ID: 1159550574

View in Genome Browser
Species Human (GRCh38)
Location 18:69891846-69891868
Sequence CATTAGTTCTTGAGCAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159550574_1159550576 10 Left 1159550574 18:69891846-69891868 CCATCTTTGCTCAAGAACTAATG 0: 1
1: 0
2: 0
3: 9
4: 151
Right 1159550576 18:69891879-69891901 TTGACAATTATATGAGATGCAGG 0: 1
1: 0
2: 1
3: 11
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159550574 Original CRISPR CATTAGTTCTTGAGCAAAGA TGG (reversed) Intronic
901193610 1:7427170-7427192 CATTAATTTTTTATCAAAGATGG - Intronic
906635336 1:47405955-47405977 CATTACATTTTGAGCAAAGGAGG + Intergenic
906848921 1:49226567-49226589 CAGAAGTTCTTGTGCAAAAATGG + Intronic
907744336 1:57198005-57198027 CATTATTTTATGTGCAAAGAGGG - Intronic
908292004 1:62677171-62677193 AATTAGTTCCTTACCAAAGAAGG - Intronic
912188605 1:107311227-107311249 TATTTGTTCTTGAGCAATTATGG - Intronic
913252350 1:116922342-116922364 CATAAGTTTTAGAGCAATGATGG + Intronic
919641976 1:200054423-200054445 CATTAGTTGTTTAACAAAGTGGG - Intronic
921286044 1:213610363-213610385 CAATAGTTCTTGACCAAACAGGG - Intergenic
1062821189 10:535660-535682 CATTGCATCTTGAGAAAAGATGG - Intronic
1063897946 10:10701869-10701891 CAGTATTTCTTGGGCAAAGGTGG - Intergenic
1066061576 10:31728096-31728118 CTTCAGTCCCTGAGCAAAGAGGG - Intergenic
1067276842 10:44843256-44843278 CATTTGTCCTAGAGCAATGAAGG + Intergenic
1069194996 10:65540298-65540320 CACTTACTCTTGAGCAAAGAAGG + Intergenic
1070817938 10:79336877-79336899 CAGGAGTTCTTGAGCACAGGTGG - Intergenic
1073677103 10:105660824-105660846 CAGTAGTTCTTGAGCTTAGAGGG + Intergenic
1073844719 10:107541990-107542012 TATTTGTTCTTGAGCAAACTAGG + Intergenic
1075176540 10:120168588-120168610 CATTATTTCTTTAGTAAAGTTGG + Intergenic
1076051080 10:127333625-127333647 CTTTTGTTCTTGAACAAAAAGGG - Intronic
1076910077 10:133383230-133383252 CATTATTTCATAAGCATAGATGG + Intronic
1079726039 11:23882570-23882592 TCATATTTCTTGAGCAAAGAGGG - Intergenic
1084127718 11:67111518-67111540 CATATGTTCTGGAGCAGAGAAGG - Intergenic
1084881990 11:72177971-72177993 CATTGGTTCCTGATCCAAGAAGG + Intergenic
1087398036 11:97627397-97627419 GAGTAGTTCTTGGGAAAAGATGG + Intergenic
1088261658 11:107949860-107949882 CAGTAGTTCTTTAGAAAAGGTGG + Intronic
1088338489 11:108736038-108736060 CATTAACCCTTCAGCAAAGACGG - Intronic
1089550913 11:119276921-119276943 CATTTGCTTTTGATCAAAGAAGG - Intronic
1092805807 12:12221062-12221084 CATTGGTTCTTAAGGAGAGAGGG - Intronic
1093484048 12:19634541-19634563 CACCAGTTTTTGAGAAAAGAAGG + Intronic
1095258084 12:40064445-40064467 CATTATTTATTGATAAAAGAAGG + Intronic
1095310403 12:40691924-40691946 CAGTTTTTCTTGAGAAAAGACGG - Intergenic
1097629066 12:62037236-62037258 CAATAGTTTTCGAGCACAGATGG - Intronic
1099245400 12:80187821-80187843 CATTAGCTCCTAATCAAAGATGG - Intergenic
1100222011 12:92515556-92515578 TCTTATTTCTTGAGCAAAGAGGG + Intergenic
1100249068 12:92796229-92796251 CATTAGATTTTGAGCAAAGTTGG + Intronic
