ID: 1159554067

View in Genome Browser
Species Human (GRCh38)
Location 18:69926635-69926657
Sequence ATCTAATTCTTCAGGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159554067 Original CRISPR ATCTAATTCTTCAGGGAACA TGG Intronic
901881653 1:12197594-12197616 ATCTAATCCTACAGGAAAAATGG - Intronic
901941635 1:12666682-12666704 TTCACAATCTTCAGGGAACATGG - Exonic
902198774 1:14818452-14818474 CTCTACTTCTTCAGGGACAAGGG + Intronic
910391871 1:86754151-86754173 ATATAATTTTTCCAGGAACAGGG + Intergenic
910566768 1:88652447-88652469 AAATAATGCTTCAGTGAACATGG - Intergenic
913271638 1:117099715-117099737 TCCTAATTCTTCAGGAAACCTGG - Intronic
916715102 1:167441359-167441381 ATGAAACCCTTCAGGGAACAGGG - Intronic
917164056 1:172091599-172091621 CTGGAACTCTTCAGGGAACAAGG + Intronic
918628170 1:186681941-186681963 ATCTGATTCTTCATGAGACACGG + Intergenic
919265242 1:195254788-195254810 GACTAATGCTTCAGCGAACATGG + Intergenic
919496750 1:198282293-198282315 ATGACATTCTTCAGGCAACAAGG - Intronic
922682917 1:227615929-227615951 CCCTAATTTTTCAGGCAACACGG + Intronic
922962405 1:229659711-229659733 TTCAAATTCTTCAAGTAACATGG + Exonic
923214676 1:231837497-231837519 ATGTAATGCTTCATGGAAGAGGG - Intronic
924122395 1:240814464-240814486 ATCTGATTCTTAGTGGAACAAGG + Intronic
924867279 1:247997863-247997885 ATCTCATTCTCCAGGTAAAAAGG + Intronic
1064157126 10:12912084-12912106 AAGTAATGCTTCAGTGAACATGG + Intronic
1067461717 10:46463148-46463170 ACGGAATTGTTCAGGGAACATGG + Intronic
1067625477 10:47921453-47921475 ACGGAATTGTTCAGGGAACATGG - Intergenic
1067817629 10:49494526-49494548 ATCTGATTCTTCAGGAAAAAGGG - Intronic
1068572823 10:58649758-58649780 ATCTAATCCTTCTAGCAACATGG + Intronic
1070300741 10:75202026-75202048 ACCAAAGTCTTCAGGGGACATGG - Intergenic
1070400821 10:76052286-76052308 TTCCAATTCTTGAGGGAACTGGG - Intronic
1070513751 10:77184525-77184547 ATTTAATTTTTAAGGGAACAGGG + Intronic
1071708299 10:88023506-88023528 AAATAATTCTGCAGTGAACATGG - Intergenic
1072932758 10:99681158-99681180 AAATAATGCTTCAGTGAACATGG + Intronic
1074029087 10:109666108-109666130 ATGTGATTACTCAGGGAACAGGG - Intergenic
1074537369 10:114338151-114338173 AACTAGTTCCACAGGGAACAGGG + Intronic
1074665821 10:115722408-115722430 AACTAAATCTTCAAGGCACAAGG - Intronic
1074712797 10:116191675-116191697 ACCTGATTATTCAGGGATCAGGG + Intronic
1075629767 10:123994012-123994034 ATAGAATGGTTCAGGGAACAGGG + Intergenic
1080295658 11:30724176-30724198 TGCTCATTCTTCTGGGAACATGG + Intergenic
1081106852 11:39080584-39080606 ATATAGTTCTGCAGTGAACATGG - Intergenic
1085115031 11:73923799-73923821 ATCTAATTCTTAAAAGAGCATGG - Intronic
1085715372 11:78868175-78868197 CGTTCATTCTTCAGGGAACATGG - Intronic
1085976785 11:81665253-81665275 ATCTCATTCTTCATGTAAGAGGG - Intergenic
