ID: 1159548152

View in Genome Browser
Species Human (GRCh38)
Location 18:69866784-69866806
Sequence GCCTTTAAGTCCAAGATAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159548145_1159548152 24 Left 1159548145 18:69866737-69866759 CCTTGTAATTAGCTAAGCTCAAA 0: 1
1: 0
2: 0
3: 12
4: 107
Right 1159548152 18:69866784-69866806 GCCTTTAAGTCCAAGATAACTGG 0: 1
1: 0
2: 1
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159548152 Original CRISPR GCCTTTAAGTCCAAGATAAC TGG Intronic
900736226 1:4301093-4301115 GCTTTTAAGTGCAAGAGAATGGG + Intergenic
909257557 1:73443852-73443874 GCTTTTATGTCCAAGGTAATGGG + Intergenic
916064850 1:161128108-161128130 ACCTTTAAGTCCTAGATCCCAGG + Intronic
918898894 1:190386297-190386319 TCCTTTAAGTCAAAGATATGGGG + Intronic
924753328 1:246918534-246918556 GCCTTTAAGTCCCAGCTACTTGG + Intronic
1073231158 10:101971443-101971465 GCCTTTAAGTCCCAGCTACTTGG + Intronic
1073852426 10:107636400-107636422 ACCATTAAGTCCAAGAAAACAGG + Intergenic
1078473733 11:11612600-11612622 GCCTTTAACTCCAAGTTCCCAGG + Intronic
1080608868 11:33886851-33886873 GCCTTTAAATCCATCACAACTGG + Intronic
1082853502 11:57786064-57786086 GCCATTAAGTCCTACATTACTGG - Intronic
1093393551 12:18652466-18652488 GGCTGTAAGTCCAAGATCAATGG - Intergenic
1096005819 12:48170401-48170423 GCCTTTAAGTCCCAGCTACTCGG + Intronic
1099147979 12:79071793-79071815 GGCCTTAAGTCCAACATAACTGG - Intronic
1100701018 12:97148292-97148314 GCTTTAAAGTCAAACATAACAGG + Intergenic
1101565353 12:105899708-105899730 GCCCTTAAGTCCAGCATACCTGG - Intergenic
1102288477 12:111679407-111679429 ACTTTTATGTCCAAGAAAACAGG + Intronic
1104583424 12:130028367-130028389 ATCTTTAAGTTGAAGATAACCGG + Intergenic
1105909277 13:24846381-24846403 GCCTCTAAGCCAAAAATAACTGG + Intronic
1107063278 13:36184856-36184878 GGCTTAAAGACCTAGATAACGGG - Intronic
1108360192 13:49662116-49662138 GCCTGTAAGTCCCAGCTATCGGG - Intronic
1109724182 13:66317449-66317471 CCCTTTAACTCCAAAATAGCTGG - Intronic
1110441711 13:75533441-75533463 GCCTTTAAGTCCCAGCTACTTGG + Intronic
1110493836 13:76141499-76141521 GCCTTTTACTCCAAGATAACAGG - Intergenic
1113334583 13:109365928-109365950 GGCTGAAAGTCCAAGATAAGGGG + Intergenic
1115668479 14:35581410-35581432 GCTTTTAAGTCCAACAGAAAGGG - Intronic
1117705295 14:58460828-58460850 GCCCTTAAATTCTAGATAACAGG - Intronic
1127028532 15:54835046-54835068 GGCTTTAAGTCCAAGGACACAGG - Intergenic
1127533795 15:59870683-59870705 GGCTTTAAGTCCAAGGTAGTTGG + Intergenic
1128540600 15:68527106-68527128 GCTGTTAAGTCCAAGATCAAGGG - Intergenic
1133035684 16:3032860-3032882 GCCTAAAAGTCCCAGAGAACTGG - Intronic
1133701245 16:8311209-8311231 GCATTTTATTCCAAGAGAACAGG - Intergenic
1138563771 16:57817644-57817666 GGCCTTAAGTCCAATATGACTGG - Intronic
1138646042 16:58425663-58425685 GCCTTTAAGTCCCAGCTACTTGG - Intergenic
1142360631 16:89624832-89624854 GCCCTTAAGACCCAGAAAACTGG - Intronic
1146760201 17:35470376-35470398 GCCTGTAAGTTCCAGATAACAGG + Intronic
1148946573 17:51267600-51267622 GACTTTAAGCCCAACTTAACAGG - Intronic
