ID: 1159549843

View in Genome Browser
Species Human (GRCh38)
Location 18:69883490-69883512
Sequence CTTGGTGCTCAGAGGACACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159549838_1159549843 3 Left 1159549838 18:69883464-69883486 CCCACCACATAGAGCAAAGCGCA 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1159549843 18:69883490-69883512 CTTGGTGCTCAGAGGACACCAGG 0: 1
1: 0
2: 0
3: 23
4: 216
1159549840_1159549843 -1 Left 1159549840 18:69883468-69883490 CCACATAGAGCAAAGCGCAAGAC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1159549843 18:69883490-69883512 CTTGGTGCTCAGAGGACACCAGG 0: 1
1: 0
2: 0
3: 23
4: 216
1159549839_1159549843 2 Left 1159549839 18:69883465-69883487 CCACCACATAGAGCAAAGCGCAA 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1159549843 18:69883490-69883512 CTTGGTGCTCAGAGGACACCAGG 0: 1
1: 0
2: 0
3: 23
4: 216
1159549837_1159549843 24 Left 1159549837 18:69883443-69883465 CCATCTTGCTTCTCATTATATCC 0: 1
1: 0
2: 0
3: 31
4: 307
Right 1159549843 18:69883490-69883512 CTTGGTGCTCAGAGGACACCAGG 0: 1
1: 0
2: 0
3: 23
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159549843 Original CRISPR CTTGGTGCTCAGAGGACACC AGG Intronic
900470994 1:2854886-2854908 CCCGGTTCACAGAGGACACCAGG + Intergenic
900471611 1:2857735-2857757 CCCGGTTCACAGAGGACACCAGG - Intergenic
900525256 1:3125395-3125417 CTGGGGGGTCAGAGGAGACCTGG - Intronic
900613472 1:3554063-3554085 CTTGTTCCCCACAGGACACCAGG - Intronic
900720775 1:4174517-4174539 CTTGGGGCACAGTGGGCACCTGG + Intergenic
904306338 1:29592637-29592659 CTTGATGCTCAGATGCCAGCAGG - Intergenic
905304522 1:37008207-37008229 CTTGGGGCTCAGAGGGCTCTAGG + Intronic
905479932 1:38254672-38254694 CTTGGTCCTGAGAGGAGATCTGG + Intergenic
905694649 1:39965680-39965702 CTTATTGCTCAGATGAGACCTGG + Intronic
906049802 1:42860770-42860792 CTTTGTGCTCAGTGGCCCCCAGG - Intergenic
906301292 1:44683652-44683674 CTTGGAGCACAGAGGAGAACAGG + Intronic
906673695 1:47678032-47678054 CTAGGTGCTCAGGAGACACAGGG + Intergenic
908626717 1:66052835-66052857 CTGGATTCTCAGAGGAAACCTGG - Intronic
913086542 1:115442583-115442605 CTTGCACCTCAGAGGACACTTGG + Intergenic
913114145 1:115681337-115681359 CTTGGTCCTCAGAGAGCAGCAGG - Intronic
914374813 1:147063630-147063652 TTTGGTGCTCAAGGGAAACCTGG + Intergenic
916477009 1:165179304-165179326 CTTGGTGCTGGGAGGAAACAAGG - Intergenic
923019338 1:230150852-230150874 CTTTGTGCTCAGAAGACAGCAGG - Intronic
923332171 1:232935308-232935330 CTTGTTGCTGTGGGGACACCTGG + Intergenic
923751944 1:236754486-236754508 CTTGGTGATCAAAGGACAACAGG - Intronic
1063968897 10:11367732-11367754 CTCGGTGCCCACAGGGCACCAGG + Intergenic
1066444752 10:35471630-35471652 CTTTGTGCTCAGCTGACACATGG + Intronic
1067450242 10:46377624-46377646 CTTTGTGCCTAGAGGACACTGGG - Intronic
1067554107 10:47255787-47255809 CTTGGAGCTCAGAGGAGAAAAGG + Intergenic
1067587000 10:47482139-47482161 CTTTGTGCCTAGAGGACACTGGG + Intronic
1067634060 10:47989906-47989928 CTTTGTGCCTAGAGGACACTGGG + Intergenic