1085995356 11:81906009-81906031 ATCTGACTCTTCAGGAAAGATGG + Intergenic
1087520986 11:99235475-99235497 CTCTAATTTTCCTGGGAACATGG - Intronic
1089341909 11:117763763-117763785 ATCTAATTGTTCTGGGGTCAGGG + Intronic
1093130265 12:15383408-15383430 GACTAATGCTGCAGGGAACATGG + Intronic
1094496763 12:30993717-30993739 ATCTCATCCTTCAGAGAACTTGG - Exonic
1095417425 12:41991679-41991701 ATTTAATTTTTCAGGGCTCATGG + Intergenic
1096869259 12:54583241-54583263 ATCTATCTCTGAAGGGAACAGGG + Exonic
1099506913 12:83489484-83489506 ATGTAATTCTTTAAGGAAGAGGG - Intergenic
1099741282 12:86637965-86637987 TTTTAATACTTCAGAGAACATGG + Intronic
1101723426 12:107370546-107370568 ATCTATTTTTTCAGGGGAAAGGG - Intronic
1102681536 12:114693536-114693558 CTCTAATTCTTTTGAGAACAGGG + Intergenic
1103009349 12:117446348-117446370 ATCTAATGGTCCAGGAAACATGG + Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105318703 13:19294788-19294810 GTGTAATTCTTCAAGGAAAAAGG - Intergenic
1105721676 13:23122707-23122729 ATGTAATTCTTCAGTGAAAATGG + Intergenic
1106433267 13:29702803-29702825 ATCTGACTCTTAAGGAAACAGGG - Intergenic
1106708859 13:32310553-32310575 ATCTGATTCCTGAGGGAGCATGG - Intronic
1107270851 13:38614347-38614369 AGCTAATTCTTCAGGAAATATGG + Intergenic
1108929573 13:55800617-55800639 ATCTAATGCTTCTGGGAAACAGG - Intergenic
1109058668 13:57583952-57583974 ATCTGTTTCTTCATAGAACAAGG - Intergenic
1109637487 13:65141535-65141557 AACTATTTCTCCAAGGAACATGG - Intergenic
1109999624 13:70178137-70178159 ATCTAAGTCTTCAGGGATGTGGG - Intergenic
1110816358 13:79864633-79864655 ATCAAATTATTCAAGGAACTAGG + Intergenic
1111011464 13:82320643-82320665 ATCTAAGTCATCAGAGAAGACGG - Intergenic
1111587757 13:90304814-90304836 ACATAATGCTTCATGGAACATGG + Intergenic
1112294589 13:98175999-98176021 AAATAATTCTGCAGTGAACATGG + Exonic
1112947686 13:104951495-104951517 ATCTATTTCTTCAGTGTACTTGG + Intergenic
1112997067 13:105587060-105587082 ATCTTATTCTTCATTGAATATGG + Intergenic
1115404797 14:33002548-33002570 CTCTAATTCTGTAGGGCACAGGG - Intronic
1117812115 14:59558255-59558277 ATTTTATTCTGAAGGGAACAGGG + Intronic
1118159233 14:63272455-63272477 ATCTAATTATTCAAGCAAGATGG - Intronic
1118919942 14:70140721-70140743 AGCTAAGTTTTCAGGGAAAAGGG - Intronic
1119114866 14:72010029-72010051 ATCTCATTCAACAGGGAAGATGG - Intronic
1120673686 14:87393671-87393693 AACCAATTCTTGAGGGATCAAGG + Intergenic
1121661825 14:95640774-95640796 ATCTAATTCTGCAGGGAGGAGGG - Intergenic
1123985965 15:25646310-25646332 ACCTAATGCTGCAGTGAACAAGG - Intergenic
1124877037 15:33604697-33604719 CCCTAATTCTTCATGGAACGTGG + Intronic
1125058888 15:35395094-35395116 ATTTATTTCTGCAGAGAACAAGG - Intronic
1126352730 15:47762006-47762028 ATCTAATTTTACAGGGATCTAGG - Intronic
1126741424 15:51780094-51780116 AAGTAATATTTCAGGGAACAGGG + Intronic