1148965217 17:51429338-51429360 GCCTGGAAGTCCAAGATTAAGGG + Intergenic
1150845210 17:68649984-68650006 GCCTGGAAGTCCAAGATCAAGGG - Intergenic
1155955646 18:31954630-31954652 GCCTTCAAGGCCAAGAGGACAGG + Intergenic
1157479876 18:48046924-48046946 GCCTTCAAGTCCAGGGTCACAGG - Intronic
1159548152 18:69866784-69866806 GCCTTTAAGTCCAAGATAACTGG + Intronic
1160308984 18:77770747-77770769 GATTATAAGTCTAAGATAACAGG + Intergenic
1162100872 19:8337917-8337939 GCCTTTGAGTCTAAGCAAACAGG + Intronic
1166024501 19:40068701-40068723 GCCTTTGAGACCAAGAAATCTGG - Intergenic
926836514 2:17029558-17029580 TCCTTTATGTCCAAAATGACTGG + Intergenic
927769411 2:25846082-25846104 GCCTTTAAGTCCAGGCTCAGGGG - Intronic
928279599 2:29933503-29933525 GCCTTTCTGTCCAAGAACACAGG + Intergenic
929413998 2:41728977-41728999 GCTTTCAAGTTCTAGATAACAGG - Intergenic
929584539 2:43105505-43105527 GGCTGGAAGTCCAAGATCACGGG - Intergenic
930169469 2:48236224-48236246 TGCTTTTAGACCAAGATAACAGG + Intergenic
931056419 2:58477340-58477362 GCTTTGAAGTCCAATATCACTGG - Intergenic
932861312 2:75294661-75294683 GCTTTGAAGTGCAAGAGAACTGG + Intergenic
934727814 2:96636265-96636287 GCCTTAAAGTGCAAAAGAACTGG + Intronic
937499180 2:122459922-122459944 GGCTTCAAGTGCAAGAAAACAGG - Intergenic
937580148 2:123475306-123475328 GCCTGTAAGTCCCAGCTAATCGG - Intergenic
939361814 2:141182554-141182576 AACTTTAAGTCCCAGATACCTGG + Intronic
942447767 2:176089493-176089515 GCCATTAAGGCCAGGATCACAGG - Intergenic
942849604 2:180468404-180468426 GGCTTTCAGTCCAAGAACACAGG - Intergenic
946484492 2:220088176-220088198 GGCTGGAAGTCCAAGATAAAGGG - Intergenic
1172980172 20:38935566-38935588 GCCTTTAAGTCCCAGTTACTCGG - Intronic
1173566633 20:44043672-44043694 GCATTTAATTCCAAAAAAACTGG - Intronic
1176418537 21:6495358-6495380 GGATCTAAGCCCAAGATAACAGG + Intergenic
1176427065 21:6554703-6554725 GCCTGGAAGTCCAAGATCGCAGG + Intergenic
1177734336 21:25070157-25070179 GCCTGGAAGTCCAAGATCAAGGG - Intergenic
1179694030 21:43103680-43103702 GGATCTAAGCCCAAGATAACAGG + Intronic
1179702556 21:43163025-43163047 GCCTGGAAGTCCAAGATCGCAGG + Intergenic
1181156380 22:20924060-20924082 GCCTTTAAGTCCCAGCTACTTGG + Intronic
1184640813 22:45869018-45869040 GGCTGCAAGTCCAAGACAACCGG - Intergenic
950066906 3:10119330-10119352 GCCTGTAATTCCAAGCTACCTGG + Intronic
953802725 3:46039003-46039025 GGCTTTGGGTCAAAGATAACTGG - Intergenic
954016322 3:47695206-47695228 GCCTGTAAGTCCTAGCTACCAGG + Intronic
956259392 3:67321716-67321738 GCCTTGGAGTCCAAGATGAGGGG - Intergenic
961888170 3:130110020-130110042 GGCTTTAAAGCCAAGAAAACAGG - Intronic
963940488 3:151091728-151091750 GCCTTGAAGGCCAAGGTAAAGGG - Intronic
964419573 3:156487145-156487167 ACCATTAAGTCCAATATAACTGG + Intronic
968290552 3:197535918-197535940 GCCTTTAAGTCCCAGCTACTTGG + Intronic
971530611 4:27683950-27683972 GCCTCAAACTCCCAGATAACTGG - Intergenic
972052029 4:34748635-34748657 GCCACTAAGTTCAAGGTAACTGG - Intergenic
972540072 4:40031443-40031465 GCCTTGAAGTCGAAGTGAACCGG - Intergenic
