTGGTTATTGG 0: 1
1: 0
2: 1
3: 13
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159547800 Original CRISPR ACATTTTTACAGTTGTAGTA TGG (reversed) Exonic
903257110 1:22109967-22109989 ACATTTTTACATTTTCTGTAAGG - Intergenic
906493112 1:46283450-46283472 GCATTTTTATATTTTTAGTAAGG - Intronic
907172182 1:52478648-52478670 ACAATTTAACAATTATAGTAAGG + Intronic
907648626 1:56270638-56270660 CCATTTTTACAATGGTAGTAGGG + Intergenic
907880313 1:58543835-58543857 ACATTTTTATCATTGTAGAAAGG - Intronic
908534156 1:65063390-65063412 ACATTATTACTGTTATATTAGGG - Intergenic
909749776 1:79144393-79144415 ACTTTTCTACACTTTTAGTAGGG + Intergenic
909780982 1:79546940-79546962 ATATTTTTACAGTTTTAGAGTGG - Intergenic
910779842 1:90918419-90918441 ACATTTTCTCAGTTCTAGTTTGG - Intronic
911702631 1:100971894-100971916 ACATATTTATTGTTGTAGAAAGG - Intronic
911898411 1:103469130-103469152 TAATTTTTATATTTGTAGTAGGG - Intergenic
912184348 1:107256882-107256904 ACATTTTGACAGGTATAGGAAGG - Intronic
912345186 1:108957175-108957197 TCATTTTGCCAGATGTAGTAGGG - Intronic
914711662 1:150220362-150220384 ACTTTTACACAGGTGTAGTATGG - Exonic
915822137 1:159035461-159035483 TCATTTGTACAGCTGTAGCAAGG - Intronic
917108613 1:171521145-171521167 AAATTCTTACATTTGAAGTAAGG - Intronic
917733821 1:177902237-177902259 TCATTTTTACAGTGTCAGTAAGG - Intergenic
918020379 1:180681964-180681986 ATCTTTTTAAAATTGTAGTAAGG - Intronic
919069194 1:192732435-192732457 AAATTTTTATAGTGGTAGCAAGG - Intergenic
919088084 1:192945406-192945428 GCGTTTTCACAGATGTAGTAGGG - Intergenic
919423606 1:197403507-197403529 ACATTTTTGAAGTTATAGGATGG - Intronic
923154970 1:231270270-231270292 ATATTTTTACCATTTTAGTATGG + Intronic
923168466 1:231390431-231390453 ACATTTACACAGTTGTGGTGAGG - Intronic
923270434 1:232350532-232350554 ACATTTTTACATATGGTGTATGG - Intergenic
923662506 1:235970481-235970503 AATTTTTTATATTTGTAGTAGGG - Intergenic
924275558 1:242382617-242382639 GCATTTTTACTGGTGTGGTAAGG + Intronic
1064964236 10:20999428-20999450 ATATTTTTAAATTTTTAGTAGGG - Intronic
1065781125 10:29168745-29168767 ACATTTTCTCAGTTGTATTTTGG - Intergenic
1066237526 10:33500950-33500972 ACCTTATTACAATTGTAGGATGG + Intergenic
1066328056 10:34386072-34386094 ACATTTTTACGATATTAGTAAGG + Intronic
1067677500 10:48397032-48397054 TCATTTTGATAGTTGTACTATGG - Intronic
1067677600 10:48398048-48398070 TCATTTTGATAGTTGTACTATGG + Intronic
1068286811 10:54948723-54948745 TCATTTTTAAAGTTGTTATAAGG - Intronic
1071072174 10:81706933-81706955 GCATTTTTATAATTGTAATATGG + Intergenic
1071418712 10:85466424-85466446 ACATTTTGATATTTGTATTATGG - Intergenic
1071982845 10:91021256-91021278 AAATTTTTCCACTTGTATTAAGG - Intergenic
1073175982 10:101558068-101558090 ACATTCTTCCAGCTCTAGTAGGG - Intergenic
1073475502 10:103750049-103750071 ACATTTTTATTGTTGTTGTTTGG + Intronic