1130118973 15:81030492-81030514 ATTTAATTCATCAGGGCCCAAGG - Intronic
1137840631 16:51637509-51637531 ATCTTATCCTTCAGGCAAAATGG - Intergenic
1138745227 16:59355498-59355520 ATTTTGTTTTTCAGGGAACATGG + Intergenic
1139656658 16:68391600-68391622 AGATAATTCTACAGGGAGCATGG + Intronic
1143096799 17:4482674-4482696 ATCTCAGTCTCCAGGGAGCAGGG - Intronic
1145041986 17:19583804-19583826 TTCAAATTCTTCGTGGAACAAGG - Intergenic
1145416591 17:22718437-22718459 AGCTAAGTCTTCAGTGAATAGGG - Intergenic
1150039101 17:61839178-61839200 ATCTAGGTTTTCAGAGAACAAGG - Intronic
1152819010 17:82426266-82426288 ATCATATTCTGCTGGGAACAAGG - Intronic
1154976462 18:21461982-21462004 ATCTAAACCTTTAGGGAACACGG + Intronic
1155493237 18:26419918-26419940 ATTTCATTCTGCAGGGAACAGGG - Intergenic
1156885124 18:42126482-42126504 CTCTATTTCTTCATGTAACACGG - Intergenic
1157371410 18:47115928-47115950 ATCTTTTTCTTCAGGAAAGATGG - Intronic
1159554067 18:69926635-69926657 ATCTAATTCTTCAGGGAACATGG + Intronic
1161727224 19:5936572-5936594 CGCTGGTTCTTCAGGGAACATGG - Intronic
1162621286 19:11846593-11846615 ATCAAATTCATCAGGGAGGAAGG - Intergenic
1162625063 19:11878835-11878857 ATCAAATTCATCAGGGAGGATGG - Intronic
1162630299 19:11922591-11922613 ATCAAATTCATCAGGGAGGATGG - Intergenic
1162635221 19:11962861-11962883 ATCAAATTCATCAGGGAGGATGG - Intronic
1163085486 19:14976691-14976713 ATCTACTTCCTAAGGGATCAAGG + Intronic
1165175283 19:33925070-33925092 ATCCAATTCTGCTGGGAAGATGG + Intergenic
1165984736 19:39758140-39758162 ATCTCCTTCTCCAGGAAACATGG - Intergenic
926294733 2:11560771-11560793 ACAGAGTTCTTCAGGGAACAGGG - Intronic
933297660 2:80508769-80508791 AGGGAATTCCTCAGGGAACATGG - Intronic
933601861 2:84340420-84340442 AAATAATGCTTCAGTGAACATGG + Intergenic
934037466 2:88100073-88100095 ATCAAATTCTACAGAAAACAAGG - Intronic
936103944 2:109608434-109608456 ATCTGATTCTTAAGGGAGGAAGG + Intronic
936715133 2:115178108-115178130 ATCTAATTCATCATGAAAAAAGG - Intronic
937497245 2:122433799-122433821 AATTCATTCTTCATGGAACAGGG + Intergenic
937535334 2:122879629-122879651 TTCTAAATCTTCAGGAAATATGG - Intergenic
938111508 2:128569568-128569590 AAATAATGCTTCAGTGAACATGG + Intergenic
938185067 2:129224424-129224446 ATCTATTTTTTCAGGTACCAGGG + Intergenic
939399132 2:141668696-141668718 ATCTGATTCTTCCTGGAAGATGG + Intronic
941219926 2:162765144-162765166 AACCTACTCTTCAGGGAACAAGG + Intronic
941563300 2:167076739-167076761 ATCTACTTTTGCAGGGAAAAGGG + Intronic
943883969 2:193187163-193187185 ATCTAATTCTCCTGAGAAGAGGG + Intergenic
944115084 2:196177227-196177249 ATCACATTCTCCAGGGTACATGG + Intergenic
944696330 2:202203697-202203719 GGTTAATTCTTCAGGGCACAGGG - Intergenic
947234674 2:227927807-227927829 ACCTAATTCTTAAGGGACCTAGG - Intergenic
947437831 2:230088110-230088132 TTCTATTTCTTCAGGAACCATGG + Intergenic