1067682010 10:48447354-48447376 CATGTGGCTCAGAGGTCACCAGG - Intronic
1069916287 10:71789208-71789230 CTTTGTGCTCATAGGAGGCCCGG - Intronic
1070319536 10:75344133-75344155 CTTGGGGCTCAGGGGAAATCAGG + Intergenic
1070388968 10:75952110-75952132 CTTGGGGCTGAGGGGACCCCAGG - Intronic
1070688505 10:78507654-78507676 CTCTGTGCTCAGAGAACACTTGG + Intergenic
1073463359 10:103679232-103679254 CCTTGTCCTCAGAGGACTCCTGG - Intronic
1074513666 10:114143198-114143220 CTTTGAGCTCAGATGAAACCAGG - Intronic
1074720919 10:116264423-116264445 CTTGGTGCTGAGTTGACACCTGG + Intronic
1074766396 10:116703138-116703160 CTTGGTGTTCAGTTGCCACCAGG - Intronic
1076208072 10:128619017-128619039 TCTGGTGCTCAGAGCACACAAGG - Intergenic
1076885477 10:133260332-133260354 CCTGGTTCTCAGTGCACACCTGG - Intergenic
1076885483 10:133260386-133260408 CTTGGTTCTCAGTGCACACCTGG - Intergenic
1076885488 10:133260437-133260459 CCTGGTTCTCAGTGCACACCCGG - Intergenic
1076885494 10:133260492-133260514 CCTGGTTCTCAGTGCACACCCGG - Intergenic
1077446465 11:2593311-2593333 TTTGCTGCTCAGAGAACACTGGG + Intronic
1077446479 11:2593386-2593408 TTTGCTGCTCAGAGAACACTGGG + Intronic
1077537093 11:3129610-3129632 CCTGGTGCTCAGCGGCCACCTGG - Intronic
1077550771 11:3199282-3199304 CCTGCTGCTCAGAGGACACAGGG + Intergenic
1080599550 11:33808867-33808889 CCTGGGCATCAGAGGACACCAGG + Intergenic
1080992898 11:37560984-37561006 CGCAGTGCTCAGAGGACACATGG + Intergenic
1082832480 11:57629095-57629117 CTTGTGGATCAGAAGACACCTGG - Intergenic
1083161268 11:60855709-60855731 CTTGGTGCTCAGAGGAGGGAAGG - Intronic
1083227862 11:61295708-61295730 CTGGGTGCCCAGAGGAGCCCGGG - Intergenic
1083305674 11:61761011-61761033 CCTGGGGTGCAGAGGACACCAGG - Intronic
1083734736 11:64673033-64673055 TTTGGTGCTCAGAGTAAGCCTGG - Intronic
1084087351 11:66860654-66860676 CTTGCAGGTCAGAAGACACCAGG - Intronic
1085732940 11:79014599-79014621 CTTCATGCACAGAGGCCACCAGG + Intronic
1090809232 11:130222108-130222130 TACGGTGCACAGAGGACACCTGG + Intergenic
1092165154 12:6337809-6337831 CTGGGAGCTGAGAGGACACCAGG - Intronic
1096727259 12:53574565-53574587 CGTGCTGCTCAGAGGTCTCCTGG + Intronic
1096752603 12:53771493-53771515 CTTGGTGCTAAGAACACAACAGG - Intergenic
1097856150 12:64464636-64464658 TTTGGGCCTCAGAGGACATCAGG + Intronic
1100506853 12:95229696-95229718 CTAGGAACTCAGAGAACACCTGG - Intronic
1100517925 12:95346022-95346044 CCTGGTCCGCAGAGGACATCTGG + Intergenic
1101738439 12:107481398-107481420 CCTGGTGCTCAGAGGGAACCAGG - Intronic
1103621280 12:122188934-122188956 TTTGCTGCTCAGGGGACATCAGG - Intronic
1104388315 12:128370254-128370276 ACTGTTGCTCAGAGGAAACCAGG - Intronic
1104980293 12:132570515-132570537 CCTGGTCCTCCCAGGACACCCGG + Exonic
1105706041 13:22967886-22967908 ATGGGTGCTCAGTGGACACCTGG + Intergenic
1113277421 13:108746775-108746797 CGAGATGCTCAGAGAACACCAGG + Intronic
1116083892 14:40209573-40209595 CTAGAGGCTCAGAGAACACCAGG + Intergenic
1118765798 14:68908575-68908597 CTTGGTGCCAAGAGGCCACATGG - Intronic