1073938161 10:108660343-108660365 TCATTTTTCCAGTTCTAGAAAGG - Intergenic
1074343298 10:112655639-112655661 ACATCTATACAGTTGTAGTCAGG - Intronic
1079412557 11:20202702-20202724 ACACTTTTACAGTGGTGGTCCGG + Intergenic
1081196959 11:40172929-40172951 ACATATTTCCACTTGTTGTAAGG - Intronic
1081205095 11:40265924-40265946 CCATTTTTACATTTGTAGAATGG + Intronic
1085496508 11:76974750-76974772 AAATTTTTACTGTTGTATGAAGG + Intronic
1085811752 11:79689091-79689113 ACATTATCACAGCTGTGGTAGGG + Intergenic
1086510682 11:87554627-87554649 ACATTTTTAAAGTTGTATACAGG + Intergenic
1088290960 11:108236591-108236613 ACATTTTAAGTGTTGTAGAAAGG + Intronic
1089437212 11:118480045-118480067 ACATTTTTATAGTTGAAAAAAGG - Intronic
1089511560 11:119001256-119001278 AAATTGTGACAGTTGTAGTTTGG + Intronic
1090974453 11:131669785-131669807 ACTTTTTTATAGTTTTAATATGG - Intronic
1092878502 12:12869385-12869407 ACATGTTTTCTGTTGTAGTTTGG + Intergenic
1094116293 12:26917953-26917975 ACATTTCTGTAGTTTTAGTAGGG - Intronic
1095787523 12:46126330-46126352 ACATTTTTACAGCTGTCTTATGG - Intergenic
1097497611 12:60360824-60360846 ATATTTTTACAGTGCTAATAAGG - Intergenic
1098380958 12:69869114-69869136 CCATTTTTATAGTTGGAGGATGG + Intronic
1099232190 12:80039736-80039758 ACATTTTTACATTTATAGTGTGG + Intergenic
1099655137 12:85479528-85479550 ACAGTTTCACAATTGTCGTAGGG + Intergenic
1100454544 12:94739758-94739780 ACATTTTTACTCTTATATTAAGG + Intergenic
1101773535 12:107773634-107773656 ACATTTTTAAAGGTGTAGCTTGG - Intergenic
1104154665 12:126119608-126119630 ACATTTTTACAGTTTAAAAATGG + Intergenic
1106346284 13:28882223-28882245 AAATTTTTATATTTTTAGTAGGG + Intronic
1107169414 13:37322107-37322129 ATATTTTTCCAGTTGTACCAAGG + Intergenic
1107707645 13:43123179-43123201 ACATTTTTCCAGTTGTAGGGGGG - Intergenic
1107931447 13:45311053-45311075 ACATTTGTACAGGTGTAGTCTGG - Intergenic
1108443530 13:50481377-50481399 ACACTTTTACAATGGTAGCAAGG - Intronic
1109121308 13:58461702-58461724 ACATTCTAACAGTGGTGGTAAGG - Intergenic
1109282473 13:60372764-60372786 ACACTGTTTAAGTTGTAGTAGGG + Intergenic
1110771914 13:79358915-79358937 ACATTTTGACACTTGAAGAAAGG + Intronic
1110877796 13:80531892-80531914 ACACTGTTACAATTGTAGAATGG + Intergenic
1111045805 13:82812022-82812044 ACATTTTTACCAGTGGAGTAGGG + Intergenic
1111710834 13:91812203-91812225 ACATTTTTATATTTATAGTCTGG - Intronic
1112097844 13:96153996-96154018 ACGTTTTCTCAGTTGTAATATGG + Intronic
1112879307 13:104086316-104086338 ACAATTGTACAGTTGAATTAAGG - Intergenic
1112919167 13:104588998-104589020 ACATTTTTAGCTTTTTAGTAGGG + Intergenic
1113636429 13:111921929-111921951 ACAGTTTTACAGAAGTATTAGGG - Intergenic
1117248720 14:53913776-53913798 ACATTTCTACAGCTAAAGTAAGG + Intergenic
1117718578 14:58605965-58605987 AAATTATTACACTTCTAGTAAGG + Intergenic