948130388 2:235596445-235596467 ATCCAAATCTGCAGGTAACAAGG - Intronic
1169592003 20:7154359-7154381 ATATATTTCTTCAGTGAAAAAGG - Intergenic
1169776000 20:9253772-9253794 TTCTAAATCTTCAGGAAACCTGG - Intronic
1169830491 20:9819925-9819947 ATCTTATTTTTCTGGCAACATGG - Intronic
1169864288 20:10183527-10183549 TTCTTATTATGCAGGGAACATGG - Intergenic
1172933917 20:38605566-38605588 ATATATTTCTACAGGGAGCAAGG - Intronic
1174378254 20:50140324-50140346 ATCTGATGCTGCAGGGAAGATGG - Intronic
1174584838 20:51600300-51600322 AACTAATTCTTTAGGCAACATGG - Exonic
1177200987 21:17955956-17955978 ATCTTTTTCTTCCGGGATCAAGG - Intronic
1182306314 22:29371394-29371416 ATCAGATTCATCAGAGAACAAGG - Intronic
951067309 3:18282009-18282031 ATCTAATTAATAAAGGAACAAGG - Intronic
951802131 3:26607454-26607476 TTCTAATACTTCAGGTATCATGG - Intergenic
952710271 3:36424603-36424625 ATCTATTTCTTCAAGGAAGCTGG - Intronic
956549348 3:70441066-70441088 ATAAAATTATTCAGGGAATAGGG + Intergenic
958154951 3:89744702-89744724 ATATAATGCTTCAGTGAATAAGG + Intergenic
958195384 3:90236225-90236247 ATCTCATTCTTCATGGATCCAGG + Intergenic
958528650 3:95294414-95294436 ATCTAATCCTTTAGAGAAGAAGG + Intergenic
959537635 3:107504720-107504742 ATGTGATTCTTCAGAGATCACGG - Intergenic
960864616 3:122186429-122186451 ATATAATTCTTAAGATAACACGG + Intronic
961836523 3:129665636-129665658 ATCTAATGCTTCAGAGAGCTAGG + Intronic
963080841 3:141392468-141392490 ATTTATTTCTTCCTGGAACAGGG - Intronic
963250250 3:143096157-143096179 ATCTCATTCTTCATGGACAAGGG + Intergenic
963942089 3:151105471-151105493 ATCAAGTGCTGCAGGGAACATGG - Intronic
964060481 3:152516144-152516166 AACCTATTCTTCAGGGAAAAGGG - Intergenic
965114255 3:164467176-164467198 ATTCAATTCCTCAGGGACCAAGG + Intergenic
966975181 3:185076668-185076690 ATGGAATTCTTCAGGAATCAGGG - Intergenic
967968636 3:194983605-194983627 ATTAAATTCTTGAGGAAACAGGG + Intergenic
970367808 4:15378130-15378152 AGCTAATTCTTTAGCTAACATGG + Intronic
971206177 4:24571698-24571720 CTCTAATGCTACAGGAAACATGG + Intronic
971754797 4:30693810-30693832 ATGTACTTCTTAAGGGCACATGG - Intergenic
972589063 4:40466904-40466926 ATCTGATTCTTAAAGAAACAAGG + Intronic
974024614 4:56722411-56722433 ATGTAATTCTTCAGTCTACATGG + Intergenic
974073801 4:57150157-57150179 AACTAATTCTTCAAAGAACCAGG - Intergenic
974817671 4:67026274-67026296 ATCCTATGCTTTAGGGAACAAGG - Intergenic
975444951 4:74452529-74452551 TTCTAAGCCTTCAGAGAACAAGG - Exonic
975975841 4:80095868-80095890 ATATAAATCTTCTGGGAAGATGG - Intronic
976351807 4:84068258-84068280 ATCTAATTATTAAAGGAAGAGGG - Intergenic
976443671 4:85105877-85105899 CTATAAGCCTTCAGGGAACAGGG + Intergenic
977066437 4:92322117-92322139 ATCTAAATCTTTCAGGAACAGGG - Intronic
981000597 4:139825279-139825301 ATCTCCTCCTTCAGGGAACTAGG - Intronic