1100338008 12:93650926-93650948 CAGTAATTCTTAGGCAAAGATGG - Intergenic
1103988836 12:124784910-124784932 CATAAGATCTGCAGCAAAGATGG - Intronic
1106911507 13:34468060-34468082 CTTTATTTCTTTAGTAAAGATGG - Intergenic
1107978195 13:45710196-45710218 TATTAGTTCTAGTGCAAGGATGG + Intronic
1110397300 13:75045925-75045947 CATTAGCTGTTGTGGAAAGATGG - Intergenic
1110982281 13:81916149-81916171 CATGAGTGCATGACCAAAGAAGG + Intergenic
1111577618 13:90177562-90177584 CTATAGTTCTTGAGCAATTAGGG - Intergenic
1111633768 13:90877128-90877150 CGCTAGTTCTAGAGCAAAGCAGG + Intergenic
1114515713 14:23298895-23298917 CCTTAGTCTTTGAGAAAAGATGG - Exonic
1114537900 14:23434418-23434440 AACTAGTTCTTGAGGAAAAAGGG - Intronic
1115900575 14:38142961-38142983 TTTTAGGTCTAGAGCAAAGATGG + Intergenic
1116566618 14:46452779-46452801 TATTAGTTCTTGTGGAAATAGGG + Intergenic
1117487394 14:56212233-56212255 CATTAGGTATTGAGCATAGCTGG + Intronic
1117890779 14:60419563-60419585 GATTAGTTCTTTTGGAAAGAAGG + Intronic
1118042542 14:61932751-61932773 GATAAGTTCTGAAGCAAAGATGG - Intergenic
1120859237 14:89239895-89239917 CATGAATTCTGGAGCCAAGAGGG + Intronic
1124812729 15:32957392-32957414 CATTTGTTCCTGAGCAAGGTAGG - Intronic
1129965885 15:79735278-79735300 CATTAGTGCTCTAGCAAAGCTGG + Intergenic
1130570895 15:85042660-85042682 CTTTGGTTCTAGAACAAAGAAGG - Intronic
1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG + Intronic
1136647659 16:31636006-31636028 TATTGGTTCTGGAGCCAAGATGG - Intergenic
1137323025 16:47405475-47405497 CATTGGCTCTTAAACAAAGAAGG - Intronic
1138137133 16:54532848-54532870 CAGTAGTCAGTGAGCAAAGATGG + Intergenic
1141525554 16:84608932-84608954 CATTGTTTCTGGAGCAAAGTAGG + Intronic
1141943167 16:87291962-87291984 AATTAATACTTCAGCAAAGAAGG + Intronic
1145772787 17:27505394-27505416 GATTAGTTCTTCATCCAAGAAGG + Intronic
1149178187 17:53900725-53900747 GATTATGTCTTCAGCAAAGAGGG + Intergenic
1155437551 18:25828751-25828773 CATGAGTTCTTAAGCACAGTGGG - Intergenic
1159550574 18:69891846-69891868 CATTAGTTCTTGAGCAAAGATGG - Intronic
1159969608 18:74633240-74633262 CTTTATTCATTGAGCAAAGAAGG + Exonic
1165133251 19:33646557-33646579 CTTTAGTCCCTGAGCAAGGAGGG + Intronic
1165622125 19:37256910-37256932 AAGGAGTTTTTGAGCAAAGAGGG + Intergenic
925231066 2:2234500-2234522 TATTAATGCTTGAGCCAAGAAGG + Intronic
935391223 2:102554705-102554727 CATTAATTCTTGAACAATGTGGG + Intergenic
939426565 2:142046023-142046045 AATTAATTCTTAAGCAAACAAGG + Intronic
941044931 2:160664301-160664323 AATTATTTCTTGAATAAAGATGG - Intergenic
942883114 2:180886972-180886994 GATTATATCATGAGCAAAGAGGG - Intergenic
943625446 2:190193936-190193958 CATTAGTTTTAGAGCTTAGAAGG - Intronic
943646938 2:190416559-190416581 CATAAATTCATGAGCACAGATGG + Intronic
944579230 2:201117503-201117525 AATTTGTTCTTAAGCAATGAGGG + Intronic
946766160 2:223042965-223042987 AATTATTTATTGAGCACAGAAGG + Intergenic