973344665 4:49041760-49041782 GCCTTTAAGTTCTAGTTAGCAGG + Intronic
978978166 4:114906788-114906810 ACCTTTAAGTCCAAGTTGATTGG - Intronic
979470575 4:121091551-121091573 GCCTGTAAGTCCCAGATAGTTGG + Intergenic
987250719 5:16098464-16098486 GCCTCAAAATACAAGATAACAGG + Intronic
988613728 5:32752882-32752904 CCCTTTTAGTCCAAGAAAATGGG - Intronic
993510330 5:88763267-88763289 GCCTGTAGATCCAAGATAAGGGG - Intronic
996640730 5:125749406-125749428 GGCTTCCAGTCTAAGATAACTGG - Intergenic
997865603 5:137460075-137460097 GCCTTGAAATCCAAGCTAAGAGG + Intronic
998599424 5:143569819-143569841 TCCTTCAAGGCCAAGAAAACAGG - Intergenic
999886325 5:155927345-155927367 GCCTTCCAATCAAAGATAACTGG + Intronic
1000021884 5:157325326-157325348 GCCTTTAAGTAAAAGAGAGCAGG + Intronic
1000509527 5:162164656-162164678 GGCTTTAATTTCAAGATAATGGG - Intergenic
1003180485 6:3787030-3787052 ACCTTTAAGCCCAGGATGACAGG - Intergenic
1004542900 6:16568798-16568820 GCCTTTGATTGCCAGATAACTGG - Intronic
1008638445 6:53436080-53436102 GTCTATAATTCCAAGTTAACTGG + Intergenic
1008838113 6:55862833-55862855 GCCTTTTAGTCCAAAAAGACTGG - Intronic
1016489072 6:144576246-144576268 GTATTTAAATCCAAGAGAACTGG - Intronic
1017787798 6:157770673-157770695 GCCTTTAAGTCCCAGCTACTTGG + Intronic
1019689445 7:2402412-2402434 GCCTGTAAGTCCCAGCTACCCGG + Intergenic
1020123050 7:5516338-5516360 GCCCTTAAATCCAACATGACTGG - Intergenic
1020474124 7:8575320-8575342 TCCTTTAAGTACAAGCTGACAGG + Intronic
1022680248 7:32538249-32538271 GCCCTTAACTCCAAGATTATAGG + Intronic
1033768775 7:144524555-144524577 GCCTTTATGTCCAAGATGAAAGG - Intronic
1035593414 8:835671-835693 GCATTTAATTCCAAGTTCACAGG - Intergenic
1036379927 8:8230034-8230056 GGCTTTAAAGCCAAGAAAACAGG + Intergenic
1043456534 8:80417708-80417730 GCCTGTAAGTCCCAGCTACCTGG + Intergenic
1045052916 8:98343106-98343128 GCCTTTAAGTCCCAGCTACTGGG + Intergenic
1050064717 9:1747540-1747562 GCCTTTGAGCCCAAGAAAACAGG + Intergenic
1051965352 9:22821879-22821901 GCCTTTTAATTCAAAATAACAGG + Intergenic
1061443105 9:130620249-130620271 GCCTTTAAACCCAAGTTAAGAGG + Intronic
1061583828 9:131554236-131554258 GCCTTTATGTCAAAGCTAATTGG - Intergenic
1186327879 X:8499411-8499433 GCATTTAAAACCAAGATAAGTGG + Intergenic
1187301748 X:18057667-18057689 GGCTTGAAGTCCAAGATCAATGG - Intergenic
1187915121 X:24146851-24146873 TCCTTTAAGTGCAAGATGTCTGG + Intergenic
1188101898 X:26098438-26098460 GCCTTGATGCCCAAGATAACTGG + Intergenic
1188395819 X:29682231-29682253 GCCTTTATCTTCTAGATAACAGG - Intronic
1193072242 X:77318550-77318572 GGGTTTAAATCCTAGATAACAGG + Intergenic
1196997938 X:121404506-121404528 ACCTGTAAGTCCAGGAGAACTGG + Intergenic
1197636377 X:128919366-128919388 GCCTTTAAGACCTTTATAACTGG - Intergenic
1197906984 X:131435651-131435673 GCCCTTAAGTCCAAGATCTTGGG + Intergenic
1199712348 X:150478409-150478431 ACCTGTAAGTCCAAGGTGACAGG - Intronic
1199858161 X:151777194-151777216 GCCTTTAGGTCCAAGAGCATTGG + Intergenic
1201434138 Y:13938635-13938657 GCATTTAAAACCAAGATAATTGG - Intergenic