ID: 1159554637

View in Genome Browser
Species Human (GRCh38)
Location 18:69932603-69932625
Sequence GCGCAAAAGCAAAATGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159554637_1159554640 3 Left 1159554637 18:69932603-69932625 CCAGCCTCATTTTGCTTTTGCGC 0: 1
1: 0
2: 0
3: 10
4: 206
Right 1159554640 18:69932629-69932651 TAGCATGATTTCCCTCCAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159554637 Original CRISPR GCGCAAAAGCAAAATGAGGC TGG (reversed) Intronic
900458341 1:2787974-2787996 GCAGAAAAGGAAACTGAGGCAGG - Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901584839 1:10280743-10280765 GCACAAAAGCAAAAAGAAGAAGG - Intronic
902721940 1:18309688-18309710 GGGCAGAGGCAAAAGGAGGCCGG - Intronic
905540400 1:38755948-38755970 TCTCAAAAGAAAAAAGAGGCTGG - Intergenic
906689086 1:47780924-47780946 ACGCACAAGAAAACTGAGGCTGG - Intronic
907369227 1:53989016-53989038 GTGCAAAAAGAAATTGAGGCAGG - Intergenic
908228527 1:62080626-62080648 GCACAAAAGCAAAGTAGGGCTGG - Intronic
908495208 1:64688079-64688101 GCACAATAGCAAGATGAGGAAGG + Intronic
912939599 1:114033241-114033263 GAGAAAAAGAAAAATGAAGCAGG - Intergenic
916178798 1:162066193-162066215 GATCAAAAGCAAATTAAGGCTGG + Intergenic
916305742 1:163329589-163329611 GAGCAAAAGCACAATGGGGAAGG + Intronic
921592274 1:217018522-217018544 GCTGAGCAGCAAAATGAGGCTGG - Intronic
921941267 1:220842361-220842383 GCACAAAAGCAAATGGAGACAGG - Intergenic
922550387 1:226490158-226490180 GCACTAATGCAATATGAGGCTGG + Intergenic
1069433893 10:68362493-68362515 GAACAAAAGGAAAATGTGGCTGG + Intronic
1069686607 10:70322975-70322997 GATTAAAAGCAACATGAGGCAGG - Intronic
1071628611 10:87199107-87199129 GGAGAAGAGCAAAATGAGGCTGG - Intergenic
1071732937 10:88267278-88267300 GCTATAAAGCAAAAGGAGGCTGG + Intergenic
1075382664 10:122031702-122031724 TCGAAAAAGAAAAAGGAGGCTGG - Intronic
1075510805 10:123071435-123071457 GAGCAAACGCCAAATGAAGCAGG + Intergenic
1076565783 10:131398184-131398206 GAGAAAAGGGAAAATGAGGCAGG - Intergenic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078468146 11:11565524-11565546 GAGCAGAAGAAAAAGGAGGCTGG + Intronic
1079294428 11:19219596-19219618 GAACAACAGCAAAATAAGGCGGG - Intergenic
1080744792 11:35099102-35099124 GGTCAAAAGCAATATGAGGAAGG - Intergenic
1081620556 11:44616863-44616885 ACACCAGAGCAAAATGAGGCAGG - Intronic
1082040513 11:47681031-47681053 CAGTAAAAGGAAAATGAGGCTGG + Intronic
1088109477 11:106245788-106245810 GAGCAGAAGCAAAATGGGGGAGG - Intergenic
1089473709 11:118741507-118741529 TCTCAAAAGCAGAATGAAGCTGG + Intergenic
1089703175 11:120257965-120257987 ACGCATAAGGAAACTGAGGCTGG - Intronic
1089714507 11:120345078-120345100 GAACAACAGCAAAATAAGGCAGG - Intronic
1090247875 11:125229633-125229655 GCGCAAAAACAGTGTGAGGCTGG + Intronic
1090566465 11:127997426-127997448 TCACAAGAGCACAATGAGGCAGG - Intergenic
1092749879 12:11708784-11708806 GCTGAAAAGCAAGATGAGTCGGG - Intronic
1093174834 12:15901515-15901537 GAGCAAAGGCAAAGTGAAGCTGG + Intronic
1094200420 12:27789620-27789642 GAGCAAAAACAAATTGCGGCTGG + Intronic
1095156335 12:38860038-38860060 CAGCAAAAGCAAAATTAGGTGGG + Intronic
1096793446 12:54059581-54059603 GAGAAAAATCAAAATGGGGCTGG - Intergenic
1098085431 12:66837520-66837542 CAGCAAAAGTGAAATGAGGCTGG + Intergenic
1098129225 12:67331341-67331363 GGGCAAAGGTAAAATGTGGCGGG - Intergenic
1099997983 12:89800065-89800087 GCTGATAAGAAAAATGAGGCAGG - Intergenic
1102233195 12:111277549-111277571 GCTCAGAAGCAAAATGAAGCAGG - Intronic
1104225930 12:126833047-126833069 AAGCAAAACAAAAATGAGGCAGG - Intergenic
1104577290 12:129979553-129979575 GCACAAAGGAAAAATGAGACTGG - Intergenic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1104838013 12:131804459-131804481 CTGCAAAAGCAAGATGAAGCTGG - Intergenic
1105871109 13:24506887-24506909 GCGCAGGAGCCAACTGAGGCGGG + Intronic
1106717328 13:32405211-32405233 GATAAAAAGTAAAATGAGGCCGG + Intronic
1110982254 13:81915817-81915839 GCCCAAAAGGAAGATGAGGCTGG + Intergenic
1112898935 13:104335970-104335992 GAGCAAGAGCAAAGTGAGCCTGG - Intergenic
1113646804 13:112003579-112003601 AGGCAAAAGCAAAACAAGGCTGG + Intergenic
1113830090 13:113288873-113288895 GGGAAAATGCAAAATGAGCCTGG - Intergenic
1114987551 14:28250049-28250071 CAGCAAAAGAAAAATGAGGAAGG + Intergenic
1115210273 14:30960571-30960593 GCTAAAAATGAAAATGAGGCTGG + Intronic
1119412726 14:74444452-74444474 GCAGAAAAACAAAATAAGGCTGG + Intergenic
1121043049 14:90765940-90765962 GAGAAAGAGAAAAATGAGGCTGG - Intronic
1121982932 14:98470502-98470524 TCTCAAAATCAAAATGATGCTGG - Intergenic
1125006898 15:34826854-34826876 GCGTAAAAACAATATGTGGCCGG + Intergenic
1125985658 15:44048866-44048888 GATCAAAATCATAATGAGGCCGG - Intronic
1127481871 15:59385156-59385178 CCTCAAAAACAAAAGGAGGCTGG - Intronic
1128013715 15:64323221-64323243 ACACAAAAGCAAGAGGAGGCTGG - Intronic
1129467691 15:75733090-75733112 GGGCATCAGCAAAATGGGGCCGG - Intergenic
1132592639 16:732930-732952 GCAGAAAAGCAAACTGTGGCCGG - Intronic
1136058013 16:27705205-27705227 GCACAAAAGAAAATGGAGGCTGG - Intronic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1141150231 16:81559336-81559358 GCACAAAAGAATCATGAGGCTGG - Intronic
1141272236 16:82551893-82551915 GCACATAAGAAAAATGAGCCCGG + Intergenic
1144133547 17:12270903-12270925 GAGCAAATGCAAAATTAGGAAGG - Intergenic
1147422551 17:40329748-40329770 AATCAAAAGCACAATGAGGCTGG - Intronic
1150143996 17:62752772-62752794 GAGCAAAAGCAAAAGGAAGAGGG - Intronic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1151429317 17:74051726-74051748 GAGGAACAGGAAAATGAGGCTGG + Intergenic
1152057758 17:78044699-78044721 GCACAAAAGCAGAATGAGTGTGG - Intronic
1152315540 17:79578352-79578374 GAGCAAAACCAAACCGAGGCAGG + Intergenic
1153853731 18:9123789-9123811 TTGTAAAAGAAAAATGAGGCAGG - Intronic
1154349904 18:13574265-13574287 GGGAAAAAGCAGAATGTGGCTGG + Intronic
1154387433 18:13907498-13907520 CAACAAAAGCAAAATCAGGCAGG + Intronic
1157348720 18:46865241-46865263 AAGTAAAGGCAAAATGAGGCCGG + Intronic
1157508167 18:48246572-48246594 TCGCAAATGGAAAATGAGGTAGG + Intronic
1158916532 18:62137164-62137186 GCGCAGGAGAAATATGAGGCTGG - Intronic
1159554637 18:69932603-69932625 GCGCAAAAGCAAAATGAGGCTGG - Intronic
1161712293 19:5855707-5855729 AGGTAAAAGCAAAAAGAGGCTGG - Intergenic
1162364824 19:10242209-10242231 GAAAAAAAGCAAAAAGAGGCCGG + Intergenic
1165680388 19:37769429-37769451 GCACTAAAGAAAAACGAGGCTGG + Intronic
1165726728 19:38117945-38117967 GCGTAAAGAGAAAATGAGGCTGG - Intronic
1167726094 19:51213830-51213852 AAGAAAAAGAAAAATGAGGCTGG - Intergenic
1168180560 19:54660148-54660170 ATACAAAAGCAAAATGAGGCCGG + Intronic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
926759932 2:16269452-16269474 GGGCAAAAGTAAAATGGGGAAGG - Intergenic
927372535 2:22373408-22373430 GCCCAAGAGAAAAATGAGGGGGG - Intergenic
927955642 2:27205562-27205584 GAGCAACAACAAAATAAGGCAGG - Intronic
929250497 2:39749410-39749432 GCACCTAAGCAAAATGAAGCTGG - Intronic
931169885 2:59791436-59791458 GCACAAAAGCAAGATAAAGCTGG + Intergenic
931591069 2:63883909-63883931 GAGCAAAAGAAAAGTGAGTCTGG + Intronic
931724442 2:65095347-65095369 TCTCAAAAACAAAATAAGGCTGG - Intronic
933524876 2:83424016-83424038 TCACAAAAGCAAAATGATGAGGG - Intergenic
935165374 2:100564590-100564612 CATCAAAAGAAAAATGAGGCCGG - Intronic
935402195 2:102671752-102671774 GCTCAGAAGCCACATGAGGCTGG - Intronic
936350562 2:111709517-111709539 TCCCAAGAGCAAAATGGGGCAGG + Intergenic
938196683 2:129334799-129334821 GGGCATCAGCAAAGTGAGGCTGG + Intergenic
939683170 2:145164065-145164087 TCGAAAAAGGAAAATGAGACTGG - Intergenic
940678391 2:156753000-156753022 GAGCAACAACAAAATAAGGCAGG + Intergenic
942178973 2:173361746-173361768 GCTAAAAAGCAAAAGAAGGCTGG - Intronic
944702283 2:202256930-202256952 CCACAAAACAAAAATGAGGCCGG + Intergenic
945124095 2:206489095-206489117 CCACAAGAGAAAAATGAGGCAGG - Intronic
945848913 2:214982106-214982128 ATACAAAAGCAAACTGAGGCTGG - Intronic
947186958 2:227463933-227463955 GCTCTAAAGGAAAATGAAGCAGG - Intergenic
947309633 2:228787124-228787146 GTGCAAATACAAAATGATGCTGG + Intergenic
948568443 2:238901270-238901292 GAGCAAAAGGCAAAGGAGGCCGG - Intronic
1169103637 20:2974680-2974702 AATCAAAACCAAAATGAGGCCGG - Intronic
1170601371 20:17843858-17843880 GTTCACAAGCAAAATGAGGGAGG + Intergenic
1173547317 20:43908809-43908831 GCCCATAAGCAAAGAGAGGCAGG - Intergenic
1174051244 20:47769039-47769061 TCTCAAAAAAAAAATGAGGCAGG - Intronic
1176336195 21:5602159-5602181 GCGTAACTGCAGAATGAGGCGGG + Intergenic
1176391562 21:6218789-6218811 GCGTAACTGCAGAATGAGGCGGG - Intergenic
1176469857 21:7097385-7097407 GCGTAACTGCAGAATGAGGCGGG + Intergenic
1176493418 21:7479163-7479185 GCGTAACTGCAGAATGAGGCGGG + Intergenic
1176507224 21:7659220-7659242 GCGTAACTGCAGAATGAGGCGGG - Intergenic
1178170777 21:30037534-30037556 GCTCTAAAGCAATATGAGGTGGG + Intergenic
1178387624 21:32166437-32166459 GGGAAAATGCAAAATGAGCCTGG + Intergenic
1178551372 21:33542512-33542534 GCTAAAAAAAAAAATGAGGCTGG + Intronic
1180261665 21:46674562-46674584 GCACAAAAGAAAAATCAGGTTGG + Intergenic
1180582834 22:16857798-16857820 GTGCCCAAGCAAAATGGGGCTGG - Intergenic
1183961741 22:41415372-41415394 GCTCAAAGGTAAAATGAGGCCGG - Intergenic
952639534 3:35577029-35577051 ACACAAATGCAAAATGAGCCAGG - Intergenic
953500001 3:43424101-43424123 GGGCAAAGTCAGAATGAGGCTGG - Intronic
953655025 3:44844214-44844236 GTTCAAAACCTAAATGAGGCAGG + Intronic
954003549 3:47576231-47576253 TTACAAAGGCAAAATGAGGCCGG - Intronic
956974009 3:74559213-74559235 TCTCAACAGCAAAATGAGGAAGG + Intergenic
958058275 3:88442284-88442306 GCTCACAAGGAAATTGAGGCAGG - Intergenic
960274255 3:115709227-115709249 CTGCAAAAGCAAGAGGAGGCAGG - Intronic
961834907 3:129649602-129649624 TTGCCAAAGCAAAAGGAGGCTGG + Exonic
961986800 3:131143094-131143116 GCTCAAAAGCCAAATGTGGCTGG + Intronic
965795035 3:172430771-172430793 GTGCAAAAACAAAATCAGCCAGG + Intergenic
968323178 3:197789721-197789743 GAGCAAAAGAAAAATAAGGATGG - Intergenic
971017775 4:22506254-22506276 GATGAAAAGCAAAATAAGGCCGG + Intronic
972627183 4:40811268-40811290 GGATAAAAGCAATATGAGGCCGG + Intronic
972770052 4:42189352-42189374 GGGCAAAGGCGAAGTGAGGCTGG + Intergenic
973230473 4:47835235-47835257 GACCAAATGGAAAATGAGGCTGG - Intronic
975570758 4:75815481-75815503 GTGCAAAAGCAAAGTGAGAAAGG - Intergenic
978310268 4:107379607-107379629 GAGAAAAAGAAAAATGAGGTGGG - Intergenic
978908539 4:114038277-114038299 GAGCACAAGCAAAATGAAGAAGG + Intergenic
981195659 4:141917098-141917120 GCTCAAAAGCCACATGTGGCTGG + Intergenic
982765148 4:159337956-159337978 AAGAAACAGCAAAATGAGGCTGG + Intronic
983930907 4:173452353-173452375 GAGCAAAAGCAAGAGGAGGATGG + Intergenic
983932990 4:173473622-173473644 GTGCATAAGGAAAAAGAGGCAGG + Intergenic
985530859 5:433254-433276 GAGCAAAGGCAAGATGAGGTTGG - Intronic
986457869 5:7938301-7938323 GCCCAAAAGCAAATTGTGTCAGG - Intergenic
986789791 5:11148626-11148648 GCACCAAAGCACCATGAGGCAGG - Intronic
991279020 5:64889627-64889649 TCATAAAAGCAAATTGAGGCCGG + Intronic
991669965 5:69037800-69037822 GAGAAAAAGGAAAATGAGGCTGG + Intergenic
992113153 5:73514945-73514967 GCTCAAAAACAAAACCAGGCCGG + Intergenic
992625227 5:78630800-78630822 ACGCAAAAGCAGAATAAGGCGGG + Intronic
994336721 5:98575911-98575933 GCTCACAAATAAAATGAGGCTGG - Intergenic
996113338 5:119591389-119591411 GTTAAAAAGCCAAATGAGGCCGG + Intronic
997438257 5:133890537-133890559 GCTCAAAAGCCACATGTGGCTGG - Intergenic
997800363 5:136854626-136854648 GTTTGAAAGCAAAATGAGGCTGG - Intergenic
997801280 5:136865201-136865223 GCGCAAAAGGAAAAGGGAGCTGG + Intergenic
997969856 5:138392203-138392225 GGGCAAAAGCAAAGGGAAGCAGG + Exonic
999223006 5:149997263-149997285 CCTCAAAAGCAAAAATAGGCCGG + Intronic
999551762 5:152695265-152695287 GCTGAGAAGAAAAATGAGGCTGG - Intergenic
1000835904 5:166153854-166153876 TAGAAAAAGGAAAATGAGGCTGG - Intergenic
1001519357 5:172379781-172379803 GCCCAGAAGCAAAGTGAGGGAGG + Intronic
1003850647 6:10218997-10219019 TCTCAAAAGAAAAATGATGCTGG + Intergenic
1009374719 6:62953126-62953148 AGGCAAAAGGAAAATGAGGGAGG + Intergenic
1010041671 6:71391907-71391929 GAGGAAGAGGAAAATGAGGCTGG - Intergenic
1011157035 6:84344378-84344400 GCAAAAAAGCAAAAAGAGGATGG - Intergenic
1011438531 6:87363985-87364007 GTGCAAAAAAAAAATTAGGCTGG + Intronic
1012048786 6:94312622-94312644 TAGTAAAAGAAAAATGAGGCCGG + Intergenic
1013070826 6:106727726-106727748 GCGAATGGGCAAAATGAGGCAGG - Intergenic
1014072015 6:117193232-117193254 GAGAAAAAGCAAAATGAGGTGGG - Intergenic
1015885043 6:137909303-137909325 TCTCCAAAGAAAAATGAGGCTGG + Intergenic
1015969194 6:138727497-138727519 TGGAAAAAGAAAAATGAGGCAGG + Intergenic
1016754255 6:147666436-147666458 GCACAAAAGCAGAAACAGGCTGG - Intronic
1017019036 6:150125471-150125493 GAGCAAGAGAGAAATGAGGCTGG - Intergenic
1017808206 6:157964682-157964704 TCTCAAAAATAAAATGAGGCCGG + Intergenic
1021080460 7:16358030-16358052 GGGTACCAGCAAAATGAGGCTGG + Intronic
1022395703 7:29986493-29986515 GCTCAATAGCCACATGAGGCTGG + Intronic
1022461266 7:30610151-30610173 GCTCAAGAGCCAAATGTGGCTGG - Intronic
1025010871 7:55397163-55397185 TTTAAAAAGCAAAATGAGGCTGG + Intronic
1026328998 7:69335886-69335908 GCTGAAAAGGAAAGTGAGGCTGG - Intergenic
1026770537 7:73194922-73194944 GCACAAAGGGAAACTGAGGCAGG - Intergenic
1027011403 7:74748311-74748333 GCACAAAGGGAAACTGAGGCAGG - Intronic
1027076637 7:75197731-75197753 GCACAAAGGGAAACTGAGGCAGG + Intergenic
1027596273 7:80177768-80177790 GCGTAAAAACAACATTAGGCTGG - Intronic
1029050216 7:97678984-97679006 GCTCAAAAGCTACATGTGGCTGG + Intergenic
1029205715 7:98868349-98868371 GGGCAAAAGCAAAAAGAGATGGG + Intronic
1029996730 7:105014069-105014091 GCCCACAAGCAAAATGGCGCCGG + Intergenic
1031371481 7:120972764-120972786 GAGCAAAAGAAAAATGAGAAAGG + Intronic
1032118903 7:129142191-129142213 TTTAAAAAGCAAAATGAGGCCGG - Intergenic
1035886351 8:3295420-3295442 GTACAAAAGCAAATTGAGGCTGG - Intronic
1039592729 8:38763451-38763473 ATGCTAAAACAAAATGAGGCCGG - Intronic
1044576100 8:93770543-93770565 CCACAAAAGCAAAGTGAAGCAGG - Intronic
1046945308 8:119968860-119968882 GAGAAAAAGTAAGATGAGGCTGG + Intronic
1050102305 9:2131682-2131704 TAGAAAAAACAAAATGAGGCCGG + Intronic
1051133093 9:13884510-13884532 GAGAAAAAGAAAAATGAAGCAGG - Intergenic
1056043388 9:82690684-82690706 GTGCAAAAGCAACATGATCCTGG + Intergenic
1056143667 9:83708123-83708145 GACTAAAAGCAAAATGGGGCGGG + Exonic
1058455045 9:105130870-105130892 GGGCAAAAAAAGAATGAGGCTGG + Intergenic
1061531623 9:131218586-131218608 GCCCCATAGCAAAATGGGGCGGG - Intronic
1061734556 9:132644968-132644990 GAGCAAAAGCAAAGAGAGGCTGG + Intronic
1062036956 9:134386658-134386680 CAGCAACAGCAAACTGAGGCTGG + Intronic
1185587385 X:1249878-1249900 GCAGAAAAACAAACTGAGGCTGG + Intergenic
1188984803 X:36759588-36759610 GGGAATAAGCAAAATAAGGCAGG - Intergenic
1190414388 X:50166948-50166970 GCCCAAATGCAAATTCAGGCAGG - Intergenic
1192464508 X:71344659-71344681 TCTCAAAAATAAAATGAGGCTGG - Intergenic
1195711198 X:107775206-107775228 GCTCAACAGCATAATGCGGCAGG - Exonic
1195877505 X:109557524-109557546 GGACAAAAGCAGAATTAGGCAGG - Intergenic
1195947286 X:110228781-110228803 GCGTATAAGCAAGATGAGGAGGG - Intronic
1196722264 X:118865483-118865505 GCCCAAAAGCAAGAACAGGCAGG - Intergenic
1197742319 X:129904819-129904841 GGGCAAAAGCAAAATGGGAATGG + Intergenic
1197760828 X:130026917-130026939 TGGCAAAGGCCAAATGAGGCAGG + Intronic
1197777763 X:130130630-130130652 GCTCAAAAGCCACATGTGGCTGG + Intronic
1198988716 X:142485957-142485979 GCACAAAAGCAAGATGAGCAGGG + Intergenic
1200155484 X:153972561-153972583 GCGCCGCAGCAAAATGAGCCGGG + Exonic
1200293834 X:154897521-154897543 GCGCAGGAGAAAAATGAAGCAGG + Intronic