1170367297 20:15611712-15611734 CATTTGTTCTTGTGGAAATATGG + Intronic
1172749601 20:37241310-37241332 CATTAGTTCCAGAAGAAAGATGG + Exonic
1176418627 21:6496280-6496302 CACTACTTGTTCAGCAAAGACGG + Intergenic
1179694121 21:43104602-43104624 CACTACTTGTTCAGCAAAGACGG + Intronic
1181786114 22:25228370-25228392 TATTGGTTATTGAGCAATGACGG - Intronic
1181818289 22:25456200-25456222 TATTGGTTATTGAGCAATGACGG - Intergenic
1182097127 22:27633509-27633531 GTTGAGTTCATGAGCAAAGAAGG - Intergenic
1184304848 22:43590809-43590831 CTCTTTTTCTTGAGCAAAGATGG + Intronic
949588469 3:5467216-5467238 CATTAGGTCTGGAGCAAGGCTGG + Intergenic
950448248 3:13050580-13050602 CATGAGTTCTAGAGCCAAGAGGG + Intronic
957223343 3:77412455-77412477 CAGTAGATCTTGAGGACAGAGGG - Intronic
961155662 3:124677485-124677507 CATTAGTTCTTGTCCCAATAGGG + Intronic
962968870 3:140380537-140380559 CATTTCTTCTTGAGAAAATATGG + Intronic
963474272 3:145783532-145783554 CATTAGTTTTAGAGGAAAGAAGG + Intergenic
965511758 3:169575500-169575522 GATTAGCTCATTAGCAAAGAAGG - Intronic
965788888 3:172366405-172366427 ATTTAGTTCTTGAGTAAAAAGGG + Intronic
965964648 3:174472376-174472398 CATGAGTGCTTGAAGAAAGATGG + Intronic
966247803 3:177827942-177827964 CAGTAGTTCTTGAACAATGCTGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967366499 3:188692488-188692510 AATTAGGTCTTGGACAAAGATGG - Intronic
970627854 4:17909293-17909315 CATTAATTCCTGAGCAACTAGGG + Exonic
971810824 4:31424679-31424701 CATTACTTCTATAGAAAAGAAGG - Intergenic
972386420 4:38570728-38570750 CATTAGTTATTCAGGAAATATGG + Intergenic
973074025 4:45900452-45900474 TTTTAGTCCCTGAGCAAAGAGGG + Intergenic
973637898 4:52876948-52876970 CTTTAATTCTAAAGCAAAGACGG + Intronic
974142001 4:57899602-57899624 CATCAGCTCCTGAGCCAAGATGG + Intergenic
974208991 4:58744562-58744584 CATTAGCTATAGAGAAAAGAGGG - Intergenic
977645226 4:99404323-99404345 CATCAGTTCTTGATCTTAGAGGG + Intergenic
980139985 4:128903495-128903517 CAGTAAATCTTGAGCAAATAAGG - Intronic
982154331 4:152501295-152501317 CATAAGTTCATGAATAAAGAAGG - Intronic
983483598 4:168306477-168306499 CATTCATTCTTGGGCAAGGAAGG - Exonic
984023101 4:174510210-174510232 CAGTAGCTCTTGAACAAAAAAGG + Intronic
984624150 4:181986922-181986944 CAGTACTTCTGGAGCAATGATGG + Intergenic
987169319 5:15237861-15237883 CAACAGTTATTGAGCCAAGAAGG - Intergenic
987830103 5:23084874-23084896 CAAGAGCTCTAGAGCAAAGATGG + Intergenic
988681947 5:33492111-33492133 CTTTGGTCCTTGAGCAAGGAGGG + Intergenic
988944240 5:36179344-36179366 CTTAAGTTCTTTAGCATAGATGG - Intronic
990893660 5:60674393-60674415 TACTAGTTCTTTTGCAAAGATGG + Intronic
991511493 5:67382047-67382069 AACTAGTTCTGTAGCAAAGAAGG + Intergenic
992901270 5:81299560-81299582 GATTAGTAGTTGAGCAAATAGGG - Intergenic
994731947 5:103502308-103502330 CATTAGGTCTTCTTCAAAGAGGG + Intergenic
994859934 5:105178383-105178405 TATTTGTTCTTGAGGAAAGCAGG - Intergenic
996245832 5:121263159-121263181 CAGTAGTTTTGGTGCAAAGATGG + Intergenic