1120645468 14:87069244-87069266 CTGGGTGGTCAGAGGGCCCCGGG - Intergenic
1121695434 14:95908446-95908468 CTTGATGCTAAGAGGACAGATGG - Intergenic
1121729148 14:96174237-96174259 CCTGGGGCTCAGAGGAGTCCAGG + Intergenic
1121986636 14:98513161-98513183 CTCGGTGCTCAGACGGCACAGGG - Intergenic
1122845593 14:104496049-104496071 CTTTGTGCTCAACGGAAACCGGG - Intronic
1123708161 15:22965782-22965804 CCTGCTGCTCTGGGGACACCAGG - Intronic
1125044487 15:35230474-35230496 CTTGGGGCTCCCAGGACTCCAGG - Intronic
1129169491 15:73799006-73799028 GTTGGTGCTCAGAGGGGACGAGG + Intergenic
1129454912 15:75671535-75671557 CTAGGGGCTCACAGGACATCTGG + Intergenic
1129681782 15:77662287-77662309 CTTAGTGCTCAGAGGCCCCTTGG - Intronic
1129796804 15:78383932-78383954 CTTGGTGGTGAGGGGCCACCAGG + Intergenic
1133130425 16:3673299-3673321 CTGTGTGCTCAGAGGGCAGCAGG + Intronic
1139956500 16:70695747-70695769 TTTGGCGCACAAAGGACACCAGG + Intronic
1140623957 16:76769871-76769893 CCTGGTGCTCAAAGGACCTCTGG + Intergenic
1142279432 16:89140080-89140102 CTTGGCCCACAGAGGAGACCTGG + Intronic
1143014019 17:3882287-3882309 CTTGCTGCTCAGAGGGAAGCAGG + Exonic
1144050767 17:11495487-11495509 ATGTGTGCTCAGAGCACACCTGG - Intronic
1144819960 17:18065607-18065629 CTTGGTGCTCAGTGGTCCCGAGG + Exonic
1146918215 17:36691590-36691612 CTTGGTGCTGAGGGTGCACCGGG - Intergenic
1147240050 17:39084898-39084920 CTTGCCGCTCAGAGGTCATCTGG - Intronic
1150631816 17:66885298-66885320 CCTGGGGCTCAGGGGTCACCTGG - Exonic
1151894304 17:76969687-76969709 CTTGGTGCAGAGGGGGCACCAGG - Intergenic
1152795564 17:82304509-82304531 CTTGGTGCTCAGAGGCCAGAGGG - Intergenic
1152813468 17:82393243-82393265 GTTGAGACTCAGAGGACACCGGG + Intronic
1153643405 18:7174528-7174550 CATGGTGCCCAGATGACACCTGG + Intergenic
1154375493 18:13805943-13805965 CATGAAGCTCAGAGAACACCAGG + Intergenic
1156041856 18:32831919-32831941 CATGCTGCTCACAGAACACCAGG - Intergenic
1159529089 18:69632576-69632598 CTTGGTTGTCAAAGGCCACCAGG - Intronic
1159549843 18:69883490-69883512 CTTGGTGCTCAGAGGACACCAGG + Intronic
1161569116 19:5020584-5020606 CTTGGTGCCCAGAGGAAGCCAGG + Intronic
1162042457 19:7979065-7979087 CTTGGAGCACAGAGGACCCCAGG + Intronic
1162734040 19:12735856-12735878 CTGTGTGCTCAGCTGACACCTGG + Intergenic
1162753538 19:12843494-12843516 CAAGGTGCTCAGAGGCCACAAGG - Intronic
1163233667 19:16019395-16019417 CTTGGTGCTGAGAGGGAGCCTGG + Intergenic
1165172994 19:33906556-33906578 CTGGGTGCTCAGAAGACCCCAGG + Intergenic
1165302508 19:34979668-34979690 CTTGGTACTGAAAGGCCACCAGG - Intergenic
1165780616 19:38431701-38431723 CTTGTTGCTCTGTGGACACCTGG - Intergenic
1166289576 19:41853865-41853887 CTTGGTGTACAGAGGACCCTTGG - Intergenic
1166895426 19:46019315-46019337 CTATGTGCTCAAAGGACACCGGG - Exonic
1167848981 19:52187862-52187884 CTTGGGGCTGAGAGGAGTCCTGG + Intergenic
1168355625 19:55698066-55698088 CAGGGTGATCAGAGGTCACCTGG + Intronic
925543231 2:4989234-4989256 CTCTGTGCTGAGAGGACACTTGG - Intergenic
928317230 2:30255701-30255723 TGTGGTGCTCTGAGGATACCCGG - Intronic
