ID: 1159548193

View in Genome Browser
Species Human (GRCh38)
Location 18:69867136-69867158
Sequence TTTTATATGAATATAAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1483
Summary {0: 1, 1: 0, 2: 9, 3: 117, 4: 1356}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159548193_1159548194 -7 Left 1159548193 18:69867136-69867158 CCTTTATTTATATTCATATAAAA 0: 1
1: 0
2: 9
3: 117
4: 1356
Right 1159548194 18:69867152-69867174 TATAAAAAACTTAGTTTCAAAGG 0: 1
1: 1
2: 5
3: 67
4: 610
1159548193_1159548195 -6 Left 1159548193 18:69867136-69867158 CCTTTATTTATATTCATATAAAA 0: 1
1: 0
2: 9
3: 117
4: 1356
Right 1159548195 18:69867153-69867175 ATAAAAAACTTAGTTTCAAAGGG 0: 1
1: 1
2: 6
3: 87
4: 936

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159548193 Original CRISPR TTTTATATGAATATAAATAA AGG (reversed) Intronic
900229645 1:1550200-1550222 ATATATATGTATATAAATCATGG + Intronic
901589505 1:10328405-10328427 TTTTCCATGAATAAACATAAAGG + Intronic
902729364 1:18358884-18358906 TAGTGTATGACTATAAATAAGGG - Intronic
903156965 1:21452217-21452239 TTTTATATGTATATAAAGGGAGG - Intronic
903309265 1:22440897-22440919 TTTTATATTAATGTTCATAATGG + Intergenic
904372109 1:30055505-30055527 ATCTATATCTATATAAATAATGG + Intergenic
904512411 1:31023237-31023259 TTTTATATTAATATACCTCAAGG + Intronic
904562733 1:31409710-31409732 TCTTATATGCATATTCATAAGGG + Exonic
905103569 1:35547002-35547024 TTATATACATATATAAATAATGG + Intronic
905180827 1:36165421-36165443 TTTTAAATAAAATTAAATAAAGG - Intronic
905209338 1:36362620-36362642 TTTTATATGAAGAAAAATACAGG - Intronic
905558839 1:38909867-38909889 GTTTTTATGAATATAAGTATGGG - Intronic
906088205 1:43154593-43154615 TTGAATATAAATATGAATAATGG + Intronic
906897425 1:49791233-49791255 TAGTATATTAATATAAATAGAGG + Intronic
906902347 1:49848793-49848815 TTTTATTTGAATAAATTTAAGGG - Intronic
906983228 1:50654131-50654153 TTTTATATTAAAATATATAGTGG + Intronic
907029420 1:51156013-51156035 TGTTATGTGAATATGTATAAGGG + Intergenic
907095103 1:51771326-51771348 TGGTATTTGTATATAAATAAAGG - Intronic
907127586 1:52065079-52065101 TTTTGTATGAAATTAAATGATGG + Intronic
907172500 1:52482257-52482279 TTGTATATGAGTATAGAAAAAGG - Intronic
907381010 1:54088838-54088860 TTTTAAAAGAAGAAAAATAAAGG + Intronic
907596966 1:55728906-55728928 TATTTTATATATATAAATAAAGG + Intergenic
907796882 1:57726674-57726696 TTTAATAAGAATAGAAATTAAGG - Intronic
907989176 1:59562669-59562691 TTTTGCAAGAATTTAAATAATGG - Intronic
907994901 1:59620183-59620205 TTTAATAAAAATATAAATGATGG - Intronic
908622342 1:65998171-65998193 TTTTATAGGAAAAGGAATAAAGG + Intronic
908634778 1:66150953-66150975 TTTTATATCAATATTCATACTGG + Intronic
908880629 1:68727724-68727746 TTTAATATTAATACACATAATGG + Intergenic
909184270 1:72465923-72465945 TTCATTCTGAATATAAATAATGG - Intergenic
909224708 1:73004574-73004596 TTTTATATGCATTTAAAACACGG - Intergenic
909266932 1:73571593-73571615 GTATATACTAATATAAATAAAGG + Intergenic
909407154 1:75304040-75304062 TACTATATGCATACAAATAAAGG + Intronic
909419105 1:75443471-75443493 TTTTATAAGTTTATAAATATTGG - Intronic
909461601 1:75921626-75921648 CATTATAAAAATATAAATAAAGG - Intronic
909644487 1:77901348-77901370 ATTTTTATGTTTATAAATAATGG + Intronic
909741156 1:79031185-79031207 TTTTATATGAATATTGAGAATGG + Intergenic
909834425 1:80235551-80235573 ATATATATGTATATAATTAAAGG - Intergenic
909839244 1:80297715-80297737 CTTAATATTAATATAAATGAGGG + Intergenic
909872634 1:80762434-80762456 GTTTATATCTATATAAAGAAAGG - Intergenic
909888672 1:80974856-80974878 TTTTAAATGAAAAAACATAAGGG - Intergenic
909889445 1:80985418-80985440 TTTTCTGTGAGTCTAAATAATGG + Intergenic
910235471 1:85031358-85031380 TTATATTTCAATATAAATAGAGG + Intronic
910258150 1:85270136-85270158 TATTAAATGAATACAAATACAGG + Intronic
910340213 1:86178442-86178464 ATTCATAAGAATATAAATACAGG - Intergenic
910553674 1:88505438-88505460 TTTTAGATGAATATAGTTACTGG - Intergenic
910558424 1:88563114-88563136 GATTATAAGAATATGAATAACGG - Intergenic
910651928 1:89578067-89578089 GTTTATATGCATAGAAATTAAGG - Intronic
910830743 1:91460651-91460673 ATTTATATATATATATATAAAGG + Intergenic
911241027 1:95466865-95466887 TTTTGCATCAATATTAATAAGGG + Intergenic
911328785 1:96501349-96501371 GCATGTATGAATATAAATAAGGG - Intergenic
911330053 1:96516667-96516689 TATTATATACATATAAATATGGG - Intergenic
911540223 1:99148589-99148611 ATTTATATGTTTAAAAATAAAGG + Intergenic
911737061 1:101349202-101349224 TGTTATATGAACATAAGAAAGGG - Intergenic
911818607 1:102386817-102386839 CTTTAAATAAATATAAAAAAGGG + Intergenic
911879494 1:103217288-103217310 TTTTATAAGAATATAAGTGGAGG + Intergenic
911907258 1:103586394-103586416 TTCTATAGTAATATTAATAAAGG - Intergenic
912009526 1:104941514-104941536 TTGTATATGTATATATATGAAGG + Intergenic
912078000 1:105901665-105901687 TTTTAGATGAATAGAATAAATGG + Intergenic
912082904 1:105959250-105959272 TTTTAAATAAATACAAAAAAAGG - Intergenic
912250100 1:108002507-108002529 TGTTATATTAATATAAATCATGG + Intergenic
912408608 1:109464315-109464337 TTTTCTATGTATATAACTATAGG - Intergenic
912835318 1:112991261-112991283 TATTTTATTAATACAAATAAAGG + Intergenic
912947063 1:114094183-114094205 TTTCCTATGAAGATAAACAAAGG + Intronic
913033905 1:114941277-114941299 TTTTACATGTTTATATATAATGG + Intronic
913267049 1:117055450-117055472 TTTTGTTTGAAGATATATAATGG - Intergenic
913424692 1:118714134-118714156 ATATATATGCATATATATAAGGG + Intergenic
913534812 1:119761217-119761239 TTTTATATACATAAAATTAAGGG + Intronic
914197757 1:145458479-145458501 TTTTATAGAAATATAAAATATGG + Intergenic
914298752 1:146358314-146358336 TTTCATAGGAATATAAACTAGGG - Intergenic
914476861 1:148031590-148031612 TTTTATAGAAATATAAAATATGG + Intergenic
915060704 1:153181779-153181801 TATTATATATATATATATAATGG - Intergenic
915303140 1:154962801-154962823 TTTTATATGCATATATTTTAGGG - Exonic
915687046 1:157644152-157644174 TTTTAAATGAATTTTAAAAATGG + Intergenic
915749411 1:158192133-158192155 TTTCATATTAATTTAAATTATGG - Intergenic
916022057 1:160801725-160801747 TTTTATATGATGAGAAATAGGGG + Intronic
916062451 1:161109349-161109371 TTTTATATGAGCACATATAAAGG - Intronic
916305656 1:163328019-163328041 TTTTAAATGAATTTTAAAAATGG - Intronic
916327960 1:163584294-163584316 AAATATATGCATATAAATAAAGG + Intergenic
916356981 1:163922629-163922651 TTATATATATATATATATAATGG + Intergenic
916778219 1:167992315-167992337 TTTTATATTGTTAAAAATAAAGG + Intronic
916790214 1:168118594-168118616 TTTTATGTGTATATATTTAAGGG - Intronic
916857664 1:168767527-168767549 TTTACTATCAATAAAAATAATGG + Intergenic
916902329 1:169241905-169241927 TTTTATATTTATATTTATAAGGG - Intronic
917033167 1:170717532-170717554 CTCTATATGATTAAAAATAATGG + Intronic
917729880 1:177864086-177864108 TTTTATATAAATAAATAGAAAGG - Intergenic
917823646 1:178793241-178793263 TTTTTTTTAAATCTAAATAAAGG + Intronic
917838684 1:178960262-178960284 TTTTAGATTAAAATAAAGAATGG + Intergenic
917897991 1:179511251-179511273 TTATATATGTATATATATGATGG - Intronic
917924657 1:179779182-179779204 TTTTCTAATAATATAAATATTGG - Intronic
918000120 1:180485894-180485916 GTTTATACCAATATAAATACAGG + Intronic
918335419 1:183506213-183506235 TTTTTAAAGAATATAAATTATGG + Intronic
918948511 1:191103020-191103042 TATTATATGAAAATCAATATTGG - Intergenic
919021830 1:192115608-192115630 CTTTAAAATAATATAAATAAAGG + Intergenic
919185580 1:194143572-194143594 TTTTACATGTATATACATCAGGG + Intergenic
919202597 1:194375981-194376003 TTTTTTATGGCAATAAATAATGG - Intergenic
919217915 1:194584040-194584062 TTTTATTTGATTATACATATAGG - Intergenic
919218757 1:194597316-194597338 TTTTATATGCATCAAAAGAATGG + Intergenic
919354449 1:196503236-196503258 TTTTGTGTGTTTATAAATAATGG - Intronic
919374977 1:196783223-196783245 TTTTGTATCAATATTAATCAAGG + Intronic
919441523 1:197639577-197639599 TTTTAGAGGAATATATGTAAAGG - Intronic
919492600 1:198224648-198224670 TTTTATATATATATATAAAATGG + Intronic
919520249 1:198579876-198579898 TTTTATCTGAATAAAAAAATGGG - Intergenic
919567847 1:199211050-199211072 TTTAACAGGAATATAAATTATGG - Intergenic
919600269 1:199613719-199613741 TTTTAAGTGAACATAAAAAAAGG - Intergenic
920025896 1:202995753-202995775 TTTTATATGAATGTTCAAAAGGG - Intergenic
921114497 1:212075519-212075541 ATTTATTTGAATAAAAATGAAGG + Intronic
921454533 1:215352587-215352609 TTTTATTTGAAGATACCTAAGGG + Intergenic
921664681 1:217854471-217854493 TTTTATTTAAATAGAAATACAGG - Intronic
921875371 1:220189550-220189572 TTCTATCTGAAAATAAAGAAAGG + Intronic
921980039 1:221246957-221246979 TTTAATATGAATAAAAGTTATGG - Intergenic
922052284 1:222004269-222004291 TTTTATATTAAAAAAAGTAATGG - Intergenic
922283633 1:224149093-224149115 TATTATATGTTTATAAATACTGG - Intronic
922382339 1:225043465-225043487 TTTGAGATGAAAATGAATAATGG - Intronic
922439682 1:225643513-225643535 TTTTATAATAACAAAAATAATGG + Intronic
922938912 1:229444023-229444045 TTTTATTTAAATAAAAATATAGG - Intronic
923048399 1:230372361-230372383 TTTTGTATGAAGATCAAGAACGG - Intronic
923422720 1:233834763-233834785 ATTCATATAAATATATATAATGG - Intergenic
923812022 1:237329333-237329355 TTTTTTTTAAATATAAAAAAAGG - Intronic
923937263 1:238777013-238777035 TTTTAGATTATTATAAATATAGG - Intergenic
924401496 1:243687254-243687276 TTTTATCAGAATATAAGGAATGG - Intronic
924453010 1:244196295-244196317 TTTTAAATGAAACTAACTAATGG + Intergenic
924503436 1:244658103-244658125 TATTATATGAATAGAGATGAGGG - Intronic
1062782430 10:226538-226560 ATTTATCTGAATTTAAATAGGGG - Intronic
1063011090 10:2022419-2022441 TTTTACATGTTTAAAAATAAGGG - Intergenic
1063399607 10:5729844-5729866 TTTTTTTTGAAAATGAATAAAGG - Intronic
1063760909 10:9074979-9075001 TTTTATTTAAATATAAAGCATGG - Intergenic
1063813490 10:9742836-9742858 TTTTATATAGAGAGAAATAATGG + Intergenic
1064081318 10:12310299-12310321 TTTAATAAGTAAATAAATAAGGG - Intergenic
1064393887 10:14964542-14964564 TCTTATATACATATATATAAAGG - Intronic
1064669598 10:17697468-17697490 TTTTATATGATTAGTAAAAATGG - Intronic
1064840696 10:19588031-19588053 TTTTATGTGATTTTACATAAAGG - Intronic
1064866743 10:19889201-19889223 TTTTATATATATATATAAAATGG - Intronic
1064956075 10:20911655-20911677 TTTTATATGTACATAAAATAGGG + Intronic
1064990246 10:21250492-21250514 ATGTATATGTATATATATAAAGG - Intergenic
1065397399 10:25253683-25253705 ATATATATATATATAAATAACGG - Intronic
1065415014 10:25474869-25474891 TGCTAAATAAATATAAATAAGGG - Intronic
1065426264 10:25607310-25607332 TTTTATATATATATAATCAAGGG - Intergenic
1065565538 10:27004147-27004169 TTCTAGATGAATATGAATATAGG - Intronic
1065587718 10:27236278-27236300 TTGTAGAAAAATATAAATAATGG + Intronic
1065675597 10:28170162-28170184 ATATATATGTATATACATAAAGG - Intronic
1066347680 10:34604563-34604585 CTTTATATATATATAAATAAAGG - Intronic
1066363787 10:34756459-34756481 TTTTATAAGAAAAAAAAAAAAGG - Intronic
1066706271 10:38182344-38182366 TTTAATTTCAATATAATTAATGG + Intergenic
1066983683 10:42443762-42443784 TTTAATTTCAATATAATTAATGG - Intergenic
1068176786 10:53470613-53470635 TTTAATATAAATATATATATAGG - Intergenic
1068291546 10:55007819-55007841 TGGTATAAAAATATAAATAAGGG + Intronic
1068292654 10:55024287-55024309 ATATATATGAATATATATATGGG + Intronic
1068364457 10:56027788-56027810 TTTTATATGAATTTACTTAGTGG - Intergenic
1068539914 10:58280649-58280671 TTTGATATGGATAAAAATCAAGG + Intronic
1068600352 10:58950229-58950251 TTATATATATATATATATAATGG + Intergenic
1069267320 10:66476967-66476989 TTAAATATTAACATAAATAATGG - Intronic
1069282742 10:66676053-66676075 TTTTCTGTTAACATAAATAATGG + Intronic
1069285694 10:66712512-66712534 TTTTTTCTGAATATAAAATATGG + Intronic
1069896213 10:71681783-71681805 TTTTAAATGAAAATAAATAAAGG + Intronic
1070184743 10:74050435-74050457 TTGTGCATGAATATAAATTATGG - Intronic
1071030571 10:81175099-81175121 TGTTATAAGAATATTAGTAAAGG + Intergenic
1071034554 10:81228723-81228745 TTTTATGTGATTTTAAATCAAGG + Intergenic
1071104347 10:82077329-82077351 TTTAAAATGAATTTAATTAAGGG - Intronic
1071171901 10:82876435-82876457 ATTTTTATGAATTGAAATAAGGG + Intronic
1071976031 10:90956282-90956304 ATGTATATGTATATATATAATGG + Intergenic
1072093659 10:92154899-92154921 TTTTCTAGGAACAGAAATAAAGG - Intronic
1072193679 10:93096851-93096873 TTTTATATAAATGGAAAAAAAGG + Intergenic
1072231848 10:93420485-93420507 TTTTATATGAAGATGACAAAAGG - Intronic
1072398848 10:95075383-95075405 TTGTATATGATTATAGATAGAGG + Intergenic
1072422614 10:95301817-95301839 ATATATATGTATATAAATAATGG - Intergenic
1072602718 10:96944707-96944729 TTTTATATTAATTAAAATTAGGG + Intronic
1072697593 10:97615420-97615442 TTTTATAATAATAAAATTAAAGG + Exonic
1072936592 10:99719167-99719189 TTTTCTTTGATAATAAATAATGG - Intronic
1072976646 10:100064707-100064729 TTTTATATTAATATATAAAATGG - Intronic
1073273366 10:102286685-102286707 ATTTGTATGAATAAAAATGAAGG - Intronic
1073335206 10:102702275-102702297 TTTTCTATGCATATATATGATGG - Intronic
1073658374 10:105443546-105443568 TTATATCAAAATATAAATAATGG - Intergenic
1073740914 10:106405959-106405981 TTTCAGATGAAGATAAAGAATGG + Intergenic
1073874905 10:107911545-107911567 TAGTAAATGAATTTAAATAATGG + Intergenic
1074175310 10:110994693-110994715 ATTTATATGTATAAAAATACAGG - Intronic
1074731839 10:116386540-116386562 TTTTATATTTACATAAATGAAGG - Intergenic