1118677408 14:68202392-68202414 AAATTTTTAAAGTTCTACTATGG - Intronic
1120330123 14:83081935-83081957 ATTTTTTTGCAGTTTTAGTACGG - Intergenic
1120392066 14:83921806-83921828 ACATTTGTACATTTGTACTTTGG + Intergenic
1121808611 14:96857348-96857370 ACATTTGAGCAGTTGTAGGAAGG + Intronic
1124073371 15:26416635-26416657 ACATTTTAACATCTGTTGTATGG - Intergenic
1124546141 15:30628455-30628477 CCAAGTTTACAGATGTAGTAGGG - Intronic
1124779665 15:32617846-32617868 CCAAGTTTACAGATGTAGTAGGG - Intronic
1125056446 15:35363031-35363053 ACATTTGTAGACTTGTATTATGG + Intronic
1125298846 15:38232897-38232919 ACTTTTTTATATTTTTAGTAGGG - Intergenic
1127179047 15:56395659-56395681 ACCCTTTTACACTTGCAGTATGG - Intronic
1130474290 15:84249846-84249868 TAATTTTTGCAGTTTTAGTAGGG + Intergenic
1130481704 15:84363908-84363930 TAATTTTTGCAGTTTTAGTAGGG + Intergenic
1131302713 15:91213593-91213615 AAATTTTTACAGATGAATTATGG - Intronic
1131869015 15:96742510-96742532 ACATTTCAACAGTTGTGGAAAGG - Intergenic
1137941342 16:52689913-52689935 AAATATTTACAGTTGAAGGATGG - Intergenic
1139294270 16:65886607-65886629 ACATTTGCTCAGTTGTAGGAGGG - Intergenic
1140034637 16:71363015-71363037 TAATTTTTAAATTTGTAGTAGGG - Intronic
1140783606 16:78318597-78318619 CCATTTTCTCAGTTGTAGAATGG + Intronic
1140927326 16:79596785-79596807 ATTTTTTTACAGTTGTATTGTGG - Intronic
1143860741 17:9888926-9888948 AAATATTTACACTTGTAGTAGGG - Intronic
1145179972 17:20739544-20739566 ACGTTTTCACAGTCATAGTAGGG - Intergenic
1147286494 17:39406512-39406534 ACATGTTTTCAGATGCAGTAAGG - Intronic
1147376414 17:40024900-40024922 TCATTTTTATATTTTTAGTAAGG + Intronic
1148376472 17:47151304-47151326 ACATGTTCACAGTTTTAGAAAGG + Intronic
1148409813 17:47456310-47456332 ACATTTTAATAATTGTAGTTTGG + Intergenic
1148717427 17:49725774-49725796 ACGTTTTTGCAGATGTATTAAGG + Intronic
1151117484 17:71754060-71754082 AAATTTTTACATTTTTAGCATGG + Intergenic
1155310231 18:24516190-24516212 ACATTTTTACAGTTTAATTCTGG - Intergenic
1155604513 18:27588767-27588789 ACATTTTAATAGTTGTCTTAGGG + Intergenic
1156296865 18:35800303-35800325 AAATTTTTTCAGTTTTAGGATGG - Intergenic
1158240081 18:55367781-55367803 ACATTTTTACAGCTTTTGTGGGG - Intronic
1159262069 18:66027020-66027042 ACTGCTTTACAGTGGTAGTAAGG - Intergenic
1159509937 18:69383676-69383698 ACATTTTAACAGATCCAGTATGG - Intergenic
1159547800 18:69862226-69862248 ACATTTTTACAGTTGTAGTATGG - Exonic
1159882181 18:73868655-73868677 ACATTTCTACATTGGCAGTATGG - Intergenic
1160669610 19:354170-354192 TCATTTTTATATATGTAGTATGG + Intergenic
1163097590 19:15071184-15071206 ACATTTCTCCAGGAGTAGTATGG + Intergenic
926521469 2:13920993-13921015 ACATTTTTGAAGTAGTATTAAGG + Intergenic
927989603 2:27438334-27438356 ATATTTATACAGTTTTAGTTAGG + Intronic
929484888 2:42344363-42344385 TCATTCCTAAAGTTGTAGTAGGG - Intronic
