ID: 1159555510

View in Genome Browser
Species Human (GRCh38)
Location 18:69941134-69941156
Sequence GAAAATGTACAGAAACACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 651
Summary {0: 1, 1: 0, 2: 3, 3: 121, 4: 526}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159555507_1159555510 -6 Left 1159555507 18:69941117-69941139 CCTCTGCCTAGACTTCAGAAAAT 0: 1
1: 19
2: 480
3: 1261
4: 1719
Right 1159555510 18:69941134-69941156 GAAAATGTACAGAAACACCTGGG 0: 1
1: 0
2: 3
3: 121
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159555510 Original CRISPR GAAAATGTACAGAAACACCT GGG Intronic
904218476 1:28943991-28944013 GAAAATCTACATATACACATTGG + Intronic
904219152 1:28950825-28950847 AAAAAAGTACAGAAACTGCTAGG - Intronic
905717282 1:40162408-40162430 GAAAACATACAGAAAAATCTCGG - Intronic
906785497 1:48611953-48611975 GAAAAGGAACATAAACAGCTAGG + Intronic
906882985 1:49613012-49613034 GAAAATGTACATATACATCATGG + Intronic
907346164 1:53782566-53782588 GAAACTGTACAGAAGCAGCAAGG + Intronic
908964408 1:69740596-69740618 GATGAGGTACAGAAACAACTGGG + Intronic
909053833 1:70799671-70799693 GAAAATGAACATATACACCATGG + Intergenic
909104532 1:71392054-71392076 GAAGATGTATGGAAACGCCTGGG + Intergenic
909520124 1:76558372-76558394 GAAAATGTACATATACACCATGG + Intronic
910139729 1:84013860-84013882 GAAAATGTACATATACGCCATGG + Intergenic
910148230 1:84108106-84108128 GAAAATGTACATATACACCATGG + Intronic
910690912 1:89964852-89964874 GAAAATATACATAAAGACCTTGG + Intergenic
911775680 1:101808840-101808862 GTAAATGTTCAGAAAAACCAGGG + Intronic
913459006 1:119063791-119063813 GAAAATGTATGGAAATGCCTTGG + Intronic
913510857 1:119560555-119560577 AAAAAAGGACAGCAACACCTGGG + Intergenic
913515080 1:119597960-119597982 AAAAAAGGACAGTAACACCTGGG + Intergenic
913567647 1:120088783-120088805 GAAAATGTACATACATACCATGG - Intergenic
914079093 1:144389455-144389477 GAAAATGTATGAAAACACATTGG + Intergenic
914100086 1:144577047-144577069 GAAAATGTATGAAAACACATTGG - Intergenic
914173997 1:145258002-145258024 GAAAATGTATGAAAACACATTGG + Intergenic
914288393 1:146249491-146249513 GAAAATGTACATACATACCATGG - Intergenic
914298903 1:146360635-146360657 GAAAATGTAAGAAAACACATTGG + Intergenic
914358265 1:146907552-146907574 GTGCATGTATAGAAACACCTTGG + Intergenic
914495160 1:148189455-148189477 GTGCATGTATAGAAACACCTTGG - Intergenic
914528658 1:148499187-148499209 GAAAATGTATGAAAACACATTGG + Intergenic
914549429 1:148700237-148700259 GAAAATGTACATACATACCATGG - Intergenic
914617252 1:149371481-149371503 GAAAATGTACATACATACCATGG + Intergenic
914637735 1:149567921-149567943 GAAAATGTATGAAAACACATTGG - Intergenic
914693729 1:150055666-150055688 GAAAATGTACGTATACACCATGG + Intergenic
914697942 1:150102653-150102675 GAAAATGTACATATACACCATGG + Intronic
916897402 1:169179588-169179610 GAAAATGTACATATACACCATGG + Intronic
917619632 1:176782919-176782941 GACAATTTTCAGAAACACCTGGG + Intronic
918356567 1:183710499-183710521 GAAAATGGACTAATACACCTGGG - Intronic