1074821948 10:117186280-117186302 TGTAATATTAATAGAAATAAAGG + Intergenic
1074840186 10:117343786-117343808 TTTTAAATGAATATACTAAACGG + Intronic
1075224564 10:120615193-120615215 TTTCATATAAATACAATTAAAGG + Intergenic
1075352435 10:121735685-121735707 TTGTTCATGAATATGAATAATGG + Intergenic
1075525306 10:123179626-123179648 TATTATTTGAAAACAAATAATGG - Intergenic
1076178956 10:128391124-128391146 TTTAATATGAGTATATGTAAGGG + Intergenic
1076814366 10:132907528-132907550 TTAAATTTGAAAATAAATAAGGG - Intronic
1077956295 11:7023215-7023237 TTTTATATGTGTATATAAAATGG - Intronic
1077968475 11:7161568-7161590 ATGTATATGTATATAAATATAGG - Intergenic
1078606366 11:12779654-12779676 TTTTATATCTATATTCATAAGGG - Intronic
1078777174 11:14404226-14404248 ATTTATATAAATATATATACTGG - Intergenic
1078956239 11:16198473-16198495 TTTCAGATCAATAAAAATAAGGG + Intronic
1079367754 11:19824084-19824106 ATTCATTTGAATATTAATAATGG + Intronic
1079405727 11:20144033-20144055 GTATAAATGAATAAAAATAATGG - Intergenic
1079631246 11:22678821-22678843 TGTTATATGAATATGAACACTGG - Intronic
1079920704 11:26430711-26430733 TTTTATATTATGCTAAATAATGG - Intronic
1080225835 11:29959091-29959113 TTTTAAATGGAAATAAACAAGGG - Intergenic
1080259582 11:30333132-30333154 TTTTATATGAATAAAAACAAAGG - Intronic
1080332436 11:31154691-31154713 CAATATATAAATATAAATAAAGG + Intronic
1080509108 11:32949395-32949417 TTTTATATCAATAAAAGTGAAGG + Intronic
1080549930 11:33364235-33364257 AATTACATGAATATAAAGAATGG + Intergenic
1081025738 11:38012272-38012294 TTTTAGATGAATAAATATTAAGG + Intergenic
1081507058 11:43728915-43728937 TATAATATAGATATAAATAAGGG + Intronic
1081844935 11:46233737-46233759 TATTCTATGGATATACATAAAGG - Intergenic
1082160545 11:48883963-48883985 TTATATATAAATATAGTTAAAGG + Intergenic
1082161821 11:48896443-48896465 TTATATATAAATATAGTTAAAGG - Intergenic
1082167406 11:48964889-48964911 TTATATATAAATATAGTTAAAGG - Intergenic
1082236159 11:49821771-49821793 TTATATATAAATATAGTTAAAGG + Intergenic
1082242538 11:49888034-49888056 TTATATATAAATATAGTTAAAGG - Intergenic
1082657024 11:55868837-55868859 TTATATATAAATATAGTTAAAGG - Intergenic
1082909715 11:58357024-58357046 TTTAATCTGAATATCAATTAGGG + Intergenic
1083056288 11:59824003-59824025 TTTCATATGATTATAATTAGAGG - Intergenic
1084228230 11:67731155-67731177 CTTAATATGAATATTAATATCGG + Intergenic
1084843559 11:71879545-71879567 ATTTATAATTATATAAATAAGGG - Intronic
1084988562 11:72901027-72901049 TTTTTTAAAAATTTAAATAATGG + Intronic
1085246967 11:75109491-75109513 TTTTATTTGAAATTATATAATGG - Intronic
1085631895 11:78125396-78125418 TTTTATATGTATATATAAAATGG - Intronic
1085758395 11:79220466-79220488 TTAAATAGGAATAAAAATAATGG + Intronic
1086486622 11:87310212-87310234 TTTTATAGGAACATACAGAATGG - Intronic
1086751542 11:90501036-90501058 TTTGCTATGATGATAAATAAAGG + Intergenic
1086758532 11:90596349-90596371 TTTTATTTAAGTAAAAATAAAGG + Intergenic
1086790580 11:91033143-91033165 ATTTATTTAAATATAATTAATGG + Intergenic
1087489765 11:98810136-98810158 TTTTATATGATTAAGAATATGGG + Intergenic
1087822328 11:102726514-102726536 ATTTATATTAATACAAAGAATGG - Intronic
1088048743 11:105484637-105484659 CTTTATATGAATTTCAACAAAGG + Intergenic
1088115966 11:106314553-106314575 TTTTACATGATTATAAATACTGG + Intergenic
1088314558 11:108494810-108494832 TTGTAGATGAAAAGAAATAAGGG - Intronic
1088498245 11:110454709-110454731 ATATATATGAATATATATACTGG - Intronic
1088511805 11:110583270-110583292 TTTTAAATGAAAAGAAAAAAAGG - Intronic
1088516141 11:110636334-110636356 ATTTAAATGTTTATAAATAAAGG + Intronic
1088671038 11:112140870-112140892 TTTTATTTGGAAATAATTAAGGG + Intronic
1088826877 11:113503375-113503397 TTTTATAAAAATAAAAATACCGG + Intergenic
1088973933 11:114798086-114798108 TTAGATATATATATAAATAAGGG - Intergenic
1089015848 11:115164626-115164648 CTTTATAAAAAAATAAATAAAGG - Intergenic
1089883013 11:121793012-121793034 TTTTAAATGAAAAAAAAAAAAGG + Intergenic
1090526335 11:127542441-127542463 TTTAATATGTTTATAAATTAAGG + Intergenic
1090541020 11:127705545-127705567 TGTTATATGTATATAAATTAAGG + Intergenic
1090714110 11:129415063-129415085 TTTTATTTTAATATAAAAATTGG + Intronic
1090784228 11:130034697-130034719 GTCTATATGTATATAATTAAAGG + Intergenic
1090894542 11:130958948-130958970 TTTTTTATATATATATATAATGG - Intergenic
1091039828 11:132266489-132266511 TTTTACATGAATATAACTCTAGG + Intronic
1091322207 11:134659726-134659748 TTTAAAATGAATCTAAATAAGGG + Intergenic
1091423402 12:363959-363981 TTTAATATGAATATGAAAATAGG + Intronic
1091924017 12:4329217-4329239 TTATTTGTTAATATAAATAATGG + Intronic
1091929952 12:4387987-4388009 TTTTATATAATTAAAACTAATGG + Intergenic
1092585431 12:9896401-9896423 TTTTATTTGAATACATTTAAAGG - Intergenic
1093646942 12:21597026-21597048 TTTTATATGGCAATAAATAGGGG - Intronic
1093705607 12:22271950-22271972 TATCATATGAATAAAAATAATGG - Intronic
1093823827 12:23656764-23656786 TTTTATATAAATATATATAATGG + Intronic
1093874334 12:24331124-24331146 TTTTACATGAGGATAAATATGGG - Intergenic
1094073193 12:26442311-26442333 TGTTATAAGTATATAAACAAAGG - Intronic
1094228292 12:28072390-28072412 TTTTATATGATGAAAGATAAAGG - Intergenic
1094283676 12:28768692-28768714 TATTAGATGACTATCAATAAAGG - Intergenic
1094417378 12:30231657-30231679 TATTATGTGAAATTAAATAAAGG + Intergenic
1094667158 12:32531699-32531721 TTTTGGATGATTATGAATAAAGG + Intronic
1095267085 12:40173283-40173305 TATTATATGAATTACAATAATGG + Intergenic
1095521313 12:43069908-43069930 TTTGCTATGATTATAAAGAAGGG + Intergenic
1095569426 12:43666736-43666758 TTTTAAAAGAATATAAAGTATGG + Intergenic
1095582592 12:43817065-43817087 ATTTAAATGAATCTAAATACTGG + Intergenic
1095645147 12:44535140-44535162 GTTTATATGAAAATACATTATGG - Intronic
1095755040 12:45755616-45755638 TTTTACATGATTATGAACAATGG - Intronic
1095786632 12:46116755-46116777 TTATATAAAAATATATATAATGG - Intergenic
1096118959 12:49074172-49074194 TATAATAATAATATAAATAAAGG + Intergenic
1096297268 12:50394255-50394277 TTTTAAAAGAATATATAAAATGG + Intronic
1097110425 12:56653972-56653994 TCTTATATGGTTATAGATAAGGG + Intergenic
1097296525 12:57970729-57970751 GTATATATGTATATATATAATGG - Intergenic
1097652015 12:62310589-62310611 TTGTATATATATATAAACAATGG - Intronic
1097658176 12:62395156-62395178 ATTTATATGAAGAAAAATACAGG - Intronic
1097869854 12:64592399-64592421 TTTTTTGTTACTATAAATAATGG + Intergenic
1098031888 12:66263768-66263790 CTTTATATGAATAGAAATACAGG - Intergenic
1098064406 12:66597781-66597803 TTTTATCTGACTAGGAATAAAGG + Intronic
1098162673 12:67660908-67660930 TTTTATAGGGAAATTAATAATGG - Exonic
1098319300 12:69225084-69225106 TTTTAAATGAATACAAAATAAGG + Intergenic
1098566586 12:71944115-71944137 TTTTTTATTAATGGAAATAATGG + Intronic
1098682818 12:73379399-73379421 TTTTATATATAAATAAACAAAGG - Intergenic
1098795527 12:74883704-74883726 ATATATATGTATATATATAATGG - Intergenic
1098836798 12:75433514-75433536 TTATATATATATATATATAATGG + Intergenic
1098866058 12:75765157-75765179 TTTTATATTTATATGAATTAAGG + Intergenic
1099062447 12:77928727-77928749 TTTTAGATGAACAGAAATACAGG - Intronic
1099149664 12:79094636-79094658 TTTTCTATTAATATTGATAAAGG - Intronic
1099327981 12:81243936-81243958 ATTTGTATAAATAAAAATAAAGG - Intronic
1099545927 12:83979619-83979641 TATCATGTGGATATAAATAATGG + Intergenic
1099556422 12:84113786-84113808 TTTTATGTTAATATAAAAATAGG - Intergenic
1099561159 12:84175106-84175128 TTTTAAATGAAAATACATGATGG - Intergenic
1099583110 12:84478708-84478730 TTGTATATGATGATAAATAGTGG - Intergenic
1099598314 12:84697967-84697989 AGTTATATGACTATTAATAAAGG - Intergenic
1099679621 12:85808795-85808817 TTTTATTTTAAAATAAATAATGG + Intronic
1100033013 12:90215911-90215933 TTTTTTATGAATATTTGTAAAGG - Intergenic
1100033629 12:90223823-90223845 GTATATATGTATATAAACAATGG + Intergenic
1100126562 12:91434040-91434062 ATTTAAAAGATTATAAATAATGG - Intergenic
1100484132 12:95008489-95008511 TTTTACATGAATATCCATCAAGG + Intergenic
1100499203 12:95157263-95157285 TTCCATAAGAATATAAATACTGG + Intronic
1100592737 12:96044674-96044696 ATTGATATGAAAAAAAATAAAGG + Intergenic
1100741714 12:97601065-97601087 TTTTGTATAAATATAATCAATGG + Intergenic
1100791940 12:98140093-98140115 CTAAATATGAATATGAATAACGG + Intergenic
1100943514 12:99752004-99752026 ATTTATAGAATTATAAATAATGG + Intronic
1101854774 12:108433082-108433104 TTTTATATATATATATATATGGG + Intergenic
1101883726 12:108643691-108643713 TTTTAAATGACTTTAAATAATGG + Intergenic
1101890499 12:108710473-108710495 TTTTATTTGAAGATAAAAAGAGG - Intronic
1102018567 12:109665190-109665212 TTTTATATTTATAGACATAATGG - Intergenic
1102093396 12:110213653-110213675 TCTTATATGAATGTAACTCAGGG - Intronic
1102313378 12:111865231-111865253 TTTCCTATTAATATAAAAAAAGG - Exonic
1102372199 12:112391259-112391281 TTTTATATGCATATAAAGATGGG - Intergenic
1102384428 12:112496119-112496141 GTCTCTATCAATATAAATAATGG - Intronic
1102786064 12:115606035-115606057 TTTTATACAAAGAGAAATAAAGG + Intergenic
1102794536 12:115677014-115677036 TATTATTGTAATATAAATAATGG - Intergenic
1102799466 12:115718815-115718837 TCTTATATCAAAATAAATGAGGG + Intergenic
1102910523 12:116710204-116710226 TTGTATTTGTATGTAAATAAAGG - Exonic
1103632977 12:122277821-122277843 TTTTTTTTTAACATAAATAATGG - Intronic
1103757747 12:123222992-123223014 ATGTATATGTATATAAAAAAAGG + Intronic
1103934855 12:124469854-124469876 TTTTAAAGGAAGATAAAAAAGGG + Intronic
1104434417 12:128744236-128744258 TTTTACATGAAAATCAATTACGG - Intergenic
1104533879 12:129599327-129599349 TTTTGTCTGATTATAAACAAAGG - Intronic
1104600071 12:130147193-130147215 TTTTATATGAATTCAAATTCTGG - Intergenic
1104611633 12:130233920-130233942 TTATATATTGATTTAAATAAAGG - Intergenic
1104668488 12:130664841-130664863 ATATAAATGAACATAAATAAAGG + Intronic
1105347883 13:19590540-19590562 TTTTATAATCATATTAATAATGG - Intergenic
1105394192 13:20012950-20012972 TTTTATATGAATTTGAAGATTGG + Intronic
1105655504 13:22433195-22433217 TTTTATGTATATATATATAATGG + Intergenic
1105681995 13:22737578-22737600 TTTTATGTGAAAATGAAGAATGG - Intergenic
1106278260 13:28236385-28236407 TTTTTTAAAAATATAGATAAAGG - Intronic
1106630049 13:31461892-31461914 TTATTTTTGAATGTAAATAATGG + Intergenic
1107383806 13:39886657-39886679 TTTTGTATCAATATGCATAAGGG - Intergenic
1107460692 13:40599091-40599113 TTTTTGATCAATAGAAATAATGG - Intronic
1107482728 13:40798332-40798354 TTATAGAAGTATATAAATAAAGG + Intronic
1107639902 13:42431291-42431313 TTTTATGAGAATATCAATAGTGG + Intergenic
1108083552 13:46761796-46761818 TCTTACAGGAATCTAAATAAGGG + Intergenic
1108142992 13:47445871-47445893 TGTCATATGATTATAAACAATGG - Intergenic
1108147470 13:47494669-47494691 TTTCATATGAATAGAATCAATGG - Intergenic
1108173397 13:47767344-47767366 ATTGATATGAAAATAAATCAAGG + Intergenic
1108296880 13:49030106-49030128 TTTTATATCTATATTCATAAGGG - Intronic
1108426216 13:50304022-50304044 GTTTATATGAACACAAAGAAAGG - Intronic
1108434122 13:50385040-50385062 TTTTATATTAAAATAAACATGGG + Intronic
1108476421 13:50822967-50822989 ATTAATATGAATACAAATTAAGG + Intronic
1108560588 13:51640113-51640135 CTTTTTATTAATATCAATAAAGG + Intronic
1108631470 13:52287459-52287481 TTTTATAAGCTTAAAAATAATGG - Intergenic
1108641913 13:52390956-52390978 TTATATGTATATATAAATAATGG + Intronic
1109090244 13:58033451-58033473 TTTTACATGAATATAGAACAAGG - Intergenic
1109341577 13:61067604-61067626 TATTATATGAATATCAAAAGAGG - Intergenic
1109350442 13:61173567-61173589 TTTCATATAATTAGAAATAATGG - Intergenic
1109381863 13:61572770-61572792 TCTTATAGAAATAAAAATAAAGG + Intergenic
1109712165 13:66176128-66176150 CTTTATATGTATATAAAGGAGGG + Intergenic
1110008315 13:70299380-70299402 TGTTACATGATTATAAAGAAGGG - Intergenic
1110054095 13:70942676-70942698 TTTTATAACAAGAAAAATAATGG + Intergenic
1110102268 13:71623479-71623501 TTTATTTTGAATATAAAAAAAGG - Intronic
1110184855 13:72661258-72661280 TTTTTAATGAATTTTAATAAAGG + Intergenic
1110267307 13:73552906-73552928 CTATATATGAATATAAAATAAGG - Intergenic
1110300952 13:73926636-73926658 TTTTTTTTTAACATAAATAAAGG + Intronic
1110462238 13:75757720-75757742 TTTTCTATGACTATGAATAAAGG - Intronic
1110557753 13:76879272-76879294 TTTTAAATGCCTATCAATAAAGG + Intergenic
1110669242 13:78156859-78156881 ATTTAAATAAATTTAAATAAAGG - Intergenic
1110674844 13:78229617-78229639 GTATATATGGACATAAATAATGG + Intergenic
1110813175 13:79833042-79833064 ATTTATATAATTATATATAAAGG + Intergenic
1110997467 13:82130866-82130888 ATTAATATGACTAAAAATAATGG + Intergenic
1110998892 13:82151698-82151720 TTTTATATGGTTATAGATAGGGG - Intergenic
1111003827 13:82222595-82222617 TTTAATTTGCATATAAATAAGGG + Intergenic
1111012814 13:82333285-82333307 TTTTATTTAAAAATATATAAAGG - Intergenic
1111032906 13:82630696-82630718 TGATATATTAACATAAATAAAGG - Intergenic
1111124033 13:83889859-83889881 TTTGATATCAATATGAAAAATGG + Intergenic
1111145814 13:84177814-84177836 TTTTAGCTGAATATAGAAAAGGG - Intergenic
1111203795 13:84976390-84976412 TTTTATATGAACATGAAAAAAGG + Intergenic
1111323105 13:86656449-86656471 TATTAAATTAATATAAATAGTGG - Intergenic
1111354893 13:87086224-87086246 TTTTTTATTAACATAAATCATGG - Intergenic
1111367222 13:87264496-87264518 ATCTATATTGATATAAATAAAGG - Intergenic