930381847 2:50639564-50639586 ACATCTTTACAGTTTCAGGATGG + Intronic
932174889 2:69590745-69590767 CCATTTTCACAGTTGTAAAATGG + Intronic
933201766 2:79458760-79458782 ACATTTTTATATTTGTTGCATGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936890244 2:117360646-117360668 ATATTTCTACAGTTGTAAAAAGG + Intergenic
937045829 2:118851043-118851065 ACATTTTTTCACTTGAAGGAAGG + Intergenic
939320814 2:140618984-140619006 ATATTTTTACAATTGCAGAATGG + Intronic
939579172 2:143928088-143928110 ACTTTTTTACACTTGTGGTGGGG - Intergenic
940015760 2:149102412-149102434 ACATTTGTACTGTTGTTGGAGGG + Intronic
941060247 2:160838963-160838985 ACATTTACACAGTAGCAGTATGG + Intergenic
941687920 2:168466629-168466651 ACATTCTTACAGATGAATTACGG - Intronic
941922008 2:170860433-170860455 TCATTGTTACAGGTGTACTATGG + Exonic
943196677 2:184761277-184761299 GCATTTTTAAAAATGTAGTAAGG + Intronic
943293182 2:186102041-186102063 AAAGTATCACAGTTGTAGTAGGG - Intergenic
944184622 2:196933454-196933476 ACATGTTTACAGTTGTGTTTGGG + Intergenic
944421410 2:199534836-199534858 AAATTTTTACTGTTGGAGAATGG - Intergenic
945734543 2:213582943-213582965 TCATTTTTACATTTGTGTTATGG - Intronic
947262189 2:228235730-228235752 ACATTTGGACAGCTTTAGTAAGG + Intergenic
947422529 2:229953795-229953817 AAATTTTTACTGTTATACTAAGG - Intronic
947775442 2:232705250-232705272 ACATTATTAGAGTAGTAGTGGGG + Intronic
948472903 2:238196766-238196788 ACATTTTCCCATTTGTATTAGGG - Intronic
1169107204 20:3006568-3006590 ACATTTTTATAAGTGAAGTATGG + Intronic
1171040689 20:21759799-21759821 AAATGTTTACATTTGTAGTGTGG - Intergenic
1172060828 20:32186277-32186299 ACATTTTTGTATTTTTAGTAGGG + Intergenic
1174555399 20:51391680-51391702 ACATTTTTAAATTTTTAGTAGGG + Intronic
1177874478 21:26614298-26614320 ACATTTTTACATTTATTTTATGG + Intergenic
1178015433 21:28340248-28340270 AAATTTTTAAAGTTGAAATAAGG + Intergenic
1178665366 21:34541984-34542006 ACATTTTTAAAATTTTGGTAAGG + Intronic
1179209861 21:39315169-39315191 ATATTTTTATATTTTTAGTAGGG + Intronic
1182675692 22:32037448-32037470 ACATTGTAGCTGTTGTAGTATGG + Intergenic
1182720827 22:32398096-32398118 ACATTTTTACATTTGCAGTTGGG - Exonic
1182937887 22:34243403-34243425 AGATATTTAGAGTTGTATTAGGG - Intergenic
1183291217 22:37003024-37003046 ACATATTTACAGCTGTAATCTGG - Intronic
1184366498 22:44055053-44055075 TCATTCTTTCAATTGTAGTAAGG - Intronic
949706781 3:6827579-6827601 ACATTTTTGCAATTATAGCAAGG + Intronic
950735831 3:15007293-15007315 AAATTTTTATATTTTTAGTAGGG + Intronic
952222518 3:31339142-31339164 ACATTTTCTCATTTGTATTAAGG + Intergenic
952754546 3:36855065-36855087 AGGTTTTTACAGCTGAAGTAAGG - Intronic
954234980 3:49249575-49249597 ACATTTTTATAATTTTAGAATGG + Intronic
955022654 3:55136185-55136207 ACATTTTTACATTTATATGAAGG - Intergenic
955100406 3:55843709-55843731 ACATTTTTGCAGTGGGATTAAGG - Intronic