930314133 2:49776668-49776690 CTTGGTCCTCAGACCACACTTGG - Intergenic
930365745 2:50437288-50437310 CTTGGTGCCAAGAGGACAAATGG - Intronic
930780760 2:55223514-55223536 CTTGGCGCTCGGAGCACAGCAGG - Intronic
931196838 2:60059732-60059754 TTTGTTCCTCAGAGGACATCTGG - Intergenic
931516098 2:63051453-63051475 CTTGGTGAGCCGAGGACCCCGGG + Intronic
932568650 2:72925011-72925033 GTTGGTAGTCTGAGGACACCTGG - Intronic
937596430 2:123680569-123680591 AGTGGTGCTCAGAGGCCACTGGG + Intergenic
942394174 2:175528751-175528773 CTTGGTGCTGAGCAGAAACCTGG - Intergenic
942506082 2:176642932-176642954 CTTGCTGCTCAGGGAACCCCAGG + Intergenic
943172182 2:184415821-184415843 CTTGGTTCTCAGAGAACTCTGGG - Intergenic
945908514 2:215620625-215620647 CTTTGTGGTCAGTGGACAACTGG - Intergenic
948037713 2:234872781-234872803 CTTGGTTCTCAAAGGGCATCTGG + Intergenic
948930752 2:241130431-241130453 CTTGGTGGACAGAGGCCACGTGG - Intronic
948992029 2:241560186-241560208 GTTGGTGCTGTGAGGACATCTGG + Intronic
1169841067 20:9938289-9938311 TTTGTTTCCCAGAGGACACCTGG + Intergenic
1170805679 20:19628658-19628680 CTTGGTTCTCAGTGGCCCCCAGG - Intronic
1172486770 20:35303235-35303257 CTTGGTCATCAGAGGCCTCCTGG + Exonic
1173758008 20:45535123-45535145 CTTGGTGAGCACAGGAGACCGGG + Intronic
1173948260 20:46968747-46968769 TTTGCTGCCCAGAGGACACCTGG - Intronic
1174068425 20:47882882-47882904 CCGGGTGCTCAGATGACATCAGG + Intergenic
1175212004 20:57365052-57365074 GTTGCTGCTGAGAGGAGACCTGG + Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175787850 20:61723346-61723368 CACGGTGCTCAGAGGGCCCCGGG - Intronic
1175863241 20:62161262-62161284 CCTGGTGCTCTGCGGTCACCTGG + Intronic
1175872285 20:62214210-62214232 CCAGGTGCTCAGAGGCCACTTGG - Intergenic
1176002834 20:62840634-62840656 ATTGGGGCCCAGGGGACACCGGG + Exonic
1178488776 21:33034751-33034773 CTTAGTGCACGGAGGACACACGG - Intergenic
1180712093 22:17846297-17846319 GGTGGTACTCAGAGGACACTGGG + Intronic
1180940915 22:19659083-19659105 CCAGGTCCTAAGAGGACACCAGG + Intergenic
1180969388 22:19807219-19807241 CTCGATGCACAGGGGACACCGGG - Intronic
1181066245 22:20307425-20307447 CCGGGTGCCCAGAGGACACAGGG + Intergenic
1181459288 22:23076795-23076817 CTTGGGGCACAGGGGCCACCTGG - Intronic
1182246075 22:28958668-28958690 TTTGGAGTACAGAGGACACCAGG + Intronic
1182422290 22:30254400-30254422 CTGGCTGCTCAGACCACACCTGG - Intergenic
1183951517 22:41355466-41355488 CAGGGTGCTCCGAGGACACATGG + Exonic
1184528359 22:45038906-45038928 CTGAGTGCTGAGATGACACCTGG + Intergenic
951268317 3:20596462-20596484 CAAGGAGCTCAGAGCACACCTGG - Intergenic
954772769 3:52987619-52987641 CTTGGAGCTCAGAGAATACAAGG + Intronic
956202233 3:66718609-66718631 CTTGATGCCCAGACCACACCCGG + Intergenic
957322623 3:78651894-78651916 CTTGGTCCTCAGGTGACACAGGG + Exonic
959093836 3:101932508-101932530 CCTGGTGCCCAGACGCCACCTGG - Intergenic
960818887 3:121705796-121705818 CTTGGTGCTCACACAAAACCCGG + Intronic
961044648 3:123700089-123700111 CTGGGGGGTCAGAAGACACCTGG + Exonic