1111379939 13:87436204-87436226 TTTTATTTGTATATACTTAAGGG - Intergenic
1111436177 13:88211482-88211504 TTTTCTAAAAGTATAAATAATGG + Intergenic
1111685839 13:91499847-91499869 TTTTATATGTAAATCAATACAGG - Intronic
1111989962 13:95106700-95106722 TTTTATATTAAGATAAAGGAGGG + Intronic
1112122195 13:96425116-96425138 TTCTATATGCATGTAACTAAAGG + Intronic
1112367660 13:98769488-98769510 TTATAAATGAAAATAAATGAAGG + Intergenic
1112376518 13:98847004-98847026 TTTTATATGCAAATATATACAGG + Intronic
1112662538 13:101528130-101528152 TTTTATATAAAAATATATATAGG + Intronic
1112677914 13:101725200-101725222 TTTTATTTGCATTTAAATATAGG + Intronic
1112748735 13:102557499-102557521 TATAATATTAATATAAATATAGG + Intergenic
1112844337 13:103619568-103619590 CATTAGATCAATATAAATAATGG - Intergenic
1112973771 13:105291840-105291862 TTGCATATGAGTATATATAAAGG - Intergenic
1113153550 13:107291209-107291231 TTTCATATCAATATAGTTAATGG - Intronic
1113266002 13:108618650-108618672 TTGCATATGGATACAAATAAGGG - Intronic
1113495048 13:110720365-110720387 TGTTATATGGATATACATCATGG - Exonic
1113506240 13:110818436-110818458 ATTTATATGGAAATAAATGAAGG - Intergenic
1114198371 14:20499482-20499504 TTTTATATGAATGAGAAGAAAGG + Intergenic
1114520286 14:23329781-23329803 TCTTATAAGAATAAAACTAAAGG - Intergenic
1114993804 14:28321045-28321067 ATTGATAAGCATATAAATAAGGG + Intergenic
1115053758 14:29097067-29097089 TTTGATATGAAAAGAAATACAGG + Intergenic
1115318109 14:32048126-32048148 TGGTATATTAATATAAATCAAGG + Intergenic
1115403824 14:32993618-32993640 TTTTATATTCAAATAACTAAGGG + Intronic
1115560644 14:34579876-34579898 TTATATATAAAAATAAAAAAGGG + Intronic
1115591298 14:34868013-34868035 TTTTATATGAATGTAAATTTAGG + Intronic
1115711931 14:36060524-36060546 TTTTTGATGAATATAATTATGGG - Intergenic
1115794213 14:36914931-36914953 TTTTAAATAAAAATAAATAAAGG + Intronic
1115813630 14:37137319-37137341 TATTAAATAAATATAAATAATGG + Intronic
1115829532 14:37320026-37320048 TTTAATATGCAAATAAATCATGG - Intronic
1115988950 14:39131642-39131664 ATTAAGATGAATATAAATACTGG - Intronic
1116123454 14:40751376-40751398 TTTAATATTAGTAAAAATAAAGG - Intergenic
1116196275 14:41730261-41730283 TATTATTTAAAAATAAATAAAGG + Intronic
1116219808 14:42069199-42069221 TTTGATATACATATAAATTATGG + Intergenic
1116374395 14:44180022-44180044 TTAGATATGAATATAAATGAGGG + Intergenic
1116503612 14:45650914-45650936 TTTAATATGTGTATTAATAATGG + Intergenic
1116602603 14:46946122-46946144 TTTAATCTGAATAAAAATTAAGG + Intronic
1116793974 14:49369692-49369714 TTATATATATATATAAATATAGG + Intergenic
1117089234 14:52233514-52233536 CTTAATATGAATGTAAAGAAGGG + Intergenic
1117117084 14:52525229-52525251 TTTTATATATATATAAATGCAGG - Intronic
1117153948 14:52918955-52918977 TTTTATATTAAGATAAATGCTGG - Intronic
1117707663 14:58488553-58488575 TTTTATATCAAAATGAATACAGG + Intronic
1117905912 14:60586236-60586258 TAATTTATGAATATAAATATAGG - Intergenic
1118013104 14:61629904-61629926 TTTTCCATGAATATAAATATAGG - Intronic
1118040947 14:61916252-61916274 TTTTTTATGAAAAAAAGTAATGG - Intergenic
1118214461 14:63795506-63795528 GTATATATGTATATATATAAAGG - Intergenic
1118216598 14:63814516-63814538 TTATATATGGATATATATAATGG - Intergenic
1118264494 14:64281524-64281546 TTTTAAAAGAAGAAAAATAATGG + Intronic
1118269977 14:64333942-64333964 TTATATATAAATATATATTAAGG + Intronic
1118413754 14:65510348-65510370 TTTTGTATGAATATTCATCAGGG + Intronic
1118984287 14:70740205-70740227 TCTTATATGAATTTAATTATGGG - Intronic
1119071289 14:71587362-71587384 TTTTTTTAGAATATAAATTATGG + Intronic
1119071961 14:71595598-71595620 TTTTATTTGGATATAAATGTAGG - Intronic
1119827833 14:77672416-77672438 TTTTAAATGAATAAAAATTATGG - Exonic
1119837475 14:77763186-77763208 TTTTACATTTATATAAATATAGG - Intronic
1119982666 14:79099586-79099608 TTTTTTATGATCCTAAATAAAGG - Intronic
1120117033 14:80631510-80631532 TTATCTTTGAATATAAAGAATGG - Intronic
1120223626 14:81765025-81765047 TTGTATCGGAGTATAAATAAAGG + Intergenic
1120230912 14:81839838-81839860 TTTGGTATGAATAAAAAAAAAGG + Intergenic
1120279943 14:82426587-82426609 TTTTATAAGAAAATAGATGATGG - Intergenic
1120869770 14:89326658-89326680 TTTTATATTAGTGTACATAATGG + Intronic
1121081407 14:91111579-91111601 GTTTTTAAAAATATAAATAAAGG - Intronic
1121363409 14:93283861-93283883 TCTTTTAAGTATATAAATAAGGG + Intronic
1121382472 14:93485129-93485151 TTTGAGATGAATTTAAACAAAGG + Intronic
1121679563 14:95781629-95781651 TTATATATGTATATATATAAAGG - Intergenic
1122455302 14:101845663-101845685 TTTTATTTGCATATGAAGAAAGG - Intronic
1122867908 14:104617430-104617452 TTCTATCTGCATATAAATAGTGG + Intergenic
1202888629 14_KI270722v1_random:133646-133668 TTAAATCTGATTATAAATAATGG + Intergenic
1123405075 15:20014774-20014796 TATTTTATAATTATAAATAATGG + Intergenic
1123514406 15:21021422-21021444 TATTTTATAATTATAAATAATGG + Intergenic
1123777308 15:23592332-23592354 ATTTATATAAATATAACTGAAGG + Intronic
1125061285 15:35428179-35428201 TTTTTTATGTATTTAAATGAGGG + Intronic
1125108660 15:36004831-36004853 TTTTATATAAATATATGAAAAGG + Intergenic
1125126218 15:36224608-36224630 TTTTATATAAAAATAAAGTATGG + Intergenic
1125180151 15:36873279-36873301 TTTTGTATGAATATGATAAATGG - Intergenic
1125234307 15:37494521-37494543 TTTAATAAGCATTTAAATAAGGG + Intergenic
1125400694 15:39299485-39299507 TTTTTTATGTATAAAAACAATGG - Intergenic
1125851610 15:42908913-42908935 TGCTATATGAATATATATACAGG - Intronic
1125866839 15:43059363-43059385 TGTTATAAGAATAAAAATTATGG - Intronic
1126129930 15:45330786-45330808 TTTTATTTGAATATCAAGATTGG + Intergenic
1126485772 15:49178793-49178815 TCATATAAGAAAATAAATAATGG - Intronic
1127350901 15:58151037-58151059 TATAATATTGATATAAATAAAGG - Intronic
1127542947 15:59960879-59960901 TTTTATATTCAAATAAAAAATGG - Intergenic
1127730170 15:61793461-61793483 TTGTATATGAAGTGAAATAAGGG + Intergenic
1127839471 15:62818544-62818566 TTTTTTATGGATTTAAAAAAAGG - Intronic
1127972711 15:63974027-63974049 TTAAAAATGAATATAATTAATGG - Intronic
1128348405 15:66871096-66871118 CTTTATATCAATATAATTATAGG - Intergenic
1128586463 15:68855521-68855543 TTTTAAATGAATTTAATTAATGG + Intronic
1128964680 15:72046547-72046569 TCCAATATGAATATAAATGATGG - Exonic
1129095922 15:73207835-73207857 TTTTATTTAAATATGATTAAAGG + Intronic
1129096370 15:73212933-73212955 TTTTATATACACATAAATATGGG - Intronic
1129820461 15:78598341-78598363 TTATACATGAATAGAAATAGTGG + Intronic
1131718369 15:95138882-95138904 TTATATATTTATATGAATAATGG + Intergenic
1131784515 15:95897556-95897578 TTTTATATAAATATCAACATGGG + Intergenic
1131887899 15:96938488-96938510 TTGTATATGGAGATAAATAGGGG + Intergenic
1131981694 15:98000515-98000537 TTGTATTTGAATAAAGATAATGG - Intergenic
1132199995 15:99944749-99944771 TTTTTGATGAAAATAACTAAAGG - Intergenic
1132325541 15:100966540-100966562 TTTTCTTTCAATTTAAATAAAGG + Intronic
1132358923 15:101195936-101195958 TTATATATAAATATTAAAAATGG + Intronic
1132928039 16:2442305-2442327 TATTATATATATATAATTAAGGG - Intronic
1133070697 16:3244889-3244911 TTTTATTTCAATAGAAAGAAAGG - Intronic
1133486106 16:6220086-6220108 TTCTATATGTACATATATAAGGG + Intronic
1133992843 16:10723329-10723351 TAATATGTTAATATAAATAAAGG + Intergenic
1134262862 16:12666816-12666838 GTTTATATAATTATTAATAATGG + Intronic
1135005262 16:18815568-18815590 TTTTGGGTGAATATAAATCATGG - Exonic
1135199612 16:20425787-20425809 TGGTATATAAATATATATAATGG - Intronic
1135631145 16:24036444-24036466 TATCTAATGAATATAAATAAGGG + Intronic
1135773669 16:25237146-25237168 TTTTCTATGAATCTTCATAAAGG + Exonic
1135854994 16:26001332-26001354 GTCTATGTGAATATACATAAAGG + Intronic
1136555778 16:31007118-31007140 ATTTTTTTAAATATAAATAAAGG + Intronic
1137296946 16:47103606-47103628 TTTTATATTAATATTCATAAGGG - Intronic
1137322967 16:47404409-47404431 TTTTAAATGATTACCAATAAAGG - Intronic
1137793035 16:51190947-51190969 TCTTCTATGAAAATCAATAAGGG - Intergenic
1137876380 16:52000206-52000228 TTTTAAATTTTTATAAATAAGGG - Intergenic
1138080027 16:54081771-54081793 CTGTATATAAATTTAAATAATGG - Intronic
1138197779 16:55065832-55065854 TTCTATATGAATTTTAATATCGG - Intergenic
1138817899 16:60223401-60223423 TTTCATATAAATATATATATTGG + Intergenic
1138883206 16:61041890-61041912 TTTTATAAGTATATATATAGAGG - Intergenic
1138896223 16:61208025-61208047 TTTAATATGAAAAAAACTAAAGG - Intergenic
1138919502 16:61510049-61510071 TTTTATATGAGGATAACTCATGG + Intergenic
1138932768 16:61680995-61681017 TTTTATATATATTTAAAAAAAGG + Intronic
1139078878 16:63490016-63490038 TTTTATAAGAATATCAGTATTGG + Intergenic
1140321920 16:73960809-73960831 TTCTATATGAATATGAATATTGG - Intergenic
1140338332 16:74132967-74132989 TATTTTATGAAGATAAATGATGG - Intergenic
1140508792 16:75492546-75492568 TTTTATAGGAAAATAACTCAGGG + Intronic
1140567482 16:76061046-76061068 TTTTAAATCAATATAAATATAGG - Intergenic
1140793628 16:78415119-78415141 TTTTATGTAACTATAAACAAGGG + Intronic
1140927133 16:79594142-79594164 ATATATATGCATATATATAATGG - Exonic
1140937017 16:79681741-79681763 TTATAGATGAAGATTAATAAAGG - Intergenic
1141331081 16:83111260-83111282 TATTATATCAATAGAAATTAGGG - Intronic
1141539738 16:84710597-84710619 TTTTCTACGAATATAATCAAGGG - Intronic
1142873239 17:2834885-2834907 ATTTATTTTAATTTAAATAAAGG - Intronic
1142955787 17:3520805-3520827 ATATATATGTATATATATAAAGG + Intronic
1143942844 17:10560561-10560583 TGCTATTTGAATATACATAATGG - Intergenic
1144143474 17:12373483-12373505 TTTTTTTTAAATTTAAATAATGG + Intergenic
1145070754 17:19804895-19804917 TTTTCTCTAAATATAACTAATGG - Intronic
1145410779 17:22660842-22660864 ATTTTTCTGAATAAAAATAAAGG + Intergenic
1145729818 17:27169010-27169032 TTTTTTCTGAATCAAAATAAAGG - Intergenic
1145848121 17:28062351-28062373 TGTTATATGAAGTTCAATAATGG - Intronic
1146338772 17:32000836-32000858 TTTTTTATAAATAGAAACAAAGG - Exonic
1146454847 17:33001517-33001539 ATTTATATGAAACTAAAAAAGGG - Intergenic
1146533695 17:33631797-33631819 CTTTATTTGAATATAACAAAGGG - Intronic
1146807921 17:35880083-35880105 ATTCATAAGAATGTAAATAATGG + Intronic
1147479840 17:40749870-40749892 TTTTATATTAACATCAAGAATGG + Intronic
1147517864 17:41139221-41139243 TTTTTTATGAATATGGAGAAGGG - Intergenic
1147972571 17:44227476-44227498 TTTTATATGCATATATTTTAGGG - Intergenic
1148205363 17:45776268-45776290 TTTTAAATGCATATAAAAATAGG + Intergenic
1148264285 17:46212574-46212596 ATTTATAGGAAAATAAATCATGG - Intronic
1148368550 17:47075299-47075321 TTTTAGATGAATCTAGATGATGG - Intergenic
1148528598 17:48366802-48366824 TTTAATATAAATAGAAATTAGGG + Intronic
1149211906 17:54313348-54313370 TTTCATCTGCTTATAAATAAAGG - Intergenic
1149332422 17:55598804-55598826 TTTTACATGAACATTAATCAGGG + Intergenic
1150186136 17:63183414-63183436 TTCTAGTTTAATATAAATAAAGG + Intronic
1150360197 17:64525413-64525435 TTTTGTATCAATGTCAATAAAGG - Intronic
1150741153 17:67779887-67779909 AATTAAATAAATATAAATAAAGG - Intergenic
1150865153 17:68841545-68841567 TTTTCTAGGAATTTAAATATAGG + Intergenic
1151035686 17:70796437-70796459 TTATATATAAAAATATATAAAGG + Intergenic
1151037457 17:70818881-70818903 ATTTATATATATATATATAAAGG + Intergenic
1151063209 17:71120654-71120676 TTTTACATGAATAGCTATAATGG + Intergenic
1151125717 17:71842640-71842662 TTTTGTATAACTAAAAATAAAGG + Intergenic
1152814732 17:82400635-82400657 ATATATATGTATATAAATAAAGG - Intronic
1203183634 17_KI270729v1_random:90288-90310 TTTTATGGGAAAATAAATAGAGG - Intergenic
1153196499 18:2604009-2604031 ATGAATATGAATGTAAATAAAGG + Intronic
1153380167 18:4429271-4429293 TTTAATATTAATAAACATAAAGG + Intronic
1153418003 18:4871147-4871169 TTCTATATCAATATTTATAAGGG - Intergenic
1153493392 18:5672695-5672717 TCTTTGATGAATATAAATAAAGG - Intergenic
1153558089 18:6338504-6338526 TTTCATATAATTATAAAGAAAGG + Intronic
1153569768 18:6457629-6457651 TTTTATATGAATTTGAAAATTGG + Intergenic
1153944241 18:10004711-10004733 TTATATATATATATATATAAAGG - Intergenic
1154955312 18:21248346-21248368 TTTTATGTGAATTTAAATGTTGG + Intronic
1155001191 18:21688448-21688470 CTTTACATGAATATTAATATTGG + Intronic
1155248702 18:23935649-23935671 ATGTAAATGAAGATAAATAATGG + Intronic
1155431057 18:25758740-25758762 TCTTCTATGAATATGAATTATGG - Intergenic
1155595173 18:27477566-27477588 TTATATATGCATACAATTAATGG + Intergenic
1155640999 18:28014608-28014630 TTTTAAACAAATAAAAATAAAGG + Intronic
1155721993 18:29027080-29027102 ATGTATATGCATATAAATATAGG + Intergenic
1155736628 18:29231871-29231893 TTTTACATCAATATTAATCAAGG - Intergenic
1155738827 18:29259923-29259945 TTTTATATGCTAATATATAAAGG + Intergenic
1155755858 18:29494745-29494767 TTTTTTATGAAAAATAATAAAGG - Intergenic
1156114448 18:33770420-33770442 ATTTATCTGAAGATAAACAAGGG + Intergenic
1156176292 18:34551031-34551053 TTTCATATCAAAGTAAATAAGGG - Intronic
1156622929 18:38874104-38874126 TTTTATATGTATATACATAATGG + Intergenic
1156763949 18:40628709-40628731 TATTATATATATATATATAAAGG - Intergenic
1156911970 18:42421874-42421896 TTATATATGGAGAAAAATAAGGG + Intergenic
1157265765 18:46219918-46219940 TTTGATTTTAATGTAAATAATGG + Intronic
1157269556 18:46261549-46261571 CTTAATATGAATTTATATAATGG + Intronic
1157939450 18:51911186-51911208 TTGTAGATGGATAAAAATAATGG - Intergenic
1157967943 18:52229961-52229983 TTTTCTTTTAATACAAATAATGG + Intergenic