955437334 3:58915707-58915729 ACATTTTAAAAATTGTATTATGG + Intronic
955688621 3:61568595-61568617 TTTTTTTTACAGTTGTATTAAGG - Intronic
956122775 3:65982506-65982528 TCATTTTTACAGCTGTATTCTGG - Intronic
956570085 3:70684444-70684466 ACATATTTTCAGTAGTACTATGG - Intergenic
957731665 3:84146849-84146871 ACATTTTTTCAGTTATATTGAGG + Intergenic
958143921 3:89599716-89599738 ACATTTTTTAAGTTGATGTATGG - Intergenic
958182240 3:90074275-90074297 AAATTTTTAAATTTGTATTAAGG + Intergenic
958984545 3:100765131-100765153 ACATTTCTAGAAATGTAGTAAGG - Intronic
959209256 3:103355882-103355904 ACATTTATACATTTTTAGGATGG - Intergenic
959765396 3:110020970-110020992 ACATATTTGCAGTTGTTGAATGG + Intergenic
959979984 3:112505126-112505148 ACAGTTTTACAATTGGGGTAAGG + Intergenic
960197292 3:114784707-114784729 ACATTCTTATTTTTGTAGTATGG - Intronic
960794652 3:121472815-121472837 ACATTTTTACAGATGTTTCAGGG - Intronic
962153544 3:132919058-132919080 ACATTTTTACCTTTGTTGTGAGG + Intergenic
962250055 3:133830562-133830584 ACATTTTTACAGGTGGAGATGGG - Intronic
962337867 3:134553250-134553272 CCATTTTTCCAGTTGAAATAAGG - Intronic
962412867 3:135156510-135156532 ACAGTTTTACATTTATAGAATGG + Intronic
963828030 3:149976369-149976391 ACATTTTGCTAGTTGTATTATGG + Intronic
963842833 3:150125338-150125360 AAATTATTACAGTTGCATTAAGG + Intergenic
965428558 3:168558611-168558633 ACCTCTTTACAGTTTTAGAAAGG + Intergenic
966407485 3:179612884-179612906 ACATTTCTGCAGGTGTAGTCAGG + Intronic
966705361 3:182907743-182907765 ACAATTTTATAGTTTTAGTCAGG - Intronic
967830672 3:193917095-193917117 ACATTTTTAGAGGTTTAGGAGGG + Intergenic
969290319 4:6234942-6234964 ACAATTTTACAGTAGCAGTCGGG + Intergenic
971528503 4:27653899-27653921 ACAATTTTACAGTGTTTGTATGG + Intergenic
972153907 4:36132489-36132511 ACATTTTTACATTTAAAATAGGG + Intronic
973217431 4:47685652-47685674 ACATTTTTACAGCTTTATTGAGG - Intronic
975619471 4:76281542-76281564 ACATTTTTACATATCTAATATGG - Intronic
977460560 4:97320123-97320145 ATATTTTTACAGTTATAGGGAGG - Intronic
978563429 4:110057422-110057444 ACATTTATGTAGTTGTAGTCAGG + Intronic
979447062 4:120826264-120826286 GCATCTTTGCAGTTGTACTAAGG - Intronic
979491800 4:121336858-121336880 ACACTTTTACAGGTGTGGTCTGG - Exonic
980051388 4:128043643-128043665 ATTTTTTTATAGTTTTAGTAGGG + Intergenic
980062197 4:128143116-128143138 TAATTTTTACATTTTTAGTAGGG - Intronic
981922816 4:150104508-150104530 ACATTTTTACATCTATAGTCTGG - Intronic
982584254 4:157217633-157217655 ACATTTTTACAGTCCCAGGAAGG + Intronic
983316645 4:166141197-166141219 ACATTTTAAAGGTTGCAGTAAGG + Intergenic
983490317 4:168381814-168381836 AGATTTTTTCTTTTGTAGTAAGG - Intronic
983802970 4:171959091-171959113 AACTTTTTATATTTGTAGTAAGG + Intronic
986194381 5:5524718-5524740 ACATTATTACATTTGTGGTTAGG + Intergenic