961142232 3:124565267-124565289 CTTAGTCCTCAGAGGACAGGGGG - Intronic
962228465 3:133637455-133637477 ATTGGTTCTCAGAGTACACCCGG - Intronic
962251599 3:133839348-133839370 CTAGGAGCTTTGAGGACACCTGG - Intronic
962733037 3:138300302-138300324 CTCTGTGCTCAGGGGACACACGG - Intronic
963904449 3:150762633-150762655 CGTGGTGCTGCGGGGACACCGGG + Exonic
966796605 3:183720531-183720553 CTTGGTGCTCTAGGGACACCTGG + Intronic
966826464 3:183969127-183969149 CCTGGTGCACAGAAGACACTTGG + Intronic
968564686 4:1305244-1305266 CTTGCTCCCCAGGGGACACCTGG - Intronic
968664680 4:1814704-1814726 ATTGGTGCTCTGAGGACCCTGGG - Intronic
970329613 4:14966071-14966093 CCTGGTGCTATGAGGAGACCAGG + Intergenic
970863592 4:20733809-20733831 TTTCTTGCACAGAGGACACCTGG - Intronic
971144287 4:23960218-23960240 TTTGTTGCTCAAGGGACACCTGG + Intergenic
973878813 4:55248102-55248124 TTTGGTGTTCACAGCACACCTGG + Intergenic
975841055 4:78474698-78474720 CTTGTTGCTGTGAGGACAGCAGG - Intronic
983128872 4:163989075-163989097 CTGGGTGCTTAGTGGACTCCTGG - Intronic
984102590 4:175503121-175503143 CTTGGTTCTCAAAGGAGATCAGG + Intergenic
985859026 5:2455713-2455735 CTGGGAGCTCAAGGGACACCAGG - Intergenic
986317103 5:6596998-6597020 CTTGGTGGTCACTGGACTCCAGG + Intergenic
988444226 5:31267342-31267364 CTTGGCTCTCAGAGGATATCTGG - Exonic
988827265 5:34950778-34950800 CTTCCTGCTCAGAGGAGCCCTGG + Intronic
992711415 5:79461056-79461078 TTTGGAGCTCAGAGAAAACCAGG + Intronic
994263692 5:97689379-97689401 CTTGCTCCTCAGAAGAAACCTGG + Intergenic
997211700 5:132080721-132080743 CTGGGTGCTCAGAGGTCCCAAGG + Intergenic
997690005 5:135821988-135822010 AGGGGAGCTCAGAGGACACCTGG + Intergenic
1000952910 5:167506419-167506441 CTTGGTTTTCAGAGCAAACCAGG + Intronic
1001138082 5:169119217-169119239 CTTGTTACGCAGATGACACCTGG + Intronic
1001744050 5:174076714-174076736 TTTGTTTCTCAGAGGACACTTGG + Intronic
1002107943 5:176889372-176889394 CCTGGTGCTCAGAGGTGACCTGG - Exonic
1002496301 5:179614116-179614138 CTTGGTGCTCTGTGCCCACCTGG - Intergenic
1005668477 6:28081076-28081098 CTTGGCCCTCAGAGGAATCCCGG + Exonic
1005993571 6:30918513-30918535 CTGGGTGCCCAGAGGACACTGGG - Intronic
1007622942 6:43225954-43225976 CGCGGTGCTCAGAGCCCACCAGG + Intronic
1008406903 6:51128327-51128349 CTTTATGGTCAGAGGAGACCAGG - Intergenic
1011071816 6:83393221-83393243 CCTGGTGCTCAGAGTAGCCCAGG - Intronic
1015078394 6:129192080-129192102 CTTGGTGCTATGACAACACCTGG - Intronic
1015978850 6:138818810-138818832 CAGGGTGCTCAGACAACACCTGG + Intronic
1017778098 6:157695296-157695318 CCTGGAGCTCTGAGGATACCAGG + Intergenic
1018659643 6:166074060-166074082 CCAGGTGCTCAGCTGACACCCGG + Intergenic
1019652656 7:2168816-2168838 CGTGGGGCCCAGAGGCCACCGGG + Intronic
1019744667 7:2692900-2692922 CTGGGGGCTCAGGGGACAGCCGG - Intronic
1020551783 7:9615796-9615818 CTTGGTGCTCAGTGTAGCCCAGG - Intergenic
1021286562 7:18788043-18788065 CTGAGTGTTCAGAGGACAGCAGG - Intronic
1022478903 7:30730162-30730184 CCTGGTGCACAGAGCCCACCTGG + Intronic
1022534388 7:31086738-31086760 CTTGTCTCTCAGAGGACTCCTGG - Intronic