1158094083 18:53750256-53750278 TTTCTTATGTATATAAATCATGG - Intergenic
1158206444 18:54998632-54998654 TATTATATGTATTTGAATAATGG - Intergenic
1158257946 18:55574184-55574206 TTCTATGTGAATATAAAGGAAGG - Intronic
1158595330 18:58810765-58810787 TTTTATATTAAAAAAAATACAGG - Intergenic
1158601695 18:58861807-58861829 TTTTATATGCATATTAATAAAGG + Intergenic
1158702487 18:59761078-59761100 TTTAATCTGAAAATAATTAATGG - Intergenic
1158719052 18:59907465-59907487 TTTTATATGAATACATGCAAGGG - Intergenic
1158806099 18:60975407-60975429 TTTCATATTATTATAAATTATGG - Intergenic
1158923485 18:62223648-62223670 TTCTATATCTATATTAATAAAGG - Intronic
1159035664 18:63275080-63275102 TTTTATATAAAAAAAAATCAAGG + Intronic
1159061191 18:63515692-63515714 ATTTATGTTAATTTAAATAATGG + Intergenic
1159217212 18:65408631-65408653 CTGTATATGAATATAAACTATGG + Intergenic
1159317404 18:66795031-66795053 AATTAGAGGAATATAAATAAAGG - Intergenic
1159404661 18:67984560-67984582 ATTTATATAAATATAAATATTGG + Intergenic
1159430148 18:68341273-68341295 TTTTACTTGAATTTAAAAAAAGG + Intergenic
1159548193 18:69867136-69867158 TTTTATATGAATATAAATAAAGG - Intronic
1159690998 18:71486925-71486947 TTATATATGTATATAAATTTTGG + Intergenic
1159825076 18:73197901-73197923 TTTTATTTCAATATAGATACTGG + Intronic
1162137823 19:8566812-8566834 ATATATATTAAAATAAATAAAGG - Intronic
1162258984 19:9517278-9517300 ATATATATAAATAAAAATAAAGG + Intergenic
1163877409 19:19884228-19884250 TTTGATATGTTTATAAATCAAGG + Intronic
1164297582 19:23926960-23926982 TTTTATATAAATCCAAATAGGGG - Intronic
1164454183 19:28393360-28393382 GTTTATATGATTTTAAATATAGG - Intergenic
1166666143 19:44681604-44681626 TTTTATATATATATAACGAAAGG + Intronic
1167733564 19:51277204-51277226 TTTTGTATGAATATTCATGACGG - Intergenic
1167953186 19:53044231-53044253 TTTTAGAAAAAAATAAATAAGGG + Intergenic
1202664027 1_KI270708v1_random:100440-100462 TTAAATCTGATTATAAATAATGG + Intergenic
925321649 2:2974778-2974800 TTTAAGATAAATATAAATAAGGG + Intergenic
925757064 2:7143511-7143533 TTTTATATAAATATGAAACAAGG - Intergenic
925834098 2:7926633-7926655 TTTTAAATAATAATAAATAAAGG + Intergenic
926349079 2:11978892-11978914 TTTTATATATATATATATACAGG - Intergenic
926467462 2:13208280-13208302 TCTTACATGTATATAATTAAGGG + Intergenic
926534133 2:14089165-14089187 TTTTATATATATATATATTATGG - Intergenic
926535798 2:14110401-14110423 TTGTATATCTATATAAATATAGG - Intergenic
926538995 2:14151498-14151520 TATTATACTAATAAAAATAAAGG - Intergenic
926618445 2:15022865-15022887 TATTATTTGTATATAAATACAGG + Intergenic
926804862 2:16698835-16698857 TGTTATATATATATATATAATGG + Intergenic
927414568 2:22865201-22865223 TTTTATTTGAATTTTAATATAGG - Intergenic
927601660 2:24447526-24447548 TTTCATTTGAAAATAAATACAGG - Intergenic
927660103 2:24986063-24986085 TTTTGTATGATTCTAATTAATGG + Intergenic
927750803 2:25668728-25668750 TTTTAAAACAATATACATAATGG - Intronic
927824718 2:26300133-26300155 TTTTATATATATATATATATTGG - Intergenic
928002381 2:27535962-27535984 TTTTATATCCATATAGAGAAAGG + Intergenic
928114086 2:28533610-28533632 TTATACATGAATATAACTTATGG - Intronic
928704419 2:33932313-33932335 TTATTTATGAATACAACTAAAGG - Intergenic
928731040 2:34232962-34232984 TTTAATATCAATATAAATAGTGG + Intergenic
928791946 2:34967973-34967995 TTATATATGAATAAAGAAAATGG - Intergenic
928965984 2:36975981-36976003 GTTTAAATGAAAATAAATAATGG + Intronic
929912520 2:46102378-46102400 GTTTATTTAAATAAAAATAATGG - Intronic
930282257 2:49384167-49384189 TTTTTAATGAAAATAAATGAAGG + Intergenic
930300534 2:49610223-49610245 ATTTATATAAATATTTATAATGG + Intergenic
930961677 2:57269669-57269691 TTTTGTATGTGTATACATAAGGG - Intergenic
931093837 2:58917562-58917584 TTACATATAAATATAAATCATGG + Intergenic
931110010 2:59100026-59100048 TTATATATTTATATAAATAATGG - Intergenic
931123095 2:59242697-59242719 CTTTATATAAATAAAAATAAAGG + Intergenic
931129875 2:59323164-59323186 TATTATATAAATAAACATAAGGG - Intergenic
931165124 2:59738755-59738777 TTTTATAAGAAAATAAAATATGG + Intergenic
931313892 2:61107979-61108001 TTATATTTTAATATAAATTAAGG - Intronic
931474152 2:62570865-62570887 TTTTAAATGCATATGAATCAGGG + Intergenic
932038070 2:68268751-68268773 ATTTATACGAATAAAAAAAATGG + Intergenic
932247695 2:70209395-70209417 ATTCATATGAATATGAATTATGG + Intronic
932290807 2:70577443-70577465 TTTTATTTAAATATATATTAAGG - Intergenic
932312070 2:70750935-70750957 TTTTATAAGAATGTAAAATATGG - Intronic
932318734 2:70804283-70804305 ATATATAGGTATATAAATAAAGG + Intergenic
932914906 2:75846530-75846552 TGTTTTATGAAAATAAATTATGG - Intergenic
933471454 2:82730758-82730780 TCATATATGAATATCATTAAAGG + Intergenic
934123592 2:88864336-88864358 ATATATATGTATATAAATACGGG + Intergenic
935213111 2:100955287-100955309 TTATATATATGTATAAATAATGG + Intronic
935439961 2:103081298-103081320 ATATATATGCATATATATAATGG + Intergenic
935915890 2:107948850-107948872 AGTAATATGAATATAAATGAAGG + Intergenic
936100622 2:109575426-109575448 TTTTATTTAATTATAAACAAAGG + Intronic
936292343 2:111235911-111235933 GTTTATGTGAATATAATCAAAGG + Intergenic
936668352 2:114625589-114625611 TTTTAAAAGCTTATAAATAAAGG - Intronic
936681191 2:114773497-114773519 TTTTAAATGAACATATGTAATGG + Intronic
937007407 2:118529902-118529924 TTTTAAATGAAAAAAAAAAAAGG + Intergenic
937582144 2:123499960-123499982 ATATATATGGATATATATAAAGG + Intergenic
937647097 2:124277594-124277616 TTTTACATTAAAATAAATATTGG + Intronic
937666619 2:124495224-124495246 TTTTTTATTATTATAAATAATGG + Intronic
937757117 2:125553354-125553376 TTTTTTTTTAATATAATTAATGG - Intergenic
937778512 2:125810000-125810022 TTTTTTATACATATAAATGATGG - Intergenic
937785651 2:125891522-125891544 TTTTATATATATATATATAGGGG - Intergenic
938102776 2:128508761-128508783 TGTTATATAGATATAAATTAGGG + Intergenic
938809447 2:134839412-134839434 TTTTGAATGAATATAAAAAGAGG + Intronic
938835318 2:135096945-135096967 ATTTATATTAATATATAGAAAGG - Intronic
938967456 2:136400908-136400930 TTTTTTTCTAATATAAATAATGG - Intergenic
938989552 2:136613887-136613909 TTTCTTATGAATATAAAAATGGG + Intergenic
938998181 2:136702938-136702960 TTTTATACCAATATAAACATGGG + Intergenic
938999293 2:136715245-136715267 ATTTATATGAAAACAAAAAAAGG + Intergenic
939038259 2:137158489-137158511 TTTGATATGACTTAAAATAAAGG - Intronic
939044338 2:137232190-137232212 TTTTATATCCATATAAAAAGTGG - Intronic
939247005 2:139638043-139638065 ATTTTTATGAATATGAATCATGG - Intergenic
939373454 2:141332722-141332744 TTTTATATATATATATATAAAGG + Intronic
939385427 2:141490275-141490297 ATTATTATGAATATAAACAATGG + Intronic
939491378 2:142881337-142881359 TTGTCTAGGAATATAAAGAATGG + Intronic
939510457 2:143098389-143098411 TATAATATTGATATAAATAAAGG + Intronic
939658474 2:144856955-144856977 TTTTATATGAACAAGAAAAATGG - Intergenic
939920413 2:148103777-148103799 TTTTATTTCAAATTAAATAAAGG + Intronic
940108632 2:150126386-150126408 TTTTATTTTATTAAAAATAATGG + Intergenic
940383173 2:153039805-153039827 TTTTGTATCAATATACATCAGGG + Intergenic
940535624 2:154939331-154939353 TTATATATTTATATACATAAAGG + Intergenic
940687822 2:156876090-156876112 ATGTATATGAATATATGTAATGG - Intergenic
940938680 2:159530466-159530488 TTTTATATTAAAATATTTAAGGG - Intronic
941311268 2:163935049-163935071 TTTAATTTGTATATTAATAAAGG + Intergenic
941527160 2:166620430-166620452 TATTAGATGTATATAAATAGAGG + Intergenic
941588670 2:167390955-167390977 TTTTAAATGACTCTAGATAAGGG + Intergenic
941662987 2:168214672-168214694 TTTTACAAGAATATATACAAAGG + Intronic
941774755 2:169380847-169380869 TTTTATATCTATATTCATAAGGG - Intergenic
941796001 2:169598807-169598829 ATTTATATTTATATAAATACAGG + Intronic
941796002 2:169598835-169598857 ATTTATATGTATATAAATACAGG + Intronic
941796005 2:169598911-169598933 ATTTATATTTATATAAATACAGG + Intronic
942382490 2:175406511-175406533 TTTTATATGAGTATCAATGTAGG + Intergenic
942408370 2:175680179-175680201 TTTAATAAAAATGTAAATAATGG + Intergenic
942543717 2:177040957-177040979 ATTTATATGTGTATATATAAAGG + Intergenic
942647547 2:178130126-178130148 TTTTATCTTTATAGAAATAATGG + Intronic
942808260 2:179962162-179962184 TGTTTTATGCATATAAAAAAGGG + Intronic
942810360 2:179992139-179992161 TTTTATTTGATTATAAATGTAGG - Intronic
942926257 2:181436602-181436624 TTATATATATATATATATAATGG + Intergenic
943170914 2:184397984-184398006 TTTTATATTAATAAACAAAAAGG - Intergenic
943170959 2:184398789-184398811 TTTCATATGAATTTAAAGATTGG + Intergenic
943238961 2:185360419-185360441 TGTTATATATATATATATAAAGG + Intergenic
943267561 2:185754305-185754327 TTTTATAATGTTATAAATAAAGG - Intronic
943351275 2:186799215-186799237 TTATATATATATATATATAAAGG + Intergenic
943517999 2:188910475-188910497 TTTTATATATATATTAAGAATGG - Intergenic
943895970 2:193360052-193360074 TTTTATATATATATTTATAAAGG + Intergenic
943975016 2:194464820-194464842 CTATATATATATATAAATAACGG + Intergenic
944552506 2:200857614-200857636 TTTTATTTGATTAAAAATAAAGG - Intronic
944597841 2:201278123-201278145 TTTTAAAAGAATACAAATCAAGG - Intronic
944628965 2:201602869-201602891 TTTTAAATTAAAATTAATAAAGG + Intronic
944763048 2:202837239-202837261 TTTTTTATTAATCTAACTAAAGG + Intronic
944791881 2:203139227-203139249 TTAGATATGAAGATAAATATTGG + Intronic
944812761 2:203344236-203344258 CTTTCTATGAATATTATTAATGG - Intronic
944953254 2:204777421-204777443 GTTTATATGAATTTAAAAGAAGG + Intronic
945163392 2:206917012-206917034 TTTAAAATTAATATAATTAATGG + Intergenic
945233465 2:207612450-207612472 ATATATATATATATAAATAAAGG - Exonic
945449823 2:209980837-209980859 TGATATGTGAATACAAATAAGGG + Intronic
945606954 2:211945758-211945780 TTAAATGTGAAAATAAATAAGGG + Intronic
946280661 2:218663614-218663636 CATTCTATGTATATAAATAATGG + Intergenic
946390471 2:219412602-219412624 TTTTACATCAATATTTATAAGGG - Intergenic
946459951 2:219860083-219860105 TTTTATATGAATAAATAAATGGG - Intergenic
946590265 2:221239335-221239357 TTTTAAATGATTAGAAAAAATGG - Intergenic
946930921 2:224670261-224670283 TTATATATAAATATATATAAAGG + Intergenic
946954048 2:224909147-224909169 TTTTATTTTAATATACACAAAGG - Intronic
947012888 2:225585221-225585243 TTTTATTTAAAAATACATAATGG + Intronic
947309835 2:228789310-228789332 TTTTATAGGTAAACAAATAAAGG - Intergenic
947553573 2:231066819-231066841 GTATATATGATTATAAATATAGG + Intronic
947672852 2:231950244-231950266 TTTTTTAACATTATAAATAATGG - Intergenic
947766195 2:232639196-232639218 TTTTATGAGAATTTGAATAATGG + Intronic
948642121 2:239382234-239382256 TTTTAAATGAATAGAATTAATGG + Intronic
1168781535 20:495535-495557 ATTCTTAGGAATATAAATAATGG + Intronic
1168796568 20:613712-613734 TTTTTAATGTATATAAATAGTGG + Intergenic
1168858986 20:1031559-1031581 TATTTTATGAATATATAAAATGG + Intergenic
1169547693 20:6667486-6667508 TGTTCTCTGAATATAAATAAAGG - Intergenic
1169585395 20:7077455-7077477 TTTTAAATGTAGATAAAGAAAGG + Intergenic
1169857387 20:10117529-10117551 TTTTTTATATATATATATAATGG - Intergenic
1170237269 20:14120681-14120703 TATTATATATATATATATAATGG + Intronic
1170636979 20:18115583-18115605 GTTTACATGAATCAAAATAAAGG - Intergenic
1170977015 20:21174253-21174275 GATTAAATGATTATAAATAAAGG - Intronic
1171064552 20:22001709-22001731 TTTCAAATGAATAGAAATAGGGG + Intergenic
1171764323 20:29247476-29247498 TTTTATGTGAACATAAAAACTGG - Intergenic
1171814772 20:29775921-29775943 TTTTCTATTACTATAAAAAATGG + Intergenic
1172095827 20:32459833-32459855 GTTTTTAAAAATATAAATAATGG - Intronic
1172142699 20:32734528-32734550 TTTTATATATATATAGAAAATGG - Intronic
1172387340 20:34543224-34543246 ATTTTTAAGAATCTAAATAATGG + Intergenic
1172412638 20:34736984-34737006 TTTTGTATGTATAATAATAAGGG + Intronic
1172527603 20:35609645-35609667 TTATATATGTATATAATTAAAGG - Intergenic
1173372495 20:42449902-42449924 TTTTATATGCATAAAAAGATTGG - Intronic
1173382132 20:42555234-42555256 TTTTACATGAAGATAAACAATGG - Intronic
1173987590 20:47274161-47274183 TTTTATAGGAATATAAGAACAGG - Intronic
1174197042 20:48780611-48780633 GTTTATGATAATATAAATAATGG + Intronic
1174841614 20:53906516-53906538 TTTTATTTGAAAATAAATTCAGG + Intergenic
1174992622 20:55528192-55528214 TTTAATATGCATATGCATAAAGG - Intergenic
1176206341 20:63890655-63890677 TTTTATATGTATATAGATGAGGG + Exonic
1176741805 21:10611627-10611649 TTTTTAATGAATAAAAATTAAGG - Intergenic
1176904242 21:14480466-14480488 TTTTTTATGAATATGCATATTGG + Intergenic
1177052045 21:16248607-16248629 TTTTATATGAATAGGAATCTGGG - Intergenic
1177074420 21:16554188-16554210 TTTTATATGATTAAACAAAATGG + Intergenic
1177095924 21:16832650-16832672 TTATATATAAATAAAAATAAAGG + Intergenic
1177538986 21:22467039-22467061 TTCTATAAGTATATAAATACAGG + Intergenic
1177624146 21:23637074-23637096 TTGTATATGAAAATAGATAAGGG + Intergenic
1177912890 21:27053916-27053938 ATTTATATGAACAGAAATCAGGG + Intergenic
1178068692 21:28936233-28936255 TTTTATAGGCATATAAATCAGGG - Intronic
1178141424 21:29688295-29688317 TTTTATCTGACTATATAAAATGG + Intronic
1178638374 21:34325484-34325506 ATTTATATGAATAAATATAAAGG - Intergenic
1178780206 21:35595650-35595672 CCTTATATGAAGATAAAGAAAGG + Intronic
1178832370 21:36067046-36067068 TTTTATAAGCATAAAAATAGGGG - Intronic
1178860898 21:36288390-36288412 TTTTATATACATATAAATTTGGG + Intronic
1179117006 21:38502606-38502628 TTTGGAATGAGTATAAATAATGG + Intronic