984102841 4:175506991-175507013 ATCTACTTCTTCAGGTTTCATGG + Intergenic
984686174 4:182670947-182670969 ATATACATCTTCAGGGAAAAGGG + Intronic
987580074 5:19778767-19778789 ATCCAATTCATGAAGGAACAGGG - Intronic
987659260 5:20851289-20851311 ATCTCATCCATCAGGGAGCAAGG - Intergenic
987942924 5:24565607-24565629 ATCTAATTATTCTGGGAATTAGG - Intronic
988013719 5:25526285-25526307 AAATAATTCTTCAATGAACATGG - Intergenic
988764386 5:34354364-34354386 ATCTCATCCATCAGGGAGCAAGG + Intergenic
989248877 5:39284329-39284351 ATCTTATTCATTAGAGAACATGG - Exonic
990206188 5:53432109-53432131 ATGTATTTCTTAAGGGAAAATGG - Intergenic
993862223 5:93149919-93149941 ATATAATACTTCAGGGATTAGGG + Intergenic
994718093 5:103347791-103347813 ATCTGATGCCTCGGGGAACAGGG + Intergenic
995376808 5:111483040-111483062 ATCTATTTCTTAAGGCACCAGGG + Intronic
997031705 5:130137447-130137469 ATATAGTGCTTCAGGGAAAAAGG - Intronic
997120650 5:131169542-131169564 TTCTAGTTGTTCTGGGAACATGG - Intronic
997295217 5:132764674-132764696 ATGTATTTCCTCAGGGAGCAGGG + Intronic
997778304 5:136631004-136631026 ATCTAATTTGTCTGGGAGCAAGG - Intergenic
998648329 5:144089629-144089651 CTCTAATTCTCCAAGGAACGTGG - Intergenic
998858105 5:146414782-146414804 AACTAAATCTTCACTGAACAGGG + Intergenic
998912947 5:146980591-146980613 ATCTAGTTCCACAGGGAACAGGG - Intronic
999565360 5:152854182-152854204 ATCTAGTTCTTAGGGAAACATGG + Intergenic
1002819338 6:710522-710544 GTTTACTTCTTCAGGGAAAAGGG - Intergenic
1003736163 6:8879804-8879826 ATCCCCTTCTTGAGGGAACAGGG + Intergenic
1005043774 6:21622575-21622597 ATCTAATTTTTTAAGGAACGGGG - Intergenic
1005979850 6:30828489-30828511 ATCCAATTCTTCCTGGAACTGGG + Intergenic
1007356770 6:41325495-41325517 ATCAATTTCTACAGAGAACAAGG - Intergenic
1009634339 6:66245531-66245553 ATCTTTTTCTTCAGTAAACAAGG + Intergenic
1010915570 6:81613872-81613894 ATCCAACTCTTCCTGGAACAGGG + Intronic
1011402127 6:86975001-86975023 ATACCATTCTTCAGGGAACCAGG - Intronic
1015702420 6:136051046-136051068 ATCTTATTTTTAATGGAACAAGG - Intronic
1016023329 6:139258494-139258516 ATCTTTTTCTTAAGAGAACATGG + Intronic
1017997261 6:159542840-159542862 GTCTATTTCTTCAGGGACTAAGG - Intergenic
1018311077 6:162509406-162509428 ATTTAAATATTCAGGGAATATGG - Intronic
1022560871 7:31347627-31347649 ATTTAATTCTTAAGGTAGCAAGG - Intergenic
1022718357 7:32919552-32919574 ATGTAACTCTTCAGGATACAAGG - Intergenic
1023758072 7:43438782-43438804 ATGTATTTCTTTAGGTAACAGGG + Intronic
1024948769 7:54837039-54837061 ATCTATTTCCACTGGGAACAGGG - Intergenic
1027447229 7:78288465-78288487 TTTTAATTCTTCAGGAAATACGG + Intronic
1027448349 7:78300697-78300719 AACTGATTCCCCAGGGAACATGG + Intronic
1028594912 7:92538214-92538236 AACTTTTTCTTCAGGGAGCACGG - Intergenic
1028748183 7:94351476-94351498 TTTTAACTCTTCAGGGAGCATGG - Intergenic
1029970545 7:104784652-104784674 ATATAATGCTGCAGTGAACATGG - Intronic
1032703635 7:134403746-134403768 ATCAAATTCTTCAAAGATCATGG - Intergenic
1033828965 7:145229277-145229299 AATTAATTCTTCAGTGAAGATGG + Intergenic
1035419381 7:158714054-158714076 AACTAATTATTCAAGGAAAAGGG + Intergenic
1039263987 8:35804806-35804828 AGCTAATTCTTCTGTGAACAAGG + Intergenic
1039473926 8:37829473-37829495 ATATGTTTCTGCAGGGAACAGGG - Exonic
1040106117 8:43543013-43543035 CTCTGATTCCTCAGGGAGCAGGG - Intergenic
1041176609 8:55203431-55203453 ATCTTTATCTTCAGGGAACTTGG - Intronic
1041458687 8:58087659-58087681 CACTAATACTCCAGGGAACAGGG - Intronic
1042977866 8:74490837-74490859 ATTTAATACTTCAGAGAAGAAGG + Intergenic
1045198982 8:99959910-99959932 ATCTAACTCTTCAGAGAATCTGG + Intergenic
1045544346 8:103114758-103114780 ATCTGATTCTTCAGGCCAGAAGG - Intergenic
1045724357 8:105154524-105154546 ATCTAATTGTTTAGGAAAGATGG + Intronic
1045845423 8:106629473-106629495 ACCAAATTCTTCAGGGAACATGG - Intronic
1050100298 9:2111989-2112011 TTCTAAGTCTTCAGGAAATATGG + Intronic
1050326589 9:4503838-4503860 TTTTAATTCTTCAGTGAAGAAGG - Intronic
1050427390 9:5525414-5525436 ATCAAATTCTCCAGGGCATATGG - Intronic
1050879237 9:10678412-10678434 GTCTCATTCTTCAGGAAATAGGG + Intergenic
1052677818 9:31649611-31649633 TTCTAATTCTACAATGAACATGG - Intergenic
1056476388 9:86955661-86955683 TTCTAATTCTTCAGAGAACATGG + Intergenic
1057535806 9:95904775-95904797 ATCTGATTCCTCAGGAACCACGG - Intronic
1057617973 9:96609422-96609444 TTCTCAGTCTTCAGGGAAAAGGG + Intronic
1058256436 9:102771310-102771332 AAATAATTTTTCAGTGAACATGG + Intergenic
1058705129 9:107631549-107631571 ATCTGAGTCTCTAGGGAACAGGG - Intergenic
1060430071 9:123543453-123543475 GTCTAATAGTTCAAGGAACAGGG + Intronic
1185956531 X:4497125-4497147 ATGAAGTTCTTCAGGGAAGAAGG - Intergenic
1189101017 X:38189808-38189830 ATCAAACTCTTCAGGGAATACGG + Intronic
1190035752 X:47022086-47022108 CTCAAATTCTACATGGAACAAGG - Intronic
1191165767 X:57389660-57389682 ATATAATACTGCAGAGAACATGG + Intronic
1194051727 X:89077839-89077861 GTGGAGTTCTTCAGGGAACAGGG + Intergenic
1194942911 X:100033742-100033764 ATCTAATTATACAGAGAAAAGGG - Intergenic
1195546192 X:106114967-106114989 ATCTCAGTCTTCATGTAACAGGG - Intergenic
1195619942 X:106942902-106942924 TTCTAATTCTTCAGGAAGCAGGG + Exonic
1195996216 X:110734145-110734167 ATCGATTTCTTCTGGGAAAAGGG + Intronic
1196561018 X:117148355-117148377 ATCTAATTCACCAGGGTAAAAGG + Intergenic
1197250644 X:124212994-124213016 ATTTTATTCTTCAGGGCAAAGGG - Intronic
1197873998 X:131084909-131084931 ATCAAATTCTTCACGGAGCTAGG - Exonic
1200167499 X:154047301-154047323 ATCAAATTGTCCTGGGAACATGG - Intronic
1200427245 Y:3035003-3035025 AACTTACTCTTCAGGGAAGAGGG + Intergenic
1200867353 Y:8059118-8059140 AACTATGTCTACAGGGAACATGG + Intergenic