1022805972 7:33823132-33823154 CTAGCTGATCAAAGGACACCTGG + Intergenic
1023677872 7:42649766-42649788 CTTGGTGCTCAGTGAATATCAGG + Intergenic
1024003993 7:45212087-45212109 CTTGGAGGTCTGAGGACACAGGG + Intergenic
1024035457 7:45504295-45504317 CTTGCTGCTCAGAAGTCACATGG + Intergenic
1024043576 7:45573419-45573441 TTTGGTGCTCAGACGGCCCCTGG - Intergenic
1024085486 7:45888789-45888811 CCTCGTGCTCGGAGGTCACCCGG + Exonic
1024112902 7:46164342-46164364 CTTGGTGATGGGAGGACAGCAGG + Intergenic
1025005997 7:55355338-55355360 CAGGGTGATCAGAGGTCACCGGG + Intergenic
1025604784 7:63031682-63031704 CCTCGACCTCAGAGGACACCAGG - Intergenic
1026209696 7:68293060-68293082 CTTCCTTCTCAGAGGACTCCTGG - Intergenic
1027661423 7:80992248-80992270 CTTCGTGCTCAAAGCACACTAGG - Intergenic
1030837551 7:114308233-114308255 CTTGGTCCTCATAGGCCACTGGG + Intronic
1032386713 7:131530313-131530335 CTTGGTGCTGGGAGGAGTCCTGG - Intronic
1035363088 7:158326246-158326268 CTTGGTGCTCACTGGCCACCTGG - Intronic
1038838856 8:31160073-31160095 CTTGTTGCTCAGATGACATTAGG - Intronic
1041442228 8:57909599-57909621 CGGGGAGCTCAGAGAACACCAGG + Intergenic
1042376083 8:68054812-68054834 CTTGGTGCCCACCGGACTCCTGG + Intronic
1044300150 8:90574172-90574194 CTTGGTGCTTTAAGGACACCAGG + Intergenic
1045348598 8:101317224-101317246 CTGGGAGCTTAGAGGAAACCTGG - Intergenic
1045362107 8:101442321-101442343 CTTGGAGCTCAGAGGAGAGAAGG + Intergenic
1047775897 8:128070167-128070189 CTTGGTGCTCTGTGTTCACCTGG + Intergenic
1049195593 8:141313976-141313998 CTTGGTGGCCATATGACACCGGG - Intergenic
1049696798 8:143987993-143988015 CCTGATGCTCAGAGGGCTCCAGG + Intronic
1052789806 9:32864799-32864821 ACTGGTGCCCAGAGGAGACCTGG - Intergenic
1056576600 9:87859677-87859699 CCAGGTGCCCAGTGGACACCTGG - Intergenic
1057716580 9:97501203-97501225 CTTGCGGCTCAGAGCCCACCTGG + Intronic
1057835341 9:98440102-98440124 CTAGCTGATAAGAGGACACCTGG + Intronic
1059176913 9:112175817-112175839 CCCGCTGCTCTGAGGACACCCGG + Intergenic
1059324513 9:113496138-113496160 CTTGGGGCCCAGAGCACTCCTGG + Intronic
1060186371 9:121566500-121566522 CTTGGAGCTCACAGGAAAGCAGG - Intergenic
1061033209 9:128099270-128099292 CTTGGTGCACAGTGGGCACTGGG - Intronic
1062068177 9:134540098-134540120 TAAGGTGCTCAGAGGACAGCTGG - Intergenic
1062554919 9:137109612-137109634 CGTGGTCCTAAGAGGTCACCTGG - Intergenic
1062679485 9:137770746-137770768 CTGGGTGCTCAGAGGAGGCAGGG - Intronic
1062687855 9:137825120-137825142 CTAGGAGCTCAGAGCACCCCCGG - Intronic
1186766798 X:12778770-12778792 ATTGCTGCTCAGGGGCCACCAGG - Intergenic
1187679966 X:21758029-21758051 ATCGCAGCTCAGAGGACACCGGG - Exonic
1193305717 X:79949157-79949179 CTTGGACCTCAGAGCACATCAGG - Intergenic
1195254903 X:103081504-103081526 CTGGGTCCTCAGAGGAGCCCTGG - Intronic
1196187802 X:112763116-112763138 CTTGGTCCTCAAAGTAAACCAGG + Intergenic
1198268911 X:135035674-135035696 CTTGGTTCTCAGGGGAATCCTGG + Intergenic
1201073216 Y:10168865-10168887 CTTCCTGCTCCGAGGACCCCAGG + Intergenic