1179154440 21:38837846-38837868 TTTAATATTTACATAAATAAAGG + Intergenic
1179351498 21:40615849-40615871 TTTTAAATGCATATCATTAAAGG + Intronic
1179384122 21:40925795-40925817 TTTTATGGGAATGCAAATAATGG + Intergenic
1180330755 22:11477324-11477346 TTAAATCTGATTATAAATAATGG + Intergenic
1180798191 22:18617962-18617984 TTTTTAATAAATAAAAATAAAGG - Intergenic
1181223527 22:21377304-21377326 TTTTTAATAAATAAAAATAAAGG + Intergenic
1181255215 22:21558318-21558340 TTTTTAATAAATAAAAATAAAGG - Intronic
1181396069 22:22623245-22623267 ATTTTTATAAATAAAAATAAAGG - Intergenic
1181647256 22:24239033-24239055 ATTTTTATAAATAAAAATAAAGG + Intronic
1181704250 22:24639152-24639174 ATTTTTATAAATAAAAATAAAGG - Intergenic
1182905025 22:33928413-33928435 TCTTATATGATTATTCATAACGG - Intergenic
1184172346 22:42767256-42767278 TTTTTTTTAAATATATATAATGG + Intergenic
1184963728 22:47951247-47951269 GTTTATATATATATATATAAAGG - Intergenic
949131772 3:511272-511294 TGTTCTATAAATATAAATACAGG - Intergenic
949197409 3:1329146-1329168 TTATATATGTATATAAGCAATGG - Intronic
949391603 3:3568641-3568663 TTTTTTATAAATTTACATAAAGG - Intergenic
949481612 3:4499476-4499498 TTATATATGTATATATATCAGGG - Intronic
949532831 3:4974469-4974491 ATTTATACGAATCTCAATAATGG + Intergenic
949716431 3:6936805-6936827 TTTTATATGTCTAATAATAAGGG - Intronic
949833811 3:8246212-8246234 TTTTATGTGACTATAAATTGTGG - Intergenic
949972577 3:9422598-9422620 TTTTATCTGAAATTTAATAATGG + Intronic
950199309 3:11031809-11031831 TTTTATATGTATAAATTTAAGGG + Intronic
950589156 3:13923496-13923518 TTATATAATAATAAAAATAATGG + Intergenic
950701112 3:14747918-14747940 TTTTACATCTATATTAATAAGGG + Intronic
951138499 3:19132220-19132242 TATTATATTAATATGGATAATGG - Intergenic
951183321 3:19683686-19683708 CTTTACATGTATATAAAAAAGGG - Intergenic
951287181 3:20827382-20827404 ATATATATGTATATATATAAAGG + Intergenic
951699834 3:25484958-25484980 ATTAATATGACTATAAATGAAGG - Intronic
951886935 3:27533601-27533623 TTTTATCTAAATATAAACAGAGG + Intergenic
951909979 3:27739870-27739892 ATTCATATAATTATAAATAATGG - Intergenic
951948429 3:28169584-28169606 GTTAATATTAATATAATTAAAGG + Intergenic
952118930 3:30217974-30217996 CTTTATCTGAATATATTTAATGG + Intergenic
952640630 3:35590641-35590663 TTTATTACCAATATAAATAAGGG + Intergenic
952648045 3:35685919-35685941 TTTTCTATGCATATATATTACGG - Intronic
952737303 3:36703492-36703514 TTGTCTATGAAAATAAACAATGG + Intergenic
952957762 3:38567924-38567946 TTTTTTCTGAATATAAAAATGGG + Intronic
953147129 3:40288917-40288939 TATTAGATAAATATAAATATTGG + Intergenic
953401068 3:42618003-42618025 TTTTAAATAAATAGAAAAAATGG + Intronic
953764441 3:45726118-45726140 TTTTACATTAATATTCATAAAGG + Intronic
953897466 3:46813098-46813120 TTTTATATGCATATATTTTAGGG + Intergenic
954052152 3:47988694-47988716 TTCTATTTGAATTTAAAAAATGG + Intronic
954157753 3:48696183-48696205 TTTTATAAAAATATAATTAATGG - Intronic
954606777 3:51917090-51917112 TTTTAAATGAATAGAAAGATAGG + Intergenic
955116412 3:56009322-56009344 TTTGTTATGAATATAAAGAATGG - Intronic
955388717 3:58502160-58502182 CTTTCTATGCATATAAATCAAGG + Exonic
955426734 3:58799086-58799108 ATGTGTATGCATATAAATAATGG + Intronic
955767339 3:62358773-62358795 TTTATTCTGAATATAAATATGGG + Intergenic
955807367 3:62751334-62751356 TTTCATATCAATAGAAATTAGGG - Intronic
955812359 3:62804480-62804502 TTAAACATTAATATAAATAAGGG - Intronic
955825072 3:62937294-62937316 TTATATAAGTAGATAAATAAAGG + Intergenic
956118079 3:65938372-65938394 TATTAACTTAATATAAATAAAGG + Intronic
956140504 3:66141972-66141994 TTTCATCTCAATTTAAATAAAGG - Intronic
956147807 3:66209757-66209779 TTTTATAGGTATATCTATAAAGG + Intronic
956450040 3:69364868-69364890 TTTTTTAAAAAAATAAATAAAGG + Intronic
956732116 3:72205929-72205951 TTTTAAATAAATATGATTAATGG - Intergenic
956817947 3:72925484-72925506 TTTTATGCGATTATATATAAAGG - Intronic
957091924 3:75739177-75739199 TTAAATCTGATTATAAATAATGG - Intronic
957153532 3:76517972-76517994 TTTTTTTTTAATATAAAAAAAGG - Intronic
957230152 3:77503048-77503070 TTTTAAAATAATTTAAATAATGG + Intronic
957473208 3:80687858-80687880 TTATATATGACTATCACTAAAGG + Intergenic
957565344 3:81878050-81878072 TTTTCTATGTATATAAAAGATGG - Intergenic
957730074 3:84123535-84123557 ATTTAGATAAATTTAAATAATGG - Intergenic
957764011 3:84597823-84597845 CATCATATAAATATAAATAATGG + Intergenic
957774176 3:84734400-84734422 TTTTATATTTATATATACAATGG + Intergenic
957819558 3:85354097-85354119 ATGTAGCTGAATATAAATAAAGG - Intronic
957912620 3:86640913-86640935 TTTTATATTCATTTCAATAAAGG - Intergenic
958019039 3:87976243-87976265 TTTTATACAAATGTAATTAATGG - Intergenic
958147335 3:89642779-89642801 TTTTATATGGCAAGAAATAAGGG - Intergenic
958501516 3:94915811-94915833 TTTTATTTTATTATAAATAAGGG - Intergenic
958504742 3:94960452-94960474 TTTTAAATGAATTTAAACATAGG + Intergenic
958507677 3:95001620-95001642 GTTGTTATGAATATAAATAAAGG - Intergenic
958533192 3:95362713-95362735 TTTTGTATGAAAATAAATTTTGG - Intergenic
958579435 3:95998766-95998788 TTTAATATGAATATTCTTAAGGG + Intergenic
958664100 3:97111619-97111641 TGTTACAATAATATAAATAAGGG - Intronic
958674252 3:97246669-97246691 TTTTATTTGAAAGTACATAAAGG + Intronic
958704372 3:97635192-97635214 TTTTATAGGACTATAAATGTAGG - Intronic
959116666 3:102186619-102186641 TTATATATACATATAAATAAAGG + Intronic
959347281 3:105213995-105214017 TTTTATGTGTACATAAATTATGG + Intergenic
959367835 3:105485837-105485859 ATTTATATGAATGAAAATAATGG + Intronic
959469170 3:106727973-106727995 TTTTAGATGAAGGCAAATAAAGG - Intergenic
959645091 3:108690233-108690255 ATTTTTACGTATATAAATAATGG - Intronic
959785044 3:110286277-110286299 TTTTATATCTATATTCATAAGGG + Intergenic
959792355 3:110377929-110377951 ATTTATATAAATATAAAAAATGG - Intergenic
959850157 3:111076179-111076201 TTTTATATGTGTATAGTTAAGGG + Intronic
960216855 3:115050514-115050536 TTTTATATAAACAAACATAAAGG - Intronic
960231468 3:115232753-115232775 TTTTAAATGGTTATAAATAATGG + Intergenic
960249858 3:115439857-115439879 TTTTATATATGTCTAAATAAAGG + Intergenic
960298436 3:115972545-115972567 TTTTATTTGAATTCAAATAAAGG - Intronic
960374041 3:116876970-116876992 TTTTTTATCATTATAGATAATGG - Intronic
960402250 3:117215506-117215528 TTTTATGTGATTACAGATAATGG - Intergenic
960655860 3:120003669-120003691 ATTTAAATGGATATAAATATTGG - Intronic
960733436 3:120751082-120751104 TTTTATAATAATATATATGATGG - Intronic
960747155 3:120902697-120902719 TTTTATATGGGAATAAATACAGG - Intergenic
960880203 3:122336453-122336475 TTTTATATTAATATGACTCATGG - Intronic
961155149 3:124673429-124673451 TTCTATATGTATATACATACAGG - Intronic
961155150 3:124673465-124673487 TTCTATATGTATATACATACAGG - Intronic
961155151 3:124673501-124673523 TTCTATATGTATATACATACAGG - Intronic
961155152 3:124673537-124673559 TTCTATATGCATATACATACAGG - Intronic
961155153 3:124673573-124673595 TTCTATATGCATATACATACAGG - Intronic
961155154 3:124673609-124673631 TTCTATATGCATATACATACAGG - Intronic
961274592 3:125716823-125716845 ATTAATATTAATATTAATAATGG - Intergenic
961499550 3:127322470-127322492 ATTTATATGTATATTATTAAAGG + Intergenic
961617722 3:128196407-128196429 TTGTATTTAAATATATATAAAGG - Intronic
961668796 3:128511930-128511952 ATTTATTTGATTATGAATAAGGG - Intergenic
961800380 3:129443654-129443676 TTGTGTATGACTATAATTAAAGG + Intronic
961876908 3:130030220-130030242 ATTAATATTAATATTAATAATGG + Intergenic
962106009 3:132390345-132390367 TTTTATGGGAGTATAAATATGGG - Intergenic
962133174 3:132704592-132704614 TTTTATAAAAATAAAATTAAAGG + Intronic
962999987 3:140671358-140671380 TTTTATATTTATATTCATAAAGG - Intergenic
963162644 3:142167387-142167409 TTTTAATTAAAAATAAATAAAGG + Intronic
963177551 3:142316158-142316180 TTTTACAAGAAAATACATAATGG - Intronic
963648511 3:147946937-147946959 TTTACTATTAATATAAATAGAGG + Intergenic
963711233 3:148749989-148750011 TTTGATATGAAAATAAATTTAGG - Intergenic
963852928 3:150225811-150225833 TTTTTTTTTAATATAAAAAATGG - Intergenic
963956029 3:151255056-151255078 TTTTAAATGAATACAAGCAAAGG - Intronic
964086491 3:152825354-152825376 ATTCACATGAATATAATTAAAGG + Intergenic
964155681 3:153582272-153582294 TTTTATCTCAGTATAAATACAGG - Intergenic
964913470 3:161810895-161810917 GTAAATATGCATATAAATAATGG + Intergenic
964994529 3:162859695-162859717 TTGTATATGATGAGAAATAAGGG - Intergenic
965107381 3:164374388-164374410 TTTTATGAGAATATAAAAATAGG + Intergenic
965168042 3:165222091-165222113 TTATTGATGAATATAAATGATGG - Intergenic
965415832 3:168391082-168391104 TTTTACATTAATATTAATGAAGG - Intergenic
965423005 3:168485780-168485802 TTTGATATGAAGATAAACAGAGG + Intergenic
965442180 3:168728385-168728407 GTATATATGAATATATAAAAAGG - Intergenic
965456988 3:168913507-168913529 TTTGATAGGAATAAAAATAAGGG + Intergenic
965477025 3:169169408-169169430 TTATTTATGAATGTAAATGATGG + Intronic
965901726 3:173648971-173648993 TTTCATACTAATAGAAATAAAGG - Intronic
966043076 3:175515979-175516001 TTTTATTTTAAAATAAATAAAGG + Intronic
966043988 3:175528169-175528191 ATGTATATATATATAAATAACGG + Intronic
966160634 3:176963983-176964005 TATTATATATATATATATAATGG + Intergenic
966252029 3:177876927-177876949 TCTTATTTGTATAGAAATAAAGG - Intergenic
966274847 3:178152995-178153017 TTTTATTTGTATACAATTAAGGG + Intergenic
966587743 3:181646099-181646121 TCTTATATGTTTATATATAAAGG + Intergenic
966813604 3:183870318-183870340 TTTTAATTGAATAAGAATAAAGG - Intronic
967347810 3:188478016-188478038 TTTATTATGAAACTAAATAAAGG - Intronic
967475314 3:189909597-189909619 TTTTAAATTAATATTAACAAGGG + Intergenic
967628223 3:191711167-191711189 TTTTATAGAATTATATATAAAGG - Intergenic
967693567 3:192505221-192505243 CTTTATTTAAATATAAGTAAGGG - Intronic
967827406 3:193888512-193888534 TTTTATACAAAAAAAAATAATGG + Intergenic
967856083 3:194118511-194118533 TTTTATATAAAAAGAAATACGGG + Intergenic
968231049 3:197004704-197004726 ATGAATACGAATATAAATAAAGG + Intronic
969024862 4:4165095-4165117 TTTAATATGAATATTAATATCGG + Intergenic
969404974 4:6985347-6985369 TTTTATATGAAAAGAATAAAGGG - Intronic
969784657 4:9445625-9445647 ATTTATAATTATATAAATAAGGG - Intronic
969788547 4:9476007-9476029 ATTAATATGAATATTAATATCGG - Intergenic
969788550 4:9476054-9476076 ATTAATATTAATATAAATAATGG - Intergenic
970049999 4:11903511-11903533 TTATATGTAAAAATAAATAATGG + Intergenic
970221404 4:13815683-13815705 TATTAAATTAATATAAATTATGG + Intergenic
970224902 4:13847603-13847625 TTTTAAATTAATATATATACAGG - Intergenic
970405940 4:15764540-15764562 TTTGAAATGCATATAAAGAATGG + Intergenic
970701997 4:18752511-18752533 TATTACATGTATAAAAATAAAGG - Intergenic
970727812 4:19067595-19067617 TTTTATATGTGTATACATATAGG + Intergenic
970829244 4:20316628-20316650 TTATATATAAATATAATAAAAGG - Intronic
971024829 4:22579346-22579368 TTATATATGTTTATATATAATGG - Intergenic
971125096 4:23745165-23745187 TATTATTGGAACATAAATAATGG - Intergenic
971400097 4:26268240-26268262 TTTTTTTTGAAAAAAAATAAAGG - Intronic
971700348 4:29965193-29965215 TTTTATATGCCTCTAAATTAAGG - Intergenic
971809238 4:31402273-31402295 TTTTATATATATATAAAATATGG + Intergenic
971836231 4:31767014-31767036 GTTTATATAAAGCTAAATAAAGG - Intergenic
971846932 4:31930956-31930978 TTTCATCTGAATATATTTAAGGG + Intergenic
971879548 4:32352349-32352371 TATTATAAGAATGTAAATCAAGG - Intergenic
971893385 4:32555930-32555952 TTTCATAGTAATATAAATATAGG - Intergenic
971953219 4:33381811-33381833 GATTATAGGCATATAAATAAAGG - Intergenic
971982664 4:33773689-33773711 TTTTAAAAGCAAATAAATAAAGG + Intergenic
972013873 4:34219657-34219679 GTATATATGTATATATATAATGG - Intergenic
972031310 4:34462179-34462201 TATAATTTGAAAATAAATAAAGG + Intergenic
972071754 4:35028808-35028830 TTTTAAAAGAAAATTAATAATGG + Intergenic
972145461 4:36019562-36019584 ATGTATATGTATATACATAAGGG + Intronic
972255185 4:37347019-37347041 TTTGAGATGAATGAAAATAAAGG - Intronic
972889933 4:43544756-43544778 TTTTAAATAAAAATAAATAAAGG - Intergenic
972903425 4:43713984-43714006 TTTTATATAAAGAAAAATATAGG + Intergenic
972907233 4:43765930-43765952 TTTACTGTGAGTATAAATAAAGG - Intergenic
972966056 4:44511483-44511505 TATTATATATATATATATAAAGG - Intergenic
972969949 4:44561711-44561733 ATTTATATCAATAAAAATGAAGG + Intergenic
973112989 4:46418315-46418337 TTTTATAAGAAAATAATAAAAGG - Intronic
973266723 4:48218645-48218667 TAATATACGAATATAACTAAGGG + Intronic
973843134 4:54883091-54883113 TTTTACATGAATGTTTATAATGG - Intergenic
974220275 4:58960408-58960430 TTTCATAAGAATATACAGAATGG + Intergenic
974249443 4:59364786-59364808 TTTCATATGCATATACATCATGG + Intergenic
974319380 4:60326362-60326384 TTTAAAATAAATAGAAATAAAGG - Intergenic
974493532 4:62597237-62597259 TTTTATATAAATAGAAGCAATGG + Intergenic
974516496 4:62920031-62920053 TTTTATATACATATAGATACAGG + Intergenic
974521093 4:62980292-62980314 CTTTATTTGAATTTAAATGATGG - Intergenic
974668903 4:65002583-65002605 ATGTATATTAATTTAAATAAAGG + Intergenic
974688455 4:65264508-65264530 TATTATATGAATAAGATTAATGG + Intergenic
974946702 4:68536816-68536838 TTGTATATGATAAAAAATAAGGG + Intergenic
974951449 4:68587817-68587839 TTTTCTAAGAAAATATATAATGG - Intronic
975266114 4:72369946-72369968 CTTTATATGGACACAAATAATGG + Intronic
975569449 4:75798853-75798875 GGTTATAGGAATATAAATATGGG + Intronic