988360011 5:30225131-30225153 ACATTTTTACATTTGCATTTTGG + Intergenic
989602292 5:43211353-43211375 ACATTCTTACTCTTGTAGTGGGG + Intronic
989701968 5:44278836-44278858 AGATTTATACAGTTGAAATAAGG - Intergenic
990131664 5:52594135-52594157 ACATTTTTACAGCTTTTTTATGG - Intergenic
990254808 5:53956353-53956375 ACATTTTGACTTTTGTAATATGG - Intronic
991421940 5:66451173-66451195 ACATTTATTCAGTTGGAGTGGGG - Intergenic
993346514 5:86790150-86790172 TGATTTTTATACTTGTAGTATGG - Intergenic
993839603 5:92861519-92861541 AAAATTTTACATTTGCAGTAAGG + Intergenic
993854757 5:93059985-93060007 ACATTTTTAAAATTGTCATATGG - Intergenic
994278828 5:97875372-97875394 ACATTTTTACATTTGGGTTAAGG + Intergenic
994358520 5:98823059-98823081 ATATTTTTACAGTTCATGTAAGG - Intergenic
994705503 5:103200567-103200589 ACATTATTACATTTCTACTATGG - Intronic
995437599 5:112154931-112154953 ACATTTTTAAATTTGTTGTTAGG - Intronic
997290538 5:132730297-132730319 TCATTTTTGTAGTTTTAGTAGGG - Intronic
1000093274 5:157948748-157948770 ACATTTTTACATTTCAAGGATGG + Intergenic
1004344759 6:14838608-14838630 ACATTTTTGCAAGTGCAGTATGG - Intergenic
1004790262 6:19018031-19018053 ACTTTTTAAAAGTTGTAATAAGG - Intergenic
1007670470 6:43548686-43548708 ATCTTTTCACAGTTGTAGTATGG - Intronic
1008209390 6:48702314-48702336 TCATTTTTAGAGTTCTAGTTTGG - Intergenic
1008214835 6:48776451-48776473 ACATATTTACAGTTTTAAAAAGG + Intergenic
1008370665 6:50726833-50726855 ACATTTTTATTGTTGTATTTTGG + Intronic
1008943254 6:57070304-57070326 ACATTTTTTCATCTGTAGTTCGG + Intergenic
1010848618 6:80744275-80744297 ATATTTTTACAATTTTATTAAGG + Intergenic
1011034423 6:82957845-82957867 ACATTTTCATAGCTGTAGAATGG - Intronic
1011135859 6:84100024-84100046 AAATTTTTACATTTTTAGTAGGG + Intergenic
1011196722 6:84788199-84788221 ACATTTTTGCAGTTGTGACAAGG - Intergenic
1012815783 6:104019846-104019868 AAATTTATACAGTTTTAATATGG - Intergenic
1013883450 6:114933434-114933456 GCATTTTTATTGTTGTAGTTTGG + Intergenic
1013900196 6:115146352-115146374 TAATTTTTACAGTTGTGGTATGG - Intergenic
1017201813 6:151762795-151762817 TAATTTTTACAGTTTTAGTAGGG - Intronic
1017478817 6:154828673-154828695 CCATTTTTCCAGTTGGGGTATGG + Intronic
1017579074 6:155840990-155841012 ACAAATCTACAGTTGTAGTTAGG + Intergenic
1020968345 7:14901626-14901648 AGATTTTTACAGTGGTGGTGGGG - Intronic
1020974343 7:14986772-14986794 ACATCTTAACTGTTTTAGTAAGG + Intergenic
1024500968 7:50105541-50105563 ACATATTAACAGCTGTACTATGG + Intronic
1024591906 7:50893618-50893640 TTATTTTTACAGCTGTACTATGG + Intergenic
1026658931 7:72281790-72281812 AAATTTTTACAGTCATAATAAGG + Intronic
1027821882 7:83057046-83057068 GCATTTTTAAAGTAGTTGTATGG - Intronic
1028483086 7:91329381-91329403 TAATTTTTGTAGTTGTAGTAGGG + Intergenic
1031662761 7:124447017-124447039 AGATTTTAACAGTTGTCCTATGG + Intergenic
1032116332 7:129120910-129120932 ACATATTTAGAGTCGTGGTAGGG + Intergenic
1032244778 7:130201492-130201514 ACCTTTTTAGAGTTTTAGTGTGG - Intronic
1032814852 7:135462838-135462860 ACATTTTTAGAGTTTTAGAATGG - Intronic
1036069881 8:5429603-5429625 TCATTTTTACAGTTATAGAGAGG + Intergenic
1038551331 8:28471963-28471985 ACATTGTTACAGTTCTTGTATGG + Intronic
1038893257 8:31751618-31751640 ACATTATTATAGTTGTGGTGTGG + Intronic
1040753904 8:50746916-50746938 ACATCTTTAGACTTGTAGGATGG + Intronic
1041546045 8:59044125-59044147 ACAATTTCACAGTTTTATTATGG - Intronic
1043319854 8:78970895-78970917 ACATTTTAACTGTTTTAGTCAGG + Intergenic
1043746761 8:83882676-83882698 ACATTTTAACAGCTGTAAAAAGG - Intergenic
1044342413 8:91061830-91061852 ACATCTTTTCAGTTTTAGGAAGG - Intergenic
1046023272 8:108691752-108691774 AGTGTTCTACAGTTGTAGTAAGG + Intronic
1047672246 8:127160894-127160916 TCATTTCTAGAGTTGTAGTAAGG - Intergenic
1050216981 9:3337558-3337580 TCATGTTTACAGTGGCAGTAGGG + Intronic
1051023922 9:12582518-12582540 AAATATGTACAGCTGTAGTAAGG - Intergenic
1051123504 9:13777575-13777597 ACATCTTTACAGTTGGAGCTTGG - Intergenic
1052161101 9:25260923-25260945 ACATTCACTCAGTTGTAGTAAGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054752502 9:68922162-68922184 ACATTTTAAAAGATGTAGCAGGG + Intronic
1056365507 9:85900457-85900479 ACCTTTTAATACTTGTAGTATGG - Intergenic
1056457342 9:86773156-86773178 ACAATTTTAGAGTTGGAATATGG - Intergenic
1059937551 9:119326326-119326348 ACATTTTTACAGTTGATTTGTGG - Intronic
1060338165 9:122746992-122747014 ACATTTTTACAGTCTCAGGATGG - Intergenic
1060627771 9:125128894-125128916 AAATTTTTATATTTTTAGTAAGG - Intronic
1187263938 X:17713578-17713600 ACATTTTAACAGATGTATTTTGG + Intronic
1187781786 X:22835021-22835043 ATATTTTTAAAATTCTAGTAAGG - Intergenic
1190024031 X:46905502-46905524 ACATTTTACCACTTTTAGTAAGG - Intergenic
1191042112 X:56093534-56093556 TTATTTTTACATTTGTTGTAAGG - Intergenic
1192276655 X:69638456-69638478 CCATTTTCCCATTTGTAGTAAGG + Intronic
1193251826 X:79299611-79299633 ACATTTTTAGTGTTGTAGTTTGG - Intergenic
1193342081 X:80360466-80360488 ACATTTTGCCAGTTTGAGTATGG - Intronic
1193752842 X:85367739-85367761 ATATTTTTAAAGTTGGAGAATGG + Exonic
1195525001 X:105877437-105877459 TCATTTTGACAATTGTAGCATGG + Intronic
1196121478 X:112055862-112055884 ACAACTGCACAGTTGTAGTAAGG + Intronic
1197068043 X:122257692-122257714 AAATTTTTACAGCTTTATTAAGG + Intergenic
1197674907 X:129318681-129318703 ACAATTTTACAGATGTGGCATGG - Intergenic
1201315166 Y:12637788-12637810 ACATATTTACAGTTATAATTGGG - Intergenic
1201446513 Y:14062498-14062520 ATATTTCTACAGTAATAGTATGG - Intergenic
1201638072 Y:16147464-16147486 GCATTTTTACAGTAACAGTAGGG - Intergenic
1201863058 Y:18620814-18620836 TCATTTTTACAGCTGGAGCAAGG + Intergenic
1201870265 Y:18699564-18699586 TCATTTTTACAGCTGGAGCAAGG - Intergenic