999865669 5:155697968-155697990 CAATAGTTATTGACAAAAGATGG - Intergenic
1003722435 6:8718678-8718700 CAGTATTTCTGGAGAAAAGAAGG - Intergenic
1005471938 6:26169834-26169856 CTGTAGTCCTTGAGCCAAGAGGG + Intronic
1011937680 6:92801414-92801436 CATTGGTGCTTGAGAAATGAGGG - Intergenic
1014401549 6:120996436-120996458 TTTCAGTTCCTGAGCAAAGAAGG - Intergenic
1015421672 6:133017641-133017663 CCTTTGTGCTTGAGCAAAGGAGG + Intergenic
1016200898 6:141407174-141407196 CAATAGTTCCTGAGCCTAGAAGG - Intergenic
1020719383 7:11722224-11722246 CTTCAGTTCCTGAGCAAGGAGGG - Intronic
1020778921 7:12493954-12493976 CATTAGTACTTGAGAAAAAGAGG + Intergenic
1020842491 7:13236677-13236699 CATCAGTTCTAGAACATAGAAGG + Intergenic
1022106588 7:27201284-27201306 GACTGGTTCTTGGGCAAAGAAGG - Intergenic
1022127566 7:27372954-27372976 CCTTTGTTCATGAGGAAAGATGG + Intergenic
1026456870 7:70580394-70580416 TATTAGTTCTTCAGGAAGGAAGG + Intronic
1026837116 7:73646819-73646841 GATAAGTTCTTGGGCAAAGTGGG + Intergenic
1027160596 7:75799593-75799615 CATGAGTCCTTGAGCACAGTGGG - Intergenic
1027242424 7:76340672-76340694 CAGTAGTTCTTAACCAAGGAGGG + Intronic
1029911514 7:104155213-104155235 CATGAGTTCATAAGCAGAGAAGG + Intronic
1030066220 7:105661265-105661287 CATTAAATGTTGAGTAAAGATGG + Intronic
1031608069 7:123793273-123793295 AAATTGTTCTTAAGCAAAGAAGG - Intergenic
1032298703 7:130668054-130668076 CATTTGCTCTGGACCAAAGACGG + Intronic
1034761938 7:153680698-153680720 CATTAGTTCTCTAGCCAAAAGGG - Intergenic
1039178720 8:34839046-34839068 CATGAGTTCTTGAGCACAGCAGG - Intergenic
1039616945 8:38962951-38962973 CACTAGTTCTTGGGAAAGGAGGG + Intronic
1043824798 8:84913116-84913138 CATTACTTGCTGAGCAAACAAGG - Intronic
1044063376 8:87667265-87667287 GATTAGCCCTTGAGAAAAGAAGG + Intergenic
1046017610 8:108624069-108624091 CTTTAGTTCATCAGCAAAGTAGG + Intronic
1049028710 8:140016057-140016079 TACTAATTCTTGAGGAAAGAAGG - Intronic
1051164697 9:14248867-14248889 CCTTACTTCTCGGGCAAAGAGGG - Intronic
1051390000 9:16553714-16553736 CTTTAGTTCTAGAGAAGAGATGG - Intronic
1052634395 9:31082699-31082721 CATAATTTCTGGAGCAAAGAGGG - Intergenic
1055389634 9:75806155-75806177 CATTTTTTCTTGTGCAAGGAGGG - Intergenic
1058392043 9:104506565-104506587 CATTAGTTCTTTATCAGAGAAGG + Intergenic
1059017587 9:110536655-110536677 TATTATTTCTTGATTAAAGAAGG - Intronic
1060842370 9:126804073-126804095 AATTAGTTCTTCTACAAAGAGGG + Intergenic
1188023009 X:25178837-25178859 CATTAGGTCTTTAGCTAGGACGG - Intergenic
1188366832 X:29326209-29326231 CATTTGTCTTTGAACAAAGAGGG + Intronic
1190274036 X:48888880-48888902 AATTATTACTTTAGCAAAGAAGG + Intergenic
1193701776 X:84771616-84771638 CCTTAGATCTTCAGCAAAAAAGG - Intergenic
1195133593 X:101879726-101879748 CATTATTTCTTGACCAAACTGGG - Intergenic
1197554920 X:127941312-127941334 AATTAGTTCATGAACAAATATGG - Intergenic
1199162365 X:144628370-144628392 AACTTGTGCTTGAGCAAAGAAGG + Intergenic
1199803417 X:151273385-151273407 AATTAGTTCTGGAGCAGTGATGG - Intergenic