975585879 4:75948305-75948327 TTAAATATGAATAAAAATATAGG - Intronic
975818337 4:78242906-78242928 TTCTATATGAATATAAGATACGG - Intronic
976040543 4:80879838-80879860 ATTTATTTGAATATAAGAAATGG - Intronic
976146694 4:82048465-82048487 TATTATATGAATACTAATAGAGG + Intergenic
976396562 4:84561969-84561991 TTTTGTTTGGACATAAATAATGG + Intergenic
976467993 4:85393253-85393275 TTTTATAAGAATATAGGGAATGG + Intergenic
976664590 4:87577164-87577186 TTTTAAGTCAAAATAAATAATGG - Intergenic
976705736 4:88017020-88017042 TCATATAAAAATATAAATAAGGG + Intronic
976829906 4:89303750-89303772 TTATATATAAATATATATAATGG - Intronic
977101035 4:92815495-92815517 TTTCCTATTAATTTAAATAAAGG + Intronic
977128844 4:93207635-93207657 TTTTATATTAATAAAATAAATGG + Intronic
977129712 4:93220231-93220253 ATATATATATATATAAATAAAGG - Intronic
977164138 4:93674419-93674441 TTTAAAATAAATAAAAATAATGG + Intronic
977330101 4:95627093-95627115 TTTTTCATGAATATAGAGAAAGG + Intergenic
977953689 4:103002290-103002312 TGTTACATAACTATAAATAAAGG + Intronic
978046291 4:104133135-104133157 TATTATATGAATCCAAGTAAAGG - Intergenic
978167611 4:105627502-105627524 TTTTTAATGAAGATAACTAAGGG + Intronic
978279452 4:106992538-106992560 TTGTATATGAAAATAAATATGGG + Intronic
978425242 4:108575380-108575402 TTTCATATATATATATATAAAGG - Intergenic
978532391 4:109728596-109728618 TTTTATGTTAATAGAAGTAAAGG - Intronic
978594629 4:110363667-110363689 ATTTCTATGTATATTAATAATGG + Intergenic
978616742 4:110604866-110604888 TTATATGTGTATATATATAAAGG + Intergenic
978636520 4:110814659-110814681 TCTTATGTGTATATAAATGAGGG + Intergenic
978737032 4:112095138-112095160 TTTTATTTGTATAAATATAAGGG - Intergenic
978949414 4:114539800-114539822 ATATATATAAATATAAATAAAGG + Intergenic
979077727 4:116295911-116295933 TTTTATAAGTATATATAAAATGG + Intergenic
979180076 4:117714686-117714708 TGTTATATTAACAGAAATAATGG + Intergenic
979348590 4:119619559-119619581 TTTTAGATGAATTTTATTAATGG - Intronic
979388996 4:120104806-120104828 TTTTTTATGAATATAAGAGATGG - Intergenic
979810209 4:125027318-125027340 ATCTATATGAATATACATGAAGG - Intergenic
980015092 4:127640841-127640863 TTTTATATGATTATAAAGCATGG + Intronic
980115441 4:128674367-128674389 TTTTATTTTCATATCAATAATGG + Intergenic
980135563 4:128855550-128855572 TTTAAAATGAATAGATATAATGG + Intronic
980161356 4:129167469-129167491 ATAAATATGAATAGAAATAAAGG - Intergenic
980307712 4:131085092-131085114 TTTTGGATGAAAATATATAAAGG - Intergenic
980317931 4:131229168-131229190 TTTTGTATTAATAAAAAAAAAGG + Intergenic
980338744 4:131513115-131513137 TTTTAAATGTATATCAATGAGGG + Intergenic
980766765 4:137316528-137316550 TTTTTTATGAAAATGAATTAGGG + Intergenic
981895332 4:149792206-149792228 TTTTCGTTGAATATAAATATGGG - Intergenic
981925753 4:150137671-150137693 AATTATAGGATTATAAATAAAGG + Intronic
982419725 4:155181029-155181051 TTTTCTAGTAATACAAATAAAGG - Intergenic
982551274 4:156802682-156802704 TTTTCTAAGAGTATAAATACTGG - Intronic
982601496 4:157456511-157456533 TTTTAAATTAATAAAAACAATGG - Intergenic
982664221 4:158241709-158241731 TTTTTTAGGAATACAATTAATGG + Intronic
982952067 4:161711699-161711721 TTTTATATTAATATTCATAAGGG - Intronic
982976053 4:162062570-162062592 TTCTATATGGATATAAAGTAAGG - Intronic
982985972 4:162206569-162206591 TTTTAAATGAATAAAAAACATGG + Intergenic
982988149 4:162236143-162236165 TATTATATGAATTTATATATTGG - Intergenic
983025799 4:162736311-162736333 GTATATATAAATATATATAAAGG - Intergenic
983212538 4:164973858-164973880 TTTTATATGTAAGTAAATATAGG - Intronic
983257759 4:165420934-165420956 TTTCATATGTATATTCATAAAGG + Intronic
983267335 4:165521662-165521684 ATATATATGTATATATATAAAGG + Intergenic
983307485 4:166010550-166010572 ATATATATAAATATAAATATTGG + Intronic
983312481 4:166082261-166082283 TTTTATATGAATATGATCCATGG - Intronic
983357038 4:166675811-166675833 TTTTATATTAAAAAAAAAAAAGG - Intergenic
983374225 4:166903078-166903100 AATTAAATAAATATAAATAAAGG - Intronic
983390150 4:167120039-167120061 TTTTATGTTTCTATAAATAAGGG + Intronic
983442807 4:167809140-167809162 TTTTCTATGATAATAAATATGGG + Intergenic
983448580 4:167882512-167882534 TATTATATCATCATAAATAATGG + Intergenic
983504299 4:168536023-168536045 TTTTTTATCAAAACAAATAAAGG - Intronic
984128507 4:175842838-175842860 TTTAATATGAATTGAATTAATGG + Intronic
984178380 4:176449294-176449316 TATTAAATGACAATAAATAAAGG - Intergenic
984510917 4:180677736-180677758 TTGTATATAAAAGTAAATAAAGG + Intergenic
984750472 4:183268075-183268097 TTTCATATCAATATTAATTATGG - Intronic
984969495 4:185174944-185174966 TATTATAAGAAAATAAATATGGG - Intronic
984989542 4:185366073-185366095 TTTAATATGTTTATAAAAAAAGG + Exonic
985239476 4:187914844-187914866 TTTTATATTAATAAAAATTCTGG - Intergenic
985408683 4:189661509-189661531 TCTTATTTGAATCCAAATAAAGG - Intergenic
985756099 5:1718956-1718978 TTTTATGGGTATATGAATAAAGG - Intergenic
985934308 5:3083137-3083159 TTTTATATGATTGTATATTAAGG - Intergenic
986390474 5:7281278-7281300 TTATATATAAATATAAAGATGGG - Intergenic
986500827 5:8397715-8397737 TTTTCTATGGAAAGAAATAATGG + Intergenic
986822929 5:11488176-11488198 TTTTGAAAGTATATAAATAATGG - Intronic
986875363 5:12100950-12100972 TGTTAAATAAACATAAATAAAGG + Intergenic
987139088 5:14927382-14927404 GTTTAAATGAACCTAAATAATGG + Intergenic
987608106 5:20165582-20165604 TATTGGATGAATTTAAATAAAGG - Intronic
987638174 5:20574222-20574244 TTTAATTAAAATATAAATAAGGG + Intronic
987712201 5:21514987-21515009 ATTTATATGAATATGTATATAGG + Intergenic
987787144 5:22515548-22515570 TTCTAAATAATTATAAATAATGG - Intronic
987813822 5:22874494-22874516 TTTTCTAAGAACGTAAATAAAGG + Intergenic
987843395 5:23250531-23250553 TTTTATAAGTATATAAATTCAGG - Intergenic
987888032 5:23836446-23836468 TTTTATATGAATTTTAAAATAGG - Intergenic
987922520 5:24302105-24302127 TTATGTATGCATATACATAAAGG + Intergenic
987979978 5:25071231-25071253 TGTGATATGAATATAAATAAAGG - Intergenic
987989105 5:25187858-25187880 TTTTAAATAAATTTGAATAATGG + Intergenic
988198403 5:28038051-28038073 TTTTAAATGAAGACAAATATAGG + Intergenic
988220924 5:28346258-28346280 TTTTAAAATATTATAAATAATGG + Intergenic
988249266 5:28734182-28734204 ATTTATTTGCATAAAAATAAAGG + Intergenic
988262845 5:28911299-28911321 TTTTATATGAATATTGATTCAGG + Intergenic
988302208 5:29445800-29445822 ATTTATATGAATATGTATATAGG - Intergenic
988387416 5:30583197-30583219 TTATATATATATATATATAAAGG - Intergenic
988436972 5:31187560-31187582 TTTTGTTTGAACATAAATTAAGG + Intergenic
988667539 5:33346032-33346054 TGTTATATGAAGACAAAAAAAGG - Intergenic
989117845 5:37973410-37973432 TTTTATAGGAATATATACTAAGG - Intergenic
989283399 5:39670584-39670606 ATTTATTTGCATATGAATAAAGG - Intergenic
989299618 5:39874937-39874959 TTTTATATGTCTATTATTAAAGG + Intergenic
989393722 5:40930062-40930084 TGTTATGGGAATATAGATAAGGG - Intronic
989416647 5:41185273-41185295 CTTTATATACATATAAATACAGG - Intronic
989558360 5:42823201-42823223 TTATATATGCATGTATATAAAGG + Intronic
990540868 5:56771313-56771335 TTTCTTATGAATAAAGATAAGGG + Intergenic
990647750 5:57863701-57863723 TGTTTTATTAAAATAAATAAAGG + Intergenic
990749399 5:58997185-58997207 TTTTATATGGATAGCAAAAAAGG - Intronic
990801776 5:59612349-59612371 TCGTATTTGAATATAAATATGGG + Intronic
990892967 5:60667527-60667549 TTTTACATATATATAAAAAATGG + Intronic
990892970 5:60667601-60667623 TTTTACATATATATAAAAAATGG + Intronic
990892975 5:60667719-60667741 TTTTACATATATATAAAAAATGG + Intronic
990892976 5:60667745-60667767 TTTTACATATATATAAAAAATGG + Intronic
990892977 5:60667771-60667793 TTTTACATATATATAAAAAATGG + Intronic
990892978 5:60667797-60667819 TTTTACATATATATAAAAAATGG + Intronic
990892990 5:60668083-60668105 TTTTATATATATATATAAAATGG + Intronic
990892991 5:60668109-60668131 TTTTATATATATATATAAAATGG + Intronic
990892995 5:60668205-60668227 TTTTATATATATATATAAAATGG + Intronic
990892996 5:60668231-60668253 TTTTATATATATATATAAAATGG + Intronic
991358894 5:65799596-65799618 TTTAAGATGAAAACAAATAAAGG - Intronic
991575047 5:68093887-68093909 TTTTATATGTATATAAAGTGAGG + Intergenic
991762562 5:69934123-69934145 ATTTATATGAATATGTATATAGG + Intergenic
991784763 5:70183983-70184005 ATTTATATGAATATGTATATAGG - Intergenic
991841790 5:70809173-70809195 ATTTATATGAATATGTATATAGG + Intergenic
991877211 5:71184376-71184398 ATTTATATGAATATGTATATAGG - Intergenic
992582056 5:78189452-78189474 TTTTTAATGACTATAATTAAAGG + Intronic
992645297 5:78806115-78806137 TTTTATAATAATAACAATAAAGG - Intronic
992679307 5:79138045-79138067 ATGTATATGAATATATATATTGG + Intronic
992950746 5:81855316-81855338 TAGTATATGAAATTAAATAATGG + Intergenic
993097393 5:83495531-83495553 TTTTAAATCAATTAAAATAAAGG - Intronic
993558240 5:89368381-89368403 CTTTATATGAAAATAAAAAAAGG - Intergenic
993792122 5:92221637-92221659 TTTTATTTTTATATATATAAGGG - Intergenic
993811160 5:92477946-92477968 TTTTATATTTATATAAAAATGGG + Intergenic
994045150 5:95300083-95300105 TTTTGTTTGAAAATAAATGATGG + Intergenic
994108192 5:95969734-95969756 TATTATATGAAAAGAAACAAGGG + Intergenic
994219331 5:97176644-97176666 ATTTATATGTATATTAAAAATGG - Intronic
994459051 5:100050626-100050648 TATAATATTTATATAAATAAGGG + Intergenic
994488774 5:100414705-100414727 TTTTACATAAATGTAAATTAAGG - Intergenic
994871386 5:105353562-105353584 GTTTGTATGAATATTAAAAATGG - Intergenic
994874975 5:105409670-105409692 ATATATATGACAATAAATAAAGG - Intergenic
994940985 5:106323927-106323949 TTTCATATGAATACAATTCACGG + Intergenic
995314961 5:110759273-110759295 TTTTTTAAGAAGATAAGTAAAGG + Intronic
995324411 5:110874140-110874162 TTCTATAAGACTATAGATAATGG - Intergenic
995454144 5:112334115-112334137 CTTTATTTTAATATTAATAATGG - Intronic
995925085 5:117362835-117362857 TTTTAAATAAATAGAAATAAGGG - Intergenic
995982165 5:118117522-118117544 TTGTATATGAGTAGAAATTATGG + Intergenic
996150970 5:120034545-120034567 TTATGCATGAATATAATTAATGG - Intergenic
996162907 5:120188516-120188538 TTTCATAAAAATATAACTAAAGG + Intergenic
996170073 5:120279590-120279612 TTTTATATTAAAGTAAATAAGGG - Intergenic
996172054 5:120305529-120305551 TTTTAAATAAAGACAAATAAAGG + Intergenic
996249056 5:121304281-121304303 CTTTATATAATTATACATAAAGG + Intergenic
996488370 5:124063641-124063663 AATTATATGAATATATATATAGG + Intergenic
996526085 5:124481256-124481278 TTTTTTATGAATATAACCAAGGG + Intergenic
996963068 5:129274535-129274557 ATTTATATGAATATGGGTAATGG - Intergenic
997507362 5:134428035-134428057 TTTTATATGAACACAAGTAATGG - Intergenic
997536075 5:134622765-134622787 TATTATATAAATAAAATTAAAGG + Intronic
997879520 5:137576954-137576976 TTATCTAAGAATAAAAATAAAGG + Intronic
998126973 5:139630856-139630878 TTTAATATGAAAATAACTGAAGG + Intergenic
998583995 5:143406136-143406158 ATATATATGTATATAATTAAGGG + Intronic
998619150 5:143775174-143775196 CTTTATATGAATACTAATGAGGG - Intergenic
998727338 5:145032579-145032601 TTTTATGTAAATTTAAATTATGG - Intergenic
998732193 5:145091451-145091473 TTTTATACTTCTATAAATAAAGG + Intergenic
998733362 5:145106648-145106670 TTTTATCTCAATATTAATAAGGG + Intergenic
998903800 5:146881844-146881866 TTTAATATGAATTTTAAGAAGGG - Intronic
999544476 5:152611994-152612016 TTGTATATGAGAATATATAAGGG + Intergenic
999601958 5:153276751-153276773 TTTTTTAAAAATAGAAATAATGG - Intergenic
999714475 5:154349099-154349121 ATTTAAAATAATATAAATAAAGG - Intronic
999852983 5:155562953-155562975 TTGTTTATGAATAGTAATAATGG - Intergenic
999884370 5:155904519-155904541 TTTTATTTTAAAATATATAATGG + Intronic
999918531 5:156290767-156290789 TCTGAGATGAATATAAAAAATGG + Intronic
1000125085 5:158236241-158236263 ATTTATATATATATCAATAAAGG - Intergenic
1000315302 5:160084918-160084940 TTTTAAGTGAATCTAAATGAGGG + Intronic
1000512695 5:162203540-162203562 ATATATCTGAATACAAATAATGG + Intergenic
1000735753 5:164898078-164898100 GTTTATATCAATATAATGAAAGG - Intergenic
1000769156 5:165330009-165330031 TTTTAAATGAATATAATAATTGG + Intergenic
1000790422 5:165600046-165600068 TTATAAATGAATATGATTAAAGG - Intergenic
1000874320 5:166617647-166617669 TTTTTGAGGAATATAAAAAATGG + Intergenic
1000934050 5:167286814-167286836 TTTTATGTAAATATTAATAAAGG - Intronic
1001343649 5:170870182-170870204 TTATATATGAAAATAAAAAGGGG - Intronic
1001345267 5:170890438-170890460 TTTAATATTAATAAAAATTAAGG + Intronic
1001379078 5:171290967-171290989 TTTTATATGTAAAGAAAGAAAGG + Intronic
1002390021 5:178903325-178903347 ATTTTTTTGAATATAAATATTGG + Intronic
1002550966 5:179991743-179991765 TTTAATAATAATAGAAATAAAGG - Intronic
1003000036 6:2323307-2323329 TTTTTTCTTAATATAACTAAAGG + Intergenic
1003084501 6:3050922-3050944 TTTTATAACAATAAAAATATTGG + Intergenic
1003097357 6:3153163-3153185 ATTTATTTGAAAATAAATTATGG - Exonic
1003167354 6:3692320-3692342 TTAAATATAAATATAAATAGAGG + Intergenic
1003347039 6:5279587-5279609 TTTTATATATATATAAAATAAGG + Intronic
1003434532 6:6073549-6073571 TTTTATTTAAATGTAAATAAGGG + Intergenic
1003942155 6:11040440-11040462 TTTTCTATGAAAAAAAACAATGG + Intronic
1004637730 6:17485190-17485212 TTTTATGTGAATATTTATGAGGG + Intronic
1004793395 6:19053686-19053708 TTTTAAATCAATAAAAATGAAGG + Intergenic
1004967408 6:20869800-20869822 TGTTATATGAATATATACTATGG - Intronic
1005150077 6:22738760-22738782 TTTGAAAGGAATAAAAATAAAGG + Intergenic