918518664 1:185390115-185390137 GAAATTCTACATAAATACCTTGG + Intergenic
919194159 1:194262697-194262719 GAAAATGTACATATACAACATGG + Intergenic
919260060 1:195180756-195180778 GGAAATGTACATATACACCGTGG - Intergenic
920154052 1:203933981-203934003 GAAAATGAAAAGCAACACCTGGG - Intergenic
920494111 1:206441972-206441994 AAATATGTGCAAAAACACCTGGG - Intronic
920895268 1:210042019-210042041 GAAACTGTCCAGAAAAACCCAGG - Intronic
921436299 1:215127236-215127258 GAAATTGAACACAAAAACCTTGG - Intronic
921536147 1:216350949-216350971 GAGGATGTACAGAAAAGCCTGGG - Intronic
922138198 1:222853521-222853543 GAAAATGTATATATACACCACGG + Intergenic
922156356 1:223042571-223042593 CAAAATGAACAAAAACCCCTAGG + Intergenic
923085369 1:230699158-230699180 GAAAATGTAGATATACACCATGG - Intergenic
923177530 1:231481626-231481648 GAAAATGTACACATACACTGTGG - Intergenic
923607804 1:235460530-235460552 GAAATAGTACAGAAACAGCCAGG - Intronic
924101360 1:240605786-240605808 ATAAATTTACAGGAACACCTTGG + Intronic
924269375 1:242316972-242316994 GAAAATGTGCATATACACCATGG - Intronic
924702291 1:246466306-246466328 GAAAATGTACCTATACACCATGG + Intronic
924769836 1:247069624-247069646 GAAAATGTACATACACACAGTGG + Intronic
1062928226 10:1334054-1334076 GAAAAGTTAAAGACACACCTTGG - Intronic
1063450977 10:6149941-6149963 GAAAATGTACATATACAACATGG - Intronic
1063552767 10:7048849-7048871 GAAAATGTACAGTAAGAACATGG + Intergenic
1063748637 10:8916633-8916655 GAAAATGTAAATATACACCATGG + Intergenic
1063819305 10:9816481-9816503 GAAAATTTACATATACACCATGG - Intergenic
1063850196 10:10180524-10180546 GAAAATGTGCAGGAACTTCTAGG + Intergenic
1064798291 10:19039119-19039141 GAAAATGTACATATACACCATGG + Intergenic
1064819739 10:19313892-19313914 GAAATGTTACAGAACCACCTAGG - Intronic
1065146433 10:22772832-22772854 AAAAATGTACATATACACCATGG - Intergenic
1065640073 10:27772619-27772641 GAAAATGTATATATACACCATGG - Intergenic
1065653039 10:27914111-27914133 GAAAATGTACATACAAACCATGG + Intronic
1066173647 10:32879912-32879934 GAAAATGTACATATACACCATGG - Intronic
1067929813 10:50549324-50549346 GAAAATGTACATATACACCATGG + Intronic
1068519468 10:58062806-58062828 GAAAATGTATAGAAATGCCTGGG - Intergenic
1068872567 10:61961007-61961029 AAAAATGTCCATAAGCACCTGGG - Intronic
1069485563 10:68820581-68820603 GAAAATGTACATATGCACCATGG - Intergenic
1070579296 10:77707618-77707640 GAAAATGTACAGATACACAATGG + Intergenic
1071022650 10:81076787-81076809 GGAAATGTACATATACACCACGG - Intergenic
1073059152 10:100723240-100723262 CAATATGTACAGACACACATAGG - Intergenic
1073591610 10:104762891-104762913 GAAAATAGACAAATACACCTGGG + Intronic
1073863843 10:107778191-107778213 GAAAATGAAAAGCAACACATCGG + Intergenic
1074389919 10:113048514-113048536 GAAAGTGTTCAGAACCATCTTGG + Intronic
1074404403 10:113168782-113168804 GAAAATGCACATAAACAGCTTGG - Intergenic
1074455498 10:113592280-113592302 GAAAGTCTACAGAAACTCCTGGG - Exonic
1074794595 10:116929322-116929344 GAAAATCTTTAGAAACACCAGGG - Intronic
1075225289 10:120623754-120623776 GGAAAAATACAGATACACCTTGG - Intergenic
1075289371 10:121215073-121215095 AAAAATGCAGAGAATCACCTGGG + Intergenic
1075500503 10:122969439-122969461 GAAAATGTACATATACACCATGG + Intronic
1075860352 10:125669957-125669979 GAAAATGTACATGTACACCACGG - Intronic
1076299719 10:129415881-129415903 TAAAATGTACAGAAAGACAGGGG - Intergenic
1077173683 11:1179355-1179377 CCAAATAAACAGAAACACCTGGG + Intronic
1077703126 11:4459818-4459840 GAAAAGGTCCAGAAACATCAGGG - Intergenic
1077770380 11:5211737-5211759 GAACATGTACATATACACCATGG - Intergenic
1078113271 11:8418448-8418470 GAAAATGTACATATACACCATGG - Intronic
1078159041 11:8824560-8824582 GAAAATGTACATATACAGCATGG - Intronic
1078556833 11:12334813-12334835 GAAAATGTACATATACACCATGG - Intronic
1078560919 11:12371719-12371741 GAAAATGCACATATACACCATGG + Intergenic
1078645625 11:13139280-13139302 GAAAATGTACATATACATCATGG - Intergenic
1079837558 11:25352341-25352363 GAAAAGGTACAGAAAAAATTGGG + Intergenic
1079844265 11:25444845-25444867 GAAAAAAAACAGAAACACTTGGG + Intergenic
1080895025 11:36441748-36441770 GAAGATGTATAGAAAAGCCTGGG - Intronic
1081080863 11:38737576-38737598 GAAAAAGAACAGAAATACCTGGG - Intergenic
1081168094 11:39831430-39831452 GAAAATGTGAAGAAACAACGAGG + Intergenic
1081186119 11:40044427-40044449 GATAATGTACAGGCATACCTTGG + Intergenic
1081562608 11:44231696-44231718 TAAATTATACAGAAACACATGGG + Intronic
1082661399 11:55916440-55916462 GGGAATGTAGAGAGACACCTAGG - Intergenic
1082702619 11:56451724-56451746 GAAAATGTACAGATACGCCATGG - Intergenic
1084216944 11:67652787-67652809 GAAAATGAGCAGAAACTACTGGG - Intergenic
1084969286 11:72761418-72761440 GAAAATTTACAGAAACAAAATGG + Intronic
1085362140 11:75899019-75899041 GATAATGTACTAAAAGACCTGGG - Intronic
1086043892 11:82510427-82510449 AAAAACCTACAGAAAAACCTTGG + Intergenic
1086567151 11:88240230-88240252 GAAAATGTAAAGAAGCACTGGGG - Intergenic
1086892761 11:92277488-92277510 GGAAATGTGCATACACACCTTGG + Intergenic
1087180253 11:95134962-95134984 GAAAATGTACAGTAACTCAGAGG - Intergenic
1087720723 11:101662495-101662517 GAAAATGTACATATATACCATGG - Intronic
1088025156 11:105170878-105170900 AAAAATGTACATATACACCATGG - Intergenic
1088273838 11:108063410-108063432 GAAAATGTACATAAACACAATGG - Intronic
1088420385 11:109638567-109638589 GAAAATGTACATACACACAATGG - Intergenic
1088497999 11:110451716-110451738 GAAAATGTACATATACACCATGG + Intronic
1088570116 11:111214621-111214643 GAGAATGTAGAGAAAGACATAGG + Intergenic
1088934664 11:114387607-114387629 GAAAATGGACTAAGACACCTTGG + Intergenic
1090395825 11:126417230-126417252 GAAAATGTAAATAAAATCCTTGG - Intronic
1090607323 11:128434693-128434715 GAAATTGTACAGCAAACCCTGGG + Intergenic
1090630468 11:128643060-128643082 GAAAATGTATATATACACCATGG + Intergenic
1093054381 12:14540547-14540569 GAAAATACACAGAAACAAGTTGG + Intronic
1093097765 12:14991542-14991564 GAAAATGTACATATACACCATGG + Intergenic