ID: 1159548112

View in Genome Browser
Species Human (GRCh38)
Location 18:69866371-69866393
Sequence TTCTGGGTTTGCAGATAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 291}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159548112_1159548120 23 Left 1159548112 18:69866371-69866393 CCCTCTTATCTGCAAACCCAGAA 0: 1
1: 0
2: 0
3: 23
4: 291
Right 1159548120 18:69866417-69866439 AACACTAAGGGGCAGCAGCAAGG 0: 1
1: 0
2: 0
3: 20
4: 171
1159548112_1159548117 10 Left 1159548112 18:69866371-69866393 CCCTCTTATCTGCAAACCCAGAA 0: 1
1: 0
2: 0
3: 23
4: 291
Right 1159548117 18:69866404-69866426 AGTCTTTTAGTTAAACACTAAGG 0: 1
1: 0
2: 0
3: 12
4: 199
1159548112_1159548119 12 Left 1159548112 18:69866371-69866393 CCCTCTTATCTGCAAACCCAGAA 0: 1
1: 0
2: 0
3: 23
4: 291
Right 1159548119 18:69866406-69866428 TCTTTTAGTTAAACACTAAGGGG 0: 1
1: 1
2: 3
3: 39
4: 399
1159548112_1159548118 11 Left 1159548112 18:69866371-69866393 CCCTCTTATCTGCAAACCCAGAA 0: 1
1: 0
2: 0
3: 23
4: 291
Right 1159548118 18:69866405-69866427 GTCTTTTAGTTAAACACTAAGGG 0: 1
1: 0
2: 2
3: 7
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159548112 Original CRISPR TTCTGGGTTTGCAGATAAGA GGG (reversed) Intronic
900881380 1:5383493-5383515 TTCTGCGTTTGCAGAAGAGCTGG - Intergenic
903933828 1:26880771-26880793 TTCAAGGGTTGCAAATAAGATGG - Intronic
907764951 1:57400044-57400066 TGATGGATTTGGAGATAAGAGGG + Intronic
907898610 1:58717170-58717192 TTCTGTGTTTTCATTTAAGATGG + Intergenic
908489094 1:64625042-64625064 TTCTGGCTTTGCAGACCATAAGG - Intronic
908971768 1:69843928-69843950 ATTTGGGTTTGAAGATTAGATGG + Intronic
909342092 1:74543647-74543669 TTTTGGGTTTGGAGTAAAGAGGG - Intronic
909672208 1:78202368-78202390 TCCTGGCTTTGAAGATAGGAGGG - Intergenic
910028937 1:82692205-82692227 TTCTGGTTTTGCACATATGGTGG - Intergenic
910416062 1:87000042-87000064 TTCTGTGTTTTCAGTTAACAGGG + Intronic
910718161 1:90255602-90255624 TTTGGGGATTGCAGAAAAGATGG + Intergenic
910779625 1:90915074-90915096 TTCTAATTTTGCATATAAGATGG + Intergenic
911294350 1:96096131-96096153 TTCTGTGTTTGAAGATATGTGGG + Intergenic
912894431 1:113571824-113571846 TTCTCTGTTTGCAGATGACATGG - Intronic
913984269 1:143551102-143551124 CTCTGGGTTTGGAGTTAAGCTGG - Intergenic
914680910 1:149937658-149937680 TTCTAGGGTTGCAGATGGGAGGG - Intergenic
919297864 1:195723515-195723537 TTCTGGGATGCCAGATAAGTTGG - Intergenic
920124256 1:203681105-203681127 TTCTTGTTTCCCAGATAAGAAGG + Intronic
921410243 1:214828517-214828539 TTTTGGGTTTGTAGATGAGTGGG + Intergenic
921875656 1:220192659-220192681 TTCCCGGAATGCAGATAAGAGGG + Intronic
922678546 1:227569968-227569990 TTCTGGGCTTGCAGTAAAAAGGG + Intronic
923028797 1:230230195-230230217 TTCTGGGTTTGCAAAGCTGAGGG - Intronic
923080268 1:230646593-230646615 ACATGGGGTTGCAGATAAGAAGG - Intronic
924059379 1:240155723-240155745 TTCTAGTTTTGCAGATTAGATGG + Intronic
1062859863 10:802997-803019 CTCTGGGTTTACTGAGAAGAGGG + Intergenic
1064432201 10:15280777-15280799 TTCTGGTATTGCAGATAACTGGG - Intronic
1067189369 10:44056775-44056797 TTCTTTGTTTGCAGAGTAGAGGG + Intergenic
1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG + Intergenic
1067507677 10:46870504-46870526 TGGTGGGTTTGCTGAGAAGATGG + Intergenic
1067654578 10:48181341-48181363 TGGTGGGTTTGCTGAGAAGATGG - Intronic
1068945959 10:62729133-62729155 TGCTGGGCTTGCAGGGAAGATGG - Intergenic
1073631227 10:105151383-105151405 TTCTGGGTATGTAAATATGAGGG - Intronic
1073725835 10:106229471-106229493 ATTTGGGTTTCCAGATAAGCAGG + Intergenic
1073962425 10:108948227-108948249 ATCTCTGTTTGCAGATAATATGG - Intergenic
1074527162 10:114272724-114272746 TTCTGGGTGTGCACAGAGGAGGG + Exonic
1074560492 10:114531412-114531434 TTGTGAGTTTTCAGATGAGAAGG + Intronic
1074829146 10:117236446-117236468 TTCTTGGTTTGAACAAAAGATGG + Intergenic
1075440847 10:122478296-122478318 TTCTGGCATTGCAGAGAGGATGG + Intronic
1076192829 10:128494980-128495002 TTCTGGGTAAGCAGAGCAGAGGG - Intergenic
1077025700 11:438963-438985 CTCTGGGTTTGCAGATGGCAAGG - Intronic
1077561657 11:3266350-3266372 GTCTCTGTTTGCAGATAACATGG - Intergenic
1077567552 11:3312170-3312192 GTCTCTGTTTGCAGATAACATGG - Intergenic
1078407024 11:11079332-11079354 ATCTGGTTTTGCAGACAAGTTGG + Intergenic
1079777072 11:24544920-24544942 TGTTGGGTTTGCAGAGAAAAAGG - Intronic
1082735188 11:56847257-56847279 TTCTGGGCTTCCCGATCAGAGGG - Intergenic
1083706318 11:64518732-64518754 TTATGGGATTGCAAATAACATGG - Intergenic
1084376621 11:68782568-68782590 TTCTGTGTATTCAAATAAGACGG - Intronic
1085670755 11:78462710-78462732 TTCTGGATTTAGAGATGAGATGG + Intronic
1088781402 11:113137268-113137290 AGCTGGGTTTCCAGATAACATGG - Intronic
1089124836 11:116169565-116169587 AGCTGGGTTGGGAGATAAGAGGG - Intergenic
1091985442 12:4907545-4907567 ATATAGGTTTGCAGATAAGAAGG - Intergenic
1092048253 12:5448546-5448568 GTCTGGGTTTGACAATAAGAAGG - Intronic
1096099623 12:48961898-48961920 TTCTGGGTTTGGAAATTTGATGG - Intergenic
1096802449 12:54120114-54120136 TTTTGGGCTTGCAGAGAGGACGG - Intergenic
1101360314 12:104020264-104020286 TTCTGGGTCAGCAGAGCAGATGG + Intronic
1101556830 12:105817866-105817888 ATCAGGGTTTTCAGATGAGAAGG - Intergenic
1104426903 12:128685355-128685377 TTATGGGTTTGCAGGTAAGCGGG + Intronic
1105601864 13:21894690-21894712 TTCTGGGGCTGCAGATTAGCAGG + Intergenic
1107339296 13:39388980-39389002 TTCTGGGTGAGCTGATATGAGGG + Intronic
1107928579 13:45287678-45287700 TTCTTGGTTTGGAGGTGAGATGG - Intergenic
1108031315 13:46232418-46232440 TTTTGTGTTTGCACAAAAGATGG + Intronic
1108089841 13:46837495-46837517 TTCTGAGTGTGCTGATAATATGG - Intronic
1108181678 13:47846277-47846299 TTCAAGGTTTACAGATAAGGAGG - Intergenic
1109462776 13:62685003-62685025 TTATAGATTTTCAGATAAGAGGG + Intergenic
1109550035 13:63883509-63883531 TGCTGGGTTTGAAGATGAAAGGG + Intergenic
1111756200 13:92398835-92398857 TTCTGGGTATGTAGTCAAGAAGG - Intronic
1111870703 13:93828317-93828339 TTCTTGGTTTCCAGATCGGAAGG + Intronic
1112708550 13:102100439-102100461 TCCTGGCTTTGCAGAACAGAAGG + Intronic
1113056681 13:106275601-106275623 TTCTGGGTTAGGAGGCAAGAAGG - Intergenic
1114562117 14:23600795-23600817 TTTTTGGTTTGCAGATTAGGTGG + Intergenic
1115043217 14:28956457-28956479 ATGTGTGTTTGCACATAAGATGG - Intergenic
1115085137 14:29506578-29506600 TGCTGGTTTTGCAGCTCAGATGG - Intergenic
1115230677 14:31156969-31156991 TGCTGGCTTTGCAGATCATAAGG - Exonic
1117803859 14:59470059-59470081 TTTTTGGTTTTCAGAAAAGAAGG + Intronic
1118662336 14:68028423-68028445 TTCTGGGTTGGCATAAAAGCAGG - Intronic
1119752082 14:77086386-77086408 TTTTGGGTTTCTAGAAAAGAAGG - Intergenic
1120512075 14:85427122-85427144 ATCTGGGTTGGGAGAAAAGAGGG - Intergenic
1121044199 14:90776032-90776054 CTCTGTGTATGCAGAAAAGAAGG + Intronic
1122358435 14:101139100-101139122 ATCTCTGTTTGCAGATAACATGG - Intergenic
1122547515 14:102532253-102532275 TTCTGGGAATGCAGATAAAATGG - Intergenic
1124406913 15:29401098-29401120 CTCTGGGTTTGCAGGTCAGCTGG - Intronic
1125403390 15:39328084-39328106 TTCTGGGTCCTCAGAAAAGAAGG - Intergenic
1125825457 15:42672636-42672658 TTGTGTGTTTGCAGAGAGGAGGG + Intronic
1126187048 15:45840935-45840957 CTCTGGGCTTGTAAATAAGAAGG - Intergenic
1126465882 15:48961529-48961551 ATCTGGGTTGGCAGAAAGGAGGG - Intronic
1127103895 15:55592984-55593006 TTCTGGGGTTGCAGAGAAAAAGG - Intergenic
1128234177 15:66056240-66056262 TTCTGGGCCTGGAGAGAAGAGGG + Intronic
1128515893 15:68341749-68341771 TTCTGGCTCTGCAGATGACAGGG + Intronic
1130017993 15:80202094-80202116 TGCAGGGGTAGCAGATAAGAGGG - Intergenic
1131399695 15:92114439-92114461 TTCTGGCTTGGGAGATGAGAAGG + Intronic
1131534628 15:93225740-93225762 TTCTGGGTTCACAGATAAGTTGG + Intergenic
1134820425 16:17242327-17242349 TTCAGGTTTTGCAGAGTAGAAGG - Intronic
1139777148 16:69323640-69323662 TTGGGGGTGTGCAGCTAAGAAGG + Intronic
1140026658 16:71296965-71296987 TTCTGTCTTTGCAGATCATAAGG + Intergenic
1140825105 16:78699036-78699058 TTCTAGCTTTGCAGTTCAGATGG + Intronic
1142609041 17:1097998-1098020 TTCTGGATCTGAAGATGAGAGGG - Intronic
1142930201 17:3278029-3278051 TTCTGAGGCTGTAGATAAGAGGG + Exonic
1144097279 17:11911968-11911990 ATCTGAATTTGCAGATAACATGG - Intronic
1144501088 17:15786980-15787002 TTCTGGGTTGGAGGAGAAGAAGG - Intergenic
1145163255 17:20589654-20589676 TTCTGGGTTGGAGGAGAAGAAGG - Intergenic
1145201162 17:20946071-20946093 TTGTGAGTTTGCAGAGAAAAGGG - Intergenic
1145741774 17:27280843-27280865 TTCTGGATTTGCAGCGATGAGGG - Intergenic
1146840712 17:36152022-36152044 TTCTGTGTGAGCAGAAAAGAGGG + Intergenic
1153933591 18:9900901-9900923 TGCTGGGTGTGGAGATGAGATGG + Intergenic
1155284020 18:24270936-24270958 TTCTGGGTTTGGAGAGAGGGTGG - Intronic
1155772550 18:29720331-29720353 CTCTGGTTTTGTAGATGAGAGGG - Intergenic
1155788088 18:29927281-29927303 TTGTGGGTTTGGAGAGAAAAAGG + Intergenic
1156056172 18:33006716-33006738 CTCTGTCTTTGCAGATAAGAAGG + Intronic
1158046938 18:53167826-53167848 TACTGGGTTTGAAGACATGAGGG + Intronic
1158385190 18:56981529-56981551 TTCAGTGTTTAGAGATAAGATGG + Intronic
1158578154 18:58657729-58657751 TGCTGGGTTGGCAGAAATGAGGG + Intergenic
1158602936 18:58870559-58870581 TTCTGTGTAGGCAGAAAAGACGG + Intronic
1159548112 18:69866371-69866393 TTCTGGGTTTGCAGATAAGAGGG - Intronic
1160275746 18:77433285-77433307 TTTTGGGTTTGCAGGCCAGATGG - Intergenic
1160354113 18:78212272-78212294 GTCTGCATTTGCAGATAAGTTGG - Intergenic
1160396769 18:78578041-78578063 TCCTGGGTTTCCAGCTAAGAAGG - Intergenic
1162181102 19:8869358-8869380 TGCTGAGGTTGCAGATAAAAAGG + Intronic
1163499766 19:17669383-17669405 TTCTTGGGTTGCAGAGAACAGGG - Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164799579 19:31065194-31065216 TTCTGGTTTGGGAGACAAGAAGG + Intergenic
1164948110 19:32313080-32313102 TTGTGAGTTTGAGGATAAGACGG + Intergenic
1165889572 19:39102644-39102666 TAATGGGTTTGAAAATAAGAGGG - Intronic
1165981805 19:39730647-39730669 TTCTCGGTTTGCAAAGAGGATGG + Intergenic
1166236750 19:41462403-41462425 TGCTGGTTTTGCAGATCAGGTGG - Intergenic
1166434132 19:42752842-42752864 CCGTGTGTTTGCAGATAAGATGG - Intronic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
1167103201 19:47416664-47416686 TTCTGGGTTGGAGGAGAAGAGGG + Exonic
1167736110 19:51295536-51295558 ATCTGAGTTTGCAAATGAGAAGG - Intergenic
1167756026 19:51414507-51414529 CTCTCCGTGTGCAGATAAGAAGG - Exonic
1168138659 19:54369457-54369479 TTCTGGGTTTTTCCATAAGAAGG + Intronic
925384392 2:3452079-3452101 TCCTGAGGTTGCAGTTAAGATGG + Intronic
925524549 2:4785556-4785578 TTTTGGCTTTGAAGATAGGAGGG + Intergenic
927062403 2:19436211-19436233 TTCTGGGATTGGAGGTAAGGAGG - Intergenic
928042568 2:27892632-27892654 TTCCCAGTTTGCAGATAATATGG - Intronic
928847290 2:35692224-35692246 TTCAGGTTTTGCAGACAATATGG + Intergenic
929834553 2:45383184-45383206 TCCTGTGGTTTCAGATAAGATGG + Intergenic
930409469 2:51005894-51005916 GTGTGTATTTGCAGATAAGATGG - Intronic
930841368 2:55850405-55850427 TCCTGGGTTTACTGATCAGACGG - Intergenic
931190575 2:59996323-59996345 TTCTGACTTTGCAGATTTGAAGG - Intergenic
932281322 2:70494530-70494552 TTCTGGGTCAACAGATAAGCAGG + Intronic
936878532 2:117221507-117221529 TTGTGAGTTTGAAGATAAGGTGG + Intergenic
937009750 2:118551966-118551988 TTCTGGCTTTGCTCATCAGAAGG + Intergenic
937487813 2:122334227-122334249 TTCAGGGATTGCAGACAAGGAGG - Intergenic
937610253 2:123852702-123852724 TTGTGGGTTTGCAGAAATGAGGG + Intergenic
939167416 2:138654272-138654294 TGCTGGGTTTGCAGAAGAGGAGG + Intergenic
939574967 2:143884663-143884685 TACTGCTTTTGCTGATAAGAAGG + Intergenic
941112740 2:161434295-161434317 TTCTGGTGTTGGAGATAAGCAGG + Intronic
941809987 2:169745910-169745932 ATGTGGGTTTGCAGCTGAGAAGG + Intronic
942697841 2:178665847-178665869 TTCTGTATGTGCAGTTAAGATGG - Intronic
942855605 2:180543221-180543243 TTATGGGTGTTCAGATAAGAAGG + Intergenic
943520125 2:188938817-188938839 ATCTGGGTTGGCAGAGAAGGGGG - Intergenic
947893023 2:233643288-233643310 CTCTGTCTTTGCAAATAAGAGGG - Intronic
947969071 2:234306777-234306799 TGCTGGGTTTGCACCAAAGAAGG + Intergenic
1169355604 20:4902433-4902455 TTCTGGGGCTACAGGTAAGATGG - Exonic
1171023261 20:21606441-21606463 TTCTGGTTTTGAAAATCAGATGG - Intergenic
1172016194 20:31874856-31874878 TGCTGGGTTTGCAGATCGAAGGG + Intronic
1173253962 20:41380121-41380143 TCTTGGGTTTGCAGATTAAAAGG - Intergenic
1173854486 20:46241256-46241278 ATCTGGGTAGGCAGAGAAGAAGG + Exonic
1174904137 20:54532362-54532384 TTCTGTGTTTATAGAGAAGAAGG + Intronic
1175151477 20:56938315-56938337 TTCAGGCTTTGCAGGTCAGAAGG - Intergenic
1177040860 21:16108755-16108777 TTCAGGTTCTGCAGATAAGGAGG + Intergenic
1177388391 21:20435523-20435545 TTGTGTCTTTGCACATAAGATGG - Intergenic
1178515077 21:33239681-33239703 TTCTGGGTCTGCAGAATGGAGGG - Intronic
1182857949 22:33534702-33534724 TTCTGGGTTTGGGGAGAGGATGG + Intronic
1184452623 22:44591911-44591933 ATCTGGGTGTGCAGATGGGATGG + Intergenic
950034557 3:9876142-9876164 ACCTGGGATTGCAGATGAGAGGG + Intronic
950984959 3:17352738-17352760 TTCTGAGTTAGCATATAAAAGGG - Intronic
951403741 3:22268481-22268503 ATCTGGCTTTGCAGGTCAGAGGG + Intronic
953336956 3:42101590-42101612 TTTTAGGTTTGCAGGTCAGAAGG + Intronic
953543811 3:43845857-43845879 TTTTCGCTTTCCAGATAAGATGG - Intergenic
954015801 3:47689416-47689438 TTTTGGTTTTGCAGATGAGCAGG - Exonic
955419617 3:58723506-58723528 TTCTGAGTTTGAAAACAAGAAGG + Intronic
956934323 3:74082620-74082642 TCCTGGGATTCCAGATTAGAAGG - Intergenic
957962462 3:87275006-87275028 TTCTGTGTTTGAAGATAATTTGG - Intronic
960453243 3:117836998-117837020 TTTGGGCTTTGCAGATCAGATGG - Intergenic
960790445 3:121424466-121424488 TTCTGGCTTTGCAGTCAAGAAGG - Exonic
960887323 3:122409325-122409347 ATCTGAGTATGCAGATAAGTTGG + Intronic
961563979 3:127750237-127750259 TTCTGGGTTTGCTGTGGAGAAGG + Intronic
962901689 3:139767170-139767192 TTCTGGGTTTGCTGAGCTGATGG + Intergenic
965368014 3:167822972-167822994 TTCTCTTTTTGCAGATAATAAGG + Exonic
966217421 3:177517986-177518008 GCCTGGGTCTGCAGATTAGATGG + Intergenic
967061878 3:185879960-185879982 TGCTGTGTGTCCAGATAAGAAGG + Intergenic
968394654 4:223737-223759 CTCTGGGGTTGCAGAGAAGAAGG + Intergenic
968407002 4:349660-349682 CTCTGGGGTTGCAGAGAAGAAGG + Intronic
968413621 4:409338-409360 CTCTGCGGTTGCAGAGAAGAAGG + Intergenic
968419234 4:468689-468711 CTCTGGGGTTGCAGAGAAGAAGG - Intronic
969182782 4:5455083-5455105 TTCTGGGTGTGCACATCTGAGGG + Intronic
969909356 4:10429030-10429052 GTTTGGGTTTGAAGATCAGAAGG - Intergenic
970598315 4:17619772-17619794 ATCTGTGTTTGCATATGAGATGG - Intronic
971488103 4:27182139-27182161 TTCAGGGTTTGCAGTGAAAATGG - Intergenic
972937073 4:44149876-44149898 TACTGGTTTTGCAGAAAAGTTGG - Intergenic
972979254 4:44676543-44676565 TTGAGGCTTTGCTGATAAGAGGG - Intronic
977022670 4:91776035-91776057 TTGTGGGGTTGCAGATGTGAGGG + Intergenic
978060875 4:104336689-104336711 TTGTGAGATTGCAGAGAAGAGGG - Intergenic
979139429 4:117153276-117153298 GCCTGGGTATGCAGAAAAGAGGG + Intergenic
979847586 4:125535569-125535591 TTCTGGCCTTGAAGATTAGAGGG + Intergenic
979993873 4:127407961-127407983 TTCTGGTTTTGCAGCTCAGGGGG + Intergenic
980380717 4:132011569-132011591 TTCTGAGTTTGCTCACAAGATGG - Intergenic
982501844 4:156167538-156167560 TCGTGAGCTTGCAGATAAGATGG + Intergenic
982593666 4:157349913-157349935 TTCTGTGTTTGCAGATGATACGG - Intronic
983331604 4:166335788-166335810 TTCTGGGATTGCAGATGTGCTGG - Intergenic
983563281 4:169122979-169123001 ATCTGGGTTTATAGATCAGAAGG - Intronic
983602220 4:169543914-169543936 GTCTCTGTTTGCAGATAACATGG - Intronic
984042389 4:174751017-174751039 TTCTGGGTTAGCTGATATAAGGG - Intronic
984090752 4:175371768-175371790 TTTTGAATTTGAAGATAAGAAGG - Intergenic
984754005 4:183307922-183307944 GTCTTTGTTTGCACATAAGATGG + Intronic
985116836 4:186600018-186600040 TTCTGGGTTTGCTGTTTAAAGGG + Exonic
985681960 5:1260465-1260487 TTCTGGATTTGCAGGTGAGCAGG - Exonic
986042684 5:4008758-4008780 GCCTGGGATTGCAGATGAGAAGG - Intergenic
986085991 5:4447454-4447476 TACTGGGTTTGAAGATAAAAGGG + Intergenic
987298994 5:16580338-16580360 TTCTGTCTTTGTGGATAAGATGG - Intronic
987568971 5:19630498-19630520 TTTTGGTTTTGCTGCTAAGAAGG + Intronic
990064670 5:51697952-51697974 TTCTGGATATGCAGAAAAGAGGG - Intergenic
990908385 5:60827872-60827894 TTCTGGGTGTGCAGGAAGGATGG - Intronic
991911454 5:71566577-71566599 TTTTGGGTTTGCAGGCCAGATGG + Exonic
994150889 5:96446405-96446427 TTCTGTGTTTGCAGAAAGGAGGG + Intergenic
994151062 5:96448045-96448067 TTCTGGCTGTGCAGAGATGAGGG + Intergenic
995305104 5:110636872-110636894 ATCTGGCTTTGCAGATAACAGGG + Intronic
996022907 5:118611346-118611368 TTCTGGTCTTGCAGATATGCTGG + Intergenic
997033950 5:130164595-130164617 TTCTAGATTTTCAGAAAAGATGG - Intronic
997674600 5:135703408-135703430 TTCTGAGGTTGCAGATACCAAGG + Intergenic
999955319 5:156695014-156695036 TGATTGGTTTGCAGTTAAGAAGG - Intronic
1000026197 5:157361323-157361345 CTCTGGGCCTGCAGGTAAGAGGG + Intronic
1001467557 5:171981945-171981967 TTCTGGAATTTCATATAAGATGG - Intronic
1003122018 6:3326108-3326130 TTCTAGGTTTGCGGATGAGCAGG + Intronic
1003403505 6:5809913-5809935 TCCTGGGGTGGCAGATAAAATGG + Intergenic
1004017631 6:11746736-11746758 TACTAGGTTTCCAGACAAGAAGG + Intronic
1004770791 6:18778838-18778860 TTCTTTTTCTGCAGATAAGAAGG - Intergenic
1006628208 6:35412548-35412570 GTTTGGGTCTGCAGCTAAGATGG + Intronic
1008076338 6:47149748-47149770 TCTTGGGGCTGCAGATAAGAAGG + Intergenic
1008433215 6:51445272-51445294 TTCTCAGTCTGCAGTTAAGAGGG + Intergenic
1009342515 6:62573766-62573788 TTCTGGGATCTCAGATAACATGG + Intergenic
1010732781 6:79408883-79408905 TTCTCGGTTTGCAGAGCAGAGGG + Intergenic
1010928133 6:81768395-81768417 TTCTGTGATTGCAGATGAGTGGG + Intergenic
1010958300 6:82116769-82116791 TCCTGGGTCTTCATATAAGAAGG + Intergenic
1010986598 6:82432390-82432412 CTCTGGGTTTGATGGTAAGAAGG + Intergenic
1012914626 6:105156326-105156348 TTATTGATTTTCAGATAAGATGG - Intergenic
1014018553 6:116562827-116562849 TGCTGGCTTTGAAGATAAGGGGG + Intergenic
1014206772 6:118664633-118664655 TTCTGGGTTTTCAGAAAATGTGG + Intronic
1015191081 6:130473048-130473070 TGCTGGCTTTGAAGATAAGTGGG + Intergenic
1015834623 6:137406783-137406805 TTCTGAGGTTGCAGAGAAAAGGG - Intergenic
1017356014 6:153509966-153509988 TACTGTGTTTGCAAATCAGAAGG + Intergenic
1018364421 6:163103351-163103373 TGCTGGCTTTGAAGATGAGATGG - Intronic
1020052408 7:5090643-5090665 TTTTGGGTTTCTAAATAAGATGG - Intergenic
1020570683 7:9857172-9857194 TTTTGGGTTACCACATAAGATGG - Intergenic
1020828871 7:13067651-13067673 TTCTGGGTTTATAGATGAGGAGG - Intergenic
1021266337 7:18528447-18528469 TTCTGGGTTTTCAGACCAAATGG + Intronic
1022142844 7:27508181-27508203 TTTTGGGTTAGGAGAGAAGATGG - Intergenic
1022300206 7:29095823-29095845 TTCTGGGTTTGCAAAACAGTTGG - Intronic
1022641425 7:32188263-32188285 ACCTGGGTTTGCAGATTAAAAGG - Intronic
1023239609 7:38129609-38129631 TTAAGGGTTTACAGATAACAAGG + Intergenic
1023495656 7:40793181-40793203 CTCTGGGTTTGCAGAAGAGGTGG + Intronic
1023976842 7:45036824-45036846 TTCTGTGTTTGGTGATAAGGGGG + Intronic
1024795113 7:53010883-53010905 GTCTGTGTTTGCACATGAGATGG + Intergenic
1025799666 7:64774044-64774066 CTCTGGGGTTGCAGAGAATATGG + Intergenic
1026305088 7:69133755-69133777 TTCTGGTTTTGGGGAGAAGATGG - Intergenic
1027838539 7:83278300-83278322 TTCTGGCTATTCAGATCAGATGG + Intergenic
1028330395 7:89583921-89583943 TGCTGGTTTTGCAGCTTAGATGG - Intergenic
1028678008 7:93490466-93490488 GTCTGTGTTTGCAGACAACATGG + Intronic
1029041837 7:97584229-97584251 TTCTCCGTTTGCAGATGACATGG + Intergenic
1031550983 7:123111243-123111265 TGCTGGCTTTGAAGATAAAAGGG - Intergenic
1037500587 8:19481824-19481846 TTTTAGCTTTGCACATAAGATGG - Intronic
1038508504 8:28107543-28107565 TTCTGGGTAGGAAGATAAAAGGG + Intronic
1040122970 8:43702546-43702568 TTCTGGGCTGCCAGATGAGATGG - Intergenic
1043106094 8:76112192-76112214 TTCTGTGTTTGTAGATTAGAAGG + Intergenic
1043250960 8:78072339-78072361 TACTGGGTTTGGACAAAAGATGG - Intergenic
1043329504 8:79097654-79097676 TTCTGGGTTTGCATCTTAGATGG + Intergenic
1043702363 8:83305076-83305098 TTTTGGCTTTGCTGAAAAGATGG - Intergenic
1043714711 8:83467350-83467372 CTCTGGGATAGCAGAGAAGAAGG + Intergenic
1044400214 8:91761723-91761745 TTGAGTGTTTCCAGATAAGAAGG - Intergenic
1045814016 8:106258412-106258434 TGCTGGTTTTGCAGCTCAGATGG + Intergenic
1045877386 8:106998210-106998232 TTCAGAATTTGCAGCTAAGAAGG - Intergenic
1046338671 8:112824190-112824212 TTGTGTCTTTGCACATAAGATGG + Intronic
1049279051 8:141734938-141734960 TACTGGGCCTGGAGATAAGAAGG - Intergenic
1051158462 9:14177811-14177833 TTCTCTGTTTGCATATAACATGG - Intronic
1052241773 9:26281616-26281638 GTCTCTGTTTGCAGATAACATGG + Intergenic
1052516194 9:29482942-29482964 TTCTGCCCTTGCAGATCAGAAGG - Intergenic
1055747515 9:79466416-79466438 TTTTGGGTTAGAAGAAAAGAAGG - Intergenic
1057028747 9:91757229-91757251 GTGTGGGTTAGCAGATATGAAGG - Intronic
1058252246 9:102713425-102713447 TGCTGGTTTTGCAGCTCAGAGGG + Intergenic
1058621847 9:106891507-106891529 TTCTGCTTTTGAAGTTAAGATGG + Intronic
1058831067 9:108816738-108816760 TTCTAGGGTTGCAGTTAAGTTGG - Intergenic
1060600513 9:124874292-124874314 TTCTGGGTGTGAACACAAGAGGG + Intronic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1061472326 9:130836109-130836131 TTCGTGGTCTGTAGATAAGATGG - Intronic
1186575064 X:10756723-10756745 TACAGGTTTTGCAGAGAAGAGGG + Intronic
1188506138 X:30886988-30887010 TTCATGATTTGCAGAAAAGACGG - Intronic
1189157860 X:38777933-38777955 TTCAGGGTTTCCACAAAAGATGG + Intergenic
1189238099 X:39504071-39504093 TTCTGGCTTTGCAGGTAAGTAGG - Intergenic
1193194495 X:78615183-78615205 TTCTTTCTTTTCAGATAAGATGG + Intergenic
1195272849 X:103250457-103250479 ATGTGGGTTTTCAGATAGGAGGG + Intergenic
1195726707 X:107925143-107925165 TTTTGGATTTCCAGATAAAAGGG - Intronic
1197210391 X:123823586-123823608 TTCTCAGTGTGCAGATCAGATGG + Intergenic
1197259219 X:124299188-124299210 TACTGGGGTTGCAGAGAAAAGGG + Intronic
1197590203 X:128399961-128399983 GTCTCTGTTTGCAGATAACATGG + Intergenic
1198487957 X:137107299-137107321 TTCTGAGGTTGCAGAGAAAAAGG + Intergenic
1201986215 Y:19970310-19970332 TTGTGTCTTTGCACATAAGAAGG - Intergenic
1202132325 Y:21624469-21624491 TTATGGGTTTACAGAAATGAGGG - Intergenic
1202247405 Y:22833999-22834021 TTCTGGTTTTGCAGCTCAGGGGG - Intergenic
1202400393 Y:24467747-24467769 TTCTGGTTTTGCAGCTCAGGGGG - Intergenic
1202470387 Y:25202339-25202361 TTCTGGTTTTGCAGCTCAGGGGG + Intergenic