1005169506 6:22966506-22966528 TTTTATAGGAAAAAAAATCATGG + Intergenic
1005466359 6:26118908-26118930 TAAGATATGAATATAAATCATGG + Intronic
1006664647 6:35683722-35683744 TTTTATAAGATTAAAAATATAGG - Intronic
1006776719 6:36598690-36598712 TTTTATATTAGTAAAAATAAGGG + Intronic
1006962360 6:37946083-37946105 TTTTAGATGGACATAAATACAGG + Intronic
1007288939 6:40769656-40769678 TTTCATATGAAAACAAATATGGG - Intergenic
1007633367 6:43284668-43284690 TTTCATATTAATATAAACATAGG + Intronic
1008135075 6:47765758-47765780 ATTGATATGAAAATAAATCAAGG + Intergenic
1008164639 6:48121162-48121184 GTATATATGAATACAAATACAGG + Intergenic
1008235503 6:49042550-49042572 TATTTTTTGAATATAAAAAATGG - Intergenic
1008253675 6:49271563-49271585 ATTTAATTGAATATAAACAAAGG - Intergenic
1008255329 6:49292846-49292868 TTTAATAAGAATATAAAGAATGG + Intergenic
1008374012 6:50770687-50770709 TTTTATAATAATACAAATGAAGG - Intronic
1008374466 6:50775977-50775999 TTTAATATTATGATAAATAATGG + Intergenic
1008662821 6:53686058-53686080 ATATATATGAAGATAAATATAGG - Intergenic
1008873113 6:56296263-56296285 TTTTAAATGAAGATAAGAAATGG + Intronic
1009005506 6:57781708-57781730 ATTTATATGAATATGTATATAGG - Intergenic
1009293267 6:61910977-61910999 TTTTATATACTTTTAAATAAAGG - Intronic
1009322248 6:62306935-62306957 CTTTATATGCATAAAAGTAAAGG - Intergenic
1009522556 6:64701822-64701844 TTTTATTTGAATAAATTTAAGGG - Intronic
1009598669 6:65769612-65769634 TTAAATATAAGTATAAATAAGGG - Intergenic
1009690222 6:67020644-67020666 TATTATCTGGATATAGATAAAGG - Intergenic
1009753641 6:67905306-67905328 TTTTATATGAGTAAATTTAAAGG - Intergenic
1009868288 6:69425075-69425097 TTTCCTATGAAGATAAATATTGG + Intergenic
1009963669 6:70554922-70554944 TTTTATGAAAATATAATTAATGG - Intronic
1010284131 6:74055396-74055418 TTTTATATGACTCTTAAGAATGG + Intergenic
1010297140 6:74211475-74211497 TTTTATAGAAATATAATTAATGG - Intergenic
1010381318 6:75228646-75228668 TTTAAGATCAATATAAATATTGG - Intergenic
1010517204 6:76787634-76787656 TTTTATATGAAAATACATTATGG + Intergenic
1010535788 6:77028272-77028294 TTTTATATATATATATATATAGG + Intergenic
1010907761 6:81513669-81513691 TTTTCTATAATTTTAAATAAAGG - Intronic
1011106339 6:83785886-83785908 TGTTATATGATTATGAAGAATGG + Intergenic
1011231069 6:85162824-85162846 TATTATATGAAGAAAGATAATGG + Intergenic
1011950975 6:92964083-92964105 CTTTATATAAATAAAAACAATGG + Intergenic
1012079671 6:94740004-94740026 TTTTTTATTAATCTAGATAATGG - Intergenic
1012084916 6:94812345-94812367 ATTTATAGCAATATATATAATGG + Intergenic
1012165770 6:95949682-95949704 TATTATATTAATTTATATAAAGG + Intergenic
1012245939 6:96925336-96925358 TTAAATATCAAAATAAATAACGG - Intronic
1012323572 6:97884491-97884513 ATTTTTATGGATATAAATAAAGG + Intergenic
1012601101 6:101097994-101098016 TATTATATTTATATATATAAAGG - Intergenic
1012797747 6:103784762-103784784 TTTGATCTGATTATTAATAAGGG - Intergenic
1012984200 6:105857561-105857583 GTTTTTGTGAATATAAGTAAAGG + Intergenic
1013083699 6:106836162-106836184 TTTTGTATGAATATTCATCAGGG + Intergenic
1013398698 6:109770024-109770046 TTTAAAATGAATAGAAAAAAGGG - Intronic
1013665505 6:112343286-112343308 TTTTAGAGGAACAAAAATAAAGG + Intergenic
1014050195 6:116943569-116943591 TTTTAAATTTATATAAATACTGG - Intergenic
1014099673 6:117497850-117497872 TATAATATGAATACATATAAAGG - Intronic
1014189519 6:118477143-118477165 AGTTTTATGGATATAAATAAGGG + Intronic
1014353970 6:120380793-120380815 TTATAAATGGATAAAAATAAAGG + Intergenic
1014447106 6:121541261-121541283 TTTTAAAAGAATATAAAATATGG + Intergenic
1014456611 6:121642357-121642379 ATATATATGAATATATATAAAGG + Intergenic
1014504408 6:122236056-122236078 TTTATTATTAATACAAATAATGG + Intergenic
1014513701 6:122356292-122356314 ATTTATAAGAATATAAAAATGGG + Intergenic
1015076203 6:129161267-129161289 TTTTAAATGAAAATAAAGATAGG - Intronic
1015099630 6:129461017-129461039 TTTTATATAAAAATGAATACAGG + Intronic
1015111974 6:129602984-129603006 TTATATATATATATATATAAAGG - Intronic
1015122781 6:129719117-129719139 ACTTATATGAAAAAAAATAATGG - Intergenic
1015462595 6:133509918-133509940 TTTTCTAAAAATGTAAATAATGG + Intronic
1015467353 6:133561639-133561661 TTTTATATATATATATATATAGG + Intergenic
1015814950 6:137199271-137199293 TTTCATATATATATATATAAAGG - Intronic
1016014512 6:139170169-139170191 TTTTTTATGAAGATGAATATGGG + Intronic
1016194890 6:141322974-141322996 TTATACATGATTATAAATATAGG - Intergenic
1016207630 6:141488961-141488983 TTTTATCAGTATATATATAATGG + Intergenic
1016337441 6:143022649-143022671 TTTAATATTAATATGACTAAGGG + Intergenic
1016596073 6:145802855-145802877 GATTATCTGAATAAAAATAAAGG + Intronic
1016718219 6:147259099-147259121 TTTTAAAAATATATAAATAATGG - Intronic
1016762215 6:147750289-147750311 TTTTAGATGAATGCAAATACAGG + Intergenic
1016788039 6:148035052-148035074 ATATATATGAATATATATAAAGG - Intergenic
1016998940 6:149982155-149982177 ATATATATGAATATAAAGATGGG + Intergenic
1017331647 6:153206158-153206180 TTTGAGATGAATAAAAATATTGG + Intergenic
1017493475 6:154964318-154964340 ATATACATGATTATAAATAATGG - Intronic
1018218684 6:161557314-161557336 TATTTTAAGAATTTAAATAATGG + Intronic
1018527682 6:164731383-164731405 TTTTATAAGAACACAATTAATGG - Intergenic
1018654515 6:166021108-166021130 ATATATATGTATATATATAATGG + Intergenic
1020312033 7:6875559-6875581 CTTAATATGAATATTAATATCGG + Intergenic
1020423174 7:8033726-8033748 ATTTATAAGGATTTAAATAATGG + Intronic
1020561334 7:9731454-9731476 TTTGGTATGAATATAAAATATGG - Intergenic
1020643912 7:10790497-10790519 TTCTGTAAGAATTTAAATAAAGG - Intergenic
1020969136 7:14912083-14912105 TTTTATTGGAATATAAATAGAGG + Intronic
1021048408 7:15952247-15952269 TTTTATATGAATAGGAAAGAAGG - Intergenic
1021049388 7:15964035-15964057 TAATATATAAATATAAAAAAAGG + Intergenic
1021063397 7:16142360-16142382 TTGTACATTAATTTAAATAATGG + Intronic
1021164341 7:17317126-17317148 TTTTTTTTGAATATGCATAAGGG + Intronic
1021304701 7:19018135-19018157 TTTAATATGACTTTCAATAATGG + Intergenic
1021399801 7:20196584-20196606 TTTTATATATATATATAAAATGG - Intronic
1021471668 7:21009581-21009603 TTTTATATGATGACAGATAAGGG - Intergenic
1021609940 7:22446973-22446995 TTTTATAGGAATATAGCTTAAGG + Intronic
1021956262 7:25827702-25827724 TTGTATATGATGAGAAATAAGGG - Intergenic
1022068254 7:26883541-26883563 TTTTATACCAATATAAATAAAGG + Intronic
1022079888 7:27009263-27009285 ATATATATGTATATATATAAAGG - Intergenic
1022153888 7:27639727-27639749 TTTTAAATTAAAAAAAATAAAGG + Intronic
1022162864 7:27729040-27729062 TTTTATATAAACAATAATAATGG + Intergenic
1022296747 7:29062832-29062854 TTTTGTATGAATTAGAATAAAGG - Intronic
1022395025 7:29979919-29979941 TTTCATAGAAATATAAAGAAAGG + Intronic
1023203490 7:37723338-37723360 TTTTATATTAATAAAAAAAGAGG - Intronic
1023279845 7:38558025-38558047 TGTTATATGAAGAAAAATACAGG + Intronic
1023369764 7:39501590-39501612 GTTTATCTGAGTATAAACAAAGG - Intergenic
1023528758 7:41131734-41131756 TTTAATATGATCATAGATAAAGG + Intergenic
1023725563 7:43139663-43139685 TTTTGAATGAAAAGAAATAAGGG - Intronic
1024172756 7:46807393-46807415 TTTTTTGTTGATATAAATAATGG - Intergenic
1024175387 7:46835218-46835240 GTTCATACTAATATAAATAAAGG + Intergenic
1024456972 7:49619438-49619460 TTTGAAATGAATGAAAATAACGG + Intergenic
1024614292 7:51096164-51096186 TCTTTTCTGACTATAAATAATGG + Intronic
1024747240 7:52422198-52422220 TTATATATGCATATAATAAAGGG + Intergenic
1024815235 7:53261420-53261442 GTTCATATGAACATAAAGAATGG + Intergenic
1024820259 7:53320604-53320626 TTTAATATAAAAATAAATCATGG - Intergenic
1024874009 7:54000161-54000183 TATTATATTAATATAATTACAGG + Intergenic
1025060938 7:55806792-55806814 TTTCATATAAATACAAAAAATGG + Intronic
1025145460 7:56497203-56497225 GTATATATGAATATAATTATGGG + Intergenic
1025152107 7:56565676-56565698 TTCTATATAAAAATATATAAGGG + Intergenic
1027609299 7:80339599-80339621 TTTCATATTAATATTAATATAGG - Intergenic
1027665616 7:81040335-81040357 TTTTATATGTATACTAATTATGG + Intergenic
1027730217 7:81861657-81861679 CTATATATCAATAAAAATAAAGG + Intergenic
1027752974 7:82174583-82174605 TTTTATAGGAATCTAAAGAATGG - Intronic
1027921546 7:84401829-84401851 TTTTATATGATGACAGATAAAGG - Intronic
1027923307 7:84425412-84425434 ATTTATATTCATATAAATATAGG - Intronic
1027923308 7:84425417-84425439 ATTTATATGAATATAAATATAGG + Intronic
1028014499 7:85689914-85689936 TGCTATATGTATATAAGTAAGGG - Intergenic
1028021976 7:85788382-85788404 TTTTAGATAAATTAAAATAATGG + Intergenic
1028067735 7:86408611-86408633 TTAAATATGAATAATAATAATGG + Intergenic
1028082499 7:86595872-86595894 TTGTATAAGAAAATAAGTAAAGG - Intergenic
1028348637 7:89815799-89815821 TTTTAAATTAATTTAAATGATGG + Intergenic
1028478615 7:91279444-91279466 TTTTAGAAGAATATAAAGGATGG - Intergenic
1028514907 7:91667036-91667058 TTTGATATCCATATAAATCATGG - Intergenic
1028515726 7:91676201-91676223 TTTTATAGGTATATCAATCATGG + Intergenic
1028778819 7:94711477-94711499 TTTTATAACAATATAAATTTAGG + Intergenic
1028861272 7:95653421-95653443 TTTTATATGGTAAAAAATAATGG + Intergenic
1029020606 7:97361175-97361197 TTTTACATGAGAACAAATAATGG - Intergenic
1029415243 7:100438692-100438714 TTTTATATGATTATATTAAAAGG + Intergenic
1029929270 7:104353491-104353513 ATTCATTTGTATATAAATAAAGG + Intronic
1029974386 7:104819002-104819024 CTTTATGAGAATATAAATCATGG + Intronic
1030229234 7:107188394-107188416 AATCAAATGAATATAAATAAAGG - Intronic
1030728820 7:112959683-112959705 TTTTATCTGAATTTTAAAAATGG - Intergenic
1030777927 7:113558968-113558990 TTTAATATAAATATGACTAAAGG + Intergenic
1030790970 7:113728361-113728383 ATTTATGTGGATATAACTAAGGG - Intergenic
1030870365 7:114748171-114748193 TTTTAGAGGAATATTAAAAATGG - Intergenic
1030969363 7:116035160-116035182 TTTTTTATGATTATAAATAAAGG - Intronic
1030985971 7:116242714-116242736 TTTAAAATTAATATAAATCATGG - Intronic
1031140263 7:117935025-117935047 ATGTATATGTATATAGATAAGGG + Intergenic
1031313677 7:120231065-120231087 TTTTATATTCATAGAAACAATGG + Intergenic
1031506445 7:122590582-122590604 TTATATATGAATATATATGAAGG - Intronic
1031643398 7:124193301-124193323 ATATATATAAATATATATAAAGG + Intergenic
1031778015 7:125925175-125925197 TACTATAGGAATATAAAGAATGG + Intergenic
1032166139 7:129546599-129546621 TTTTGTATGAGTATAGAGAAAGG - Intergenic
1032278218 7:130478804-130478826 TTTTAAATTTTTATAAATAAAGG + Intergenic
1032924094 7:136581984-136582006 TTATATATTTATATATATAAAGG - Intergenic
1032937107 7:136745635-136745657 TCTTATATGGTTATAGATAAGGG - Intergenic
1032961334 7:137038158-137038180 TTTTTAATGAAAATAAATCATGG + Intergenic
1033188504 7:139253204-139253226 TTTTATGTGCATACAAATAACGG + Intronic
1033463961 7:141574019-141574041 TTGTATATGCAAATACATAATGG + Intronic
1033593345 7:142833733-142833755 TTTTATGTAAATATAATTCAAGG - Intergenic
1033647130 7:143314170-143314192 GTGTATATAAATATATATAATGG - Intergenic
1033918171 7:146353873-146353895 TTGTAAATCAATTTAAATAAAGG - Intronic
1033922841 7:146416137-146416159 TTTTATATGTAATGAAATAAAGG - Intronic
1033974648 7:147086132-147086154 TTTAATATGAATATTTTTAAAGG + Intronic
1033993483 7:147316652-147316674 TTTTGAAAGAATATAAATAATGG + Intronic
1034047498 7:147945686-147945708 TTATATATATATATATATAAAGG - Intronic
1034484949 7:151354143-151354165 TTATATAGGAAGAAAAATAAAGG - Intronic
1034725049 7:153328074-153328096 TTGAACATGAAAATAAATAATGG - Intergenic
1034763834 7:153698451-153698473 TTTTATATATATATATATGAAGG - Intergenic
1034781382 7:153886019-153886041 TTTTTTGTGAATGTAAATAATGG + Intergenic
1034822406 7:154228663-154228685 TTTTTTAATAATATATATAAGGG + Intronic
1034855657 7:154544151-154544173 TTTTATATATATATATATAGTGG + Intronic
1035915698 8:3619522-3619544 ATAGATATGAATTTAAATAAAGG + Intronic
1036067684 8:5401375-5401397 TTTTATATGTGAATAAACAAGGG - Intergenic
1036074586 8:5481448-5481470 TTTGATATAAAAATAAATAAAGG + Intergenic
1037005364 8:13772278-13772300 TTTTATATGAAAATCAAAAAAGG + Intergenic
1037135246 8:15452406-15452428 TTCCATATGAATTTAATTAAAGG - Intronic
1037267504 8:17081491-17081513 TTTTATATGGATATCTACAAAGG + Intronic
1037391832 8:18401066-18401088 TTTCAAATTAATAAAAATAAAGG + Exonic
1038299733 8:26332460-26332482 TTTTAAAAAAATAAAAATAAAGG - Intronic
1038886713 8:31670635-31670657 TTTCATATGAATATCAAGATTGG + Intronic
1038908695 8:31937481-31937503 TTTTATTTGAATTTAAAAAATGG + Intronic
1038923108 8:32108039-32108061 ATCTATATGAATATATATATAGG + Intronic
1038954742 8:32455336-32455358 CTTTTTATGCCTATAAATAAAGG + Intronic
1039365968 8:36928151-36928173 TTTTATATTGAGAAAAATAATGG - Intronic
1039482576 8:37885618-37885640 TGTTTTATGAAGAGAAATAAGGG + Intronic
1039925089 8:41922649-41922671 ATTTATATGAATACCAAGAAGGG - Intergenic
1040047574 8:42979104-42979126 TATTATAAAAATAAAAATAATGG + Intronic
1040615729 8:49036448-49036470 TTGTATATGGAGATACATAAGGG - Intergenic
1040657371 8:49527181-49527203 TTTTATAAGAATATTCATATTGG - Intergenic
1040759381 8:50820526-50820548 TTTTACATAAATATTTATAAGGG + Intergenic
1040816879 8:51517990-51518012 TATTATATGAAGATAAATTAAGG - Intronic
1040909049 8:52499800-52499822 TTTTTTATGAATATCTTTAAAGG + Intergenic
1040941592 8:52839612-52839634 TTTTATAGATATATAAATATAGG - Intergenic
1041081729 8:54221004-54221026 TTTTATGTGAATATAAAGATAGG - Intergenic
1041467397 8:58170482-58170504 ATTTATATGTGTATAAATTAGGG + Intronic
1041529369 8:58846225-58846247 TTTTTTTTTAAAATAAATAAGGG + Intronic
1041594728 8:59635310-59635332 TGTTATATGAATATTCATAATGG + Intergenic
1041615830 8:59905617-59905639 TTTGATATGATTATGAATACAGG - Intergenic
1041797295 8:61758938-61758960 TTTTACATAAAAATCAATAAAGG - Intergenic
1041807535 8:61869149-61869171 TTTTATATTTATAGAATTAATGG - Intergenic
1042005108 8:64170944-64170966 CTTTTTATAAATATAAATTATGG - Intergenic
1042605901 8:70546309-70546331 ATTTGTAAGAATACAAATAATGG + Intergenic
1042754815 8:72199323-72199345 TTTTATATGAACAAAAAAAAAGG - Intergenic
1042870636 8:73395374-73395396 TTTGATGTGAATATAAATGAAGG + Intergenic
1043006172 8:74821373-74821395 TTTTATATGAAAAAAAAAATGGG - Intronic
1043018156 8:74967195-74967217 CTTTGTATTTATATAAATAAAGG + Intergenic
1043221285 8:77668465-77668487 TTTTATATGAATATGATGTATGG + Intergenic
1043354465 8:79396039-79396061 ATTTACATGAAAATAAAAAATGG + Intergenic
1043416287 8:80053921-80053943 TTTGATATGAGTATATATACTGG + Intronic
1043453829 8:80394271-80394293 TATCATAGGAATATAAATATAGG - Intergenic
1043566174 8:81550770-81550792 TTTTCTGTGAGTAGAAATAAAGG - Intergenic
1043594352 8:81866413-81866435 TTGTAAATGAATAAAAATTAAGG + Intergenic
1043687352 8:83104142-83104164 CTTTACATGACTCTAAATAATGG + Intergenic
1043689321 8:83130851-83130873 TCTTACATGAATATTCATAAAGG - Intergenic
1043698789 8:83256841-83256863 TTTTATGTAAATTTAAACAAAGG - Intergenic
1043710806 8:83416008-83416030 TTTTTTTTTAATATATATAAAGG - Intergenic
1043766441 8:84139846-84139868 TTTATTATAAATATTAATAAAGG + Intergenic
1043821334 8:84869013-84869035 TTATATATATATATAAAGAAAGG + Intronic
1043822672 8:84887881-84887903 TCTTATATGCATATATTTAAGGG + Intronic
1044269164 8:90220539-90220561 TTAAATATGAATACAAAGAAGGG + Intergenic
1044362037 8:91297016-91297038 TTTTAAATGAATAGAAATTAAGG - Intronic
1044364601 8:91328900-91328922 TTTTATATCATTATAATAAATGG + Intronic
1044421154 8:91997211-91997233 TTTTATATAAATGTTACTAAAGG - Intronic
1044528751 8:93283416-93283438 TATCATATGAATATGAAGAAGGG + Intergenic
1044769296 8:95613006-95613028 TTGTATATGAAAATAAAGCAGGG + Intergenic
1045163465 8:99575803-99575825 TTTTATTTTAGTCTAAATAATGG + Intronic
1045744031 8:105395635-105395657 TTTTATATAATTATTAAGAAAGG + Intronic
1046053405 8:109050785-109050807 TTATATTTGAATATTCATAACGG + Intergenic
1046066164 8:109199193-109199215 TTTTAAATGAATTTAAAGTATGG + Intergenic
1046121427 8:109852215-109852237 TTTTGTGTGATTATAAAGAATGG + Intergenic
1046198879 8:110895775-110895797 TTTTATATTTATAAAAATAATGG + Intergenic
1046237452 8:111444556-111444578 TTTTAAGTGAATTTAAATATTGG - Intergenic
1046346215 8:112931413-112931435 TTTTATATGGTGAGAAATAAAGG - Intronic
1046487306 8:114903424-114903446 TATTATATGAGTATTAATTAGGG + Intergenic
1046516878 8:115274079-115274101 TTTTATATTAATCTAATAAAAGG + Intergenic
1046731648 8:117732556-117732578 TGTTATTTAAAAATAAATAAAGG - Intergenic
1046901447 8:119528066-119528088 TCATATATGTATATATATAAAGG + Intergenic
1047142034 8:122152469-122152491 TCTTATGTGAAAATAAATAGAGG + Intergenic
1047566877 8:126054441-126054463 TTTTACATAAATATAAGGAATGG + Intergenic
1048016626 8:130502730-130502752 ATTAATATAAATATAAATATAGG - Intergenic
1048155919 8:131951073-131951095 TTTTATTTTAAGATAATTAAAGG + Intronic
1048478368 8:134764057-134764079 TTTTATATTTATTTAAATAATGG - Intergenic
1048501619 8:134981129-134981151 TCTTATATATATATATATAAAGG + Intergenic
1048884199 8:138896191-138896213 TTTAACATGGATAAAAATAAGGG + Intronic
1049142496 8:140968273-140968295 TTTTAGATCAATATAAATCAGGG + Intronic
1050216079 9:3325508-3325530 ATTTAAATGTATATACATAAAGG + Intronic
1050602052 9:7262765-7262787 TATTATATGAAAATAATTACAGG + Intergenic
1050626161 9:7505841-7505863 AATTAGATGAATTTAAATAAAGG - Intergenic
1050677008 9:8067481-8067503 TTTTCTAGGAATAGAAAGAAAGG - Intergenic
1050767299 9:9150783-9150805 TTTTATATGAAAACAAACACTGG + Intronic
1050947711 9:11547669-11547691 TTTTATTTGAATATCATTAGGGG + Intergenic
1051845296 9:21445511-21445533 TTTTTAATGTATATATATAAAGG - Intergenic
1052161983 9:25273850-25273872 TTTTATATTAAAAGCAATAATGG + Intergenic
1052446566 9:28568994-28569016 TTTTCAATGAATACATATAAAGG + Intronic
1052600172 9:30617018-30617040 TATTATATGAATATTATAAAAGG - Intergenic
1053089127 9:35257287-35257309 TTTTTTATAAATATAAAAAATGG - Intronic
1053638855 9:40046800-40046822 GATTATATGATTATAATTAATGG - Intergenic
1054389274 9:64600147-64600169 TTTTTTATAATTATAAAAAATGG - Intergenic
1054545895 9:66329903-66329925 GATTATATGATTATAATTAATGG + Intergenic
1054817974 9:69494182-69494204 TTTTATATATATATTTATAATGG + Intronic
1054897117 9:70327045-70327067 TTTAATTTGAATGTAAATATCGG + Intronic
1055085466 9:72309190-72309212 TTTTATATTAATTTAAATGTAGG + Intergenic
1055092900 9:72380725-72380747 GTTTATATTAATATATATAATGG - Intergenic
1055442354 9:76348900-76348922 TTTTAAATGAAGAGAAATTAAGG - Intronic
1055732323 9:79291122-79291144 TTAGAAATAAATATAAATAAAGG - Intergenic
1055859593 9:80731558-80731580 ATTTTTATGAAAATAATTAAAGG - Intergenic
1056035855 9:82604635-82604657 TTCTATATGTATATGAATAATGG - Intergenic
1056053092 9:82790477-82790499 TTGTATACTATTATAAATAATGG - Intergenic
1056319001 9:85419102-85419124 TTTTATATACATATACATTATGG - Intergenic
1056451176 9:86718207-86718229 TCTTATATGAATATATTTTATGG + Intergenic
1058024916 9:100131808-100131830 TTATTTATGAATTTAAAAAAAGG - Intronic
1058103315 9:100940318-100940340 ATTTACATAAATATAAATAATGG + Intergenic
1058132809 9:101271890-101271912 TTTTAAAAAAATATAAAAAAGGG + Intronic
1058169537 9:101663608-101663630 TGTTATATGACAATCAATAAAGG + Intronic
1058312451 9:103520908-103520930 TATTATATGATTTTAAATAGAGG + Intergenic
1058346895 9:103974993-103975015 TTTATTATGAAGATAAATAATGG - Intergenic
1058364767 9:104195959-104195981 TTTTAGTAGAATAGAAATAATGG - Intergenic
1058369900 9:104254101-104254123 TTTTATGTGATTTTTAATAATGG - Intergenic
1058500997 9:105616272-105616294 TTTTTTATAATTATAAAAAAAGG - Intronic
1058644767 9:107120455-107120477 TTTTATATGAATATGATAACTGG - Intergenic
1059327838 9:113515008-113515030 TTTTATTTGAAAATAACTGAGGG + Intronic
1059814147 9:117892691-117892713 TTTTATATGACTAGAGACAATGG - Intergenic
1060126268 9:121050461-121050483 ATTTTTATTAATACAAATAAAGG + Intergenic
1060129800 9:121084945-121084967 TTTTATATGAAAACATTTAAAGG + Intronic
1060752184 9:126178742-126178764 TTTTATATCTATATTCATAAAGG + Intergenic
1060833585 9:126737634-126737656 TTTTACATGTATATTCATAAGGG - Intergenic
1061749014 9:132762538-132762560 ATTTAAATGAAAATAAATACAGG + Intronic
1062098223 9:134713649-134713671 TTTTATATGAAAAAAACTTAGGG + Intronic
1062596096 9:137300364-137300386 TTTTATAAAAATATAAATATGGG + Intergenic
1203485825 Un_GL000224v1:53568-53590 TTAAATCTGATTATAAATAATGG + Intergenic
1185487704 X:495907-495929 TTATATATTAATATAAATATAGG - Intergenic
1186278816 X:7970251-7970273 ATTGAAATGAAAATAAATAATGG + Intergenic
1186282182 X:8004486-8004508 TTCTACATAAATATGAATAAAGG - Intergenic
1186527241 X:10260008-10260030 TTTGATGTGAATACAAATAATGG + Intergenic
1186544793 X:10437678-10437700 TTTTATTTAAATAGGAATAATGG - Intergenic
1186748524 X:12596415-12596437 TTTGAAATGAATATAGGTAATGG + Intronic
1187497676 X:19809694-19809716 TTTTCCATGAATATTAATGATGG - Intronic
1187693965 X:21899610-21899632 ATTTATATATATATACATAAAGG + Intergenic
1187744001 X:22388334-22388356 TTTTAAATGGATATATAAAAGGG + Intergenic
1188208524 X:27390235-27390257 GTTTATATTAATATACATATTGG - Intergenic
1188211438 X:27429848-27429870 TTATTTATGAATACAAATCAAGG - Intergenic
1188510388 X:30929509-30929531 TTTTATATATATATATAAAATGG - Intronic
1188793100 X:34428720-34428742 ATGTATATGTATATAAATCATGG + Intergenic
1188972495 X:36634685-36634707 TTATATATGATGAGAAATAAGGG + Intergenic
1188990464 X:36812768-36812790 TTTTAAACGAATATATATAAAGG - Intergenic
1189009554 X:37033285-37033307 GTGTATATAAATATAAATATAGG + Intergenic
1189025870 X:37393686-37393708 TTTTGTTTAACTATAAATAAAGG - Intronic
1189076736 X:37923521-37923543 CTTTATATATATATAAAGAATGG + Intronic
1189469356 X:41301909-41301931 TTTTTAATCAAAATAAATAAAGG - Intergenic
1189837308 X:45039025-45039047 TCCTATAACAATATAAATAACGG - Intronic
1189946427 X:46184764-46184786 TTTTAAAGGTAAATAAATAAGGG + Intergenic
1190566883 X:51739517-51739539 TTATATATATATATAAAGAAAGG - Intergenic
1190659325 X:52640207-52640229 ATATATATAAATATACATAAAGG + Intergenic
1190996329 X:55613628-55613650 ATATATATGGATATATATAAAGG + Intergenic
1190996330 X:55613651-55613673 ATATATATGTATATATATAAAGG + Intergenic
1190996343 X:55613834-55613856 ATATATATGCATATATATAAAGG + Intergenic
1191159116 X:57308927-57308949 TTTAAGATGAATAAAAATTAGGG - Intronic
1191196806 X:57732695-57732717 TTTTATTTTAATAGAAAGAAGGG - Intergenic
1191741046 X:64435142-64435164 TTTTATATGCATATATTTTAGGG + Intergenic
1191909556 X:66133969-66133991 TTTTATATGGAGAGAAATATGGG + Intergenic
1192179148 X:68905112-68905134 TTATATATAAATATATATATAGG + Intergenic
1192306625 X:69967139-69967161 ATTTATAAGAATATAAAAAGTGG + Intronic
1192548634 X:72035614-72035636 TTTAAGATAATTATAAATAAGGG - Intergenic
1192747846 X:73957239-73957261 TTTTACCTGAATACAAATCAAGG + Intergenic
1192839479 X:74839166-74839188 TTTTAGGTAAAGATAAATAAAGG - Intronic
1192852236 X:74969283-74969305 TCTTATAGGAATATTAACAAAGG - Intergenic
1192975831 X:76284095-76284117 TTATATATGGAAAAAAATAAGGG - Intergenic
1192990177 X:76443995-76444017 TTGTATATGATGAGAAATAAGGG + Intergenic
1193116673 X:77782446-77782468 CTTTATATGCAAATAAATTAAGG + Intronic
1193149584 X:78110981-78111003 TTTTATATATATATATATATGGG + Intronic
1193339180 X:80325612-80325634 TTTTATATATATATAAAATAAGG - Intergenic
1193339182 X:80325660-80325682 TTTTATATATATATAAAATAAGG - Intergenic
1193339186 X:80325758-80325780 TTTTATATATATATAAAATAAGG - Intergenic
1193339191 X:80325881-80325903 TTTTATATATATATAAAATAAGG - Intergenic
1193339195 X:80325967-80325989 TTTTATATATATATAAAATAAGG - Intergenic
1193339196 X:80325990-80326012 TTTTATATATATATAAAATAAGG - Intergenic
1193339197 X:80326013-80326035 TTTTATATATATATAAAATAAGG - Intergenic
1193380881 X:80814574-80814596 TGTAATATGAATAATAATAATGG + Intergenic
1193598626 X:83480402-83480424 TTTTGTATGTATATACATTAGGG - Intergenic
1193687984 X:84602227-84602249 TTATATATGACTATAGATAGGGG + Intergenic
1194194448 X:90874632-90874654 TTATAAATGAATATCAATCATGG - Intergenic
1194225968 X:91257998-91258020 TTTTATTTGATTATATTTAAGGG + Intergenic
1194228342 X:91290423-91290445 TTTTATAGAAATAAAAAGAATGG + Intergenic
1194248758 X:91546582-91546604 TTTTATAGGAGTATAAGAAAGGG - Intergenic
1194325837 X:92515310-92515332 TCTTATGTGAATTTAAAGAAAGG + Intronic
1194395827 X:93384721-93384743 TTGTATACAAATATTAATAATGG + Intergenic
1194646446 X:96464110-96464132 TGTTATTTGAATATAAATTTGGG - Intergenic
1194736402 X:97517010-97517032 TTTTATATGCATATACATTGTGG + Intronic
1194790521 X:98142950-98142972 TTTTATCTGAAGAAAAAAAATGG + Intergenic
1194840366 X:98733117-98733139 CTTCTTATGAATATATATAAAGG - Intergenic
1194962187 X:100248484-100248506 TTTGATATGAAAATATTTAATGG + Intergenic
1195007480 X:100700504-100700526 TCTTCTATGTATATACATAACGG - Intronic
1195027397 X:100891013-100891035 TTAGAAATGAATAAAAATAAAGG - Intergenic
1195431333 X:104792773-104792795 TTTTATTTGAATTTATTTAAAGG + Intronic
1195462946 X:105147791-105147813 TTGTACATGAATATTCATAATGG - Intronic
1195504347 X:105639982-105640004 GTAGATATTAATATAAATAATGG - Intronic
1196046496 X:111261303-111261325 TTTTATATAAAGATATATAATGG + Intronic
1196225676 X:113163637-113163659 TTTTATATAAATTAGAATAAAGG + Intergenic
1196241470 X:113347090-113347112 ATTAATATGAATACAAATTAAGG + Intergenic
1196291056 X:113941666-113941688 TTTTGTATGTATATATACAATGG + Intergenic
1196715459 X:118806798-118806820 ATATTTATGTATATAAATAATGG + Intergenic
1197054985 X:122107434-122107456 TTATAAATAAATATTAATAATGG - Intergenic
1197137080 X:123073954-123073976 TTTTGTATAAAGACAAATAAAGG + Intergenic
1197321045 X:125031304-125031326 TTATAAATTAATATAAATTAAGG + Intergenic
1197341485 X:125276051-125276073 TTATATATGTATAAATATAATGG + Intergenic
1197579686 X:128266151-128266173 ATATATATGTATATAAATTAAGG + Intergenic
1198070080 X:133139575-133139597 TTTTATGAGAATATTTATAAAGG + Intergenic
1198385987 X:136130081-136130103 TATTATATAGATAAAAATAATGG + Intergenic
1198820848 X:140646597-140646619 TTTTAGATGAAATAAAATAAGGG - Intergenic
1198973231 X:142304661-142304683 TTTTATATGAAGATTAAAAGGGG + Intergenic
1199341179 X:146679158-146679180 GTTTATATAAATATATATAAAGG - Intergenic
1199622082 X:149711179-149711201 TTTTAATTGAAGATAAAGAATGG + Intronic
1200541065 Y:4457024-4457046 TTATAAATGAATATCAATCATGG - Intergenic
1200567768 Y:4788101-4788123 TTTTATAGGAGTATAAAAAAGGG - Intergenic
1200634559 Y:5634468-5634490 TCTTATGTGAATTTAAAGAAAGG + Intronic
1200832680 Y:7702919-7702941 TTTTACATTACAATAAATAAAGG - Intergenic
1200905906 Y:8482338-8482360 ATTTATATGAATTTAAATATAGG + Intergenic
1201586099 Y:15563023-15563045 TTTTACAAGAATATAAAGCAAGG - Intergenic
1201982325 Y:19921397-19921419 TTTTACATACATACAAATAATGG - Intergenic
1202345840 Y:23925502-23925524 TATTATGTGAATATAAGTAGTGG - Intergenic
1202524931 Y:25744588-25744610 TATTATGTGAATATAAGTAGTGG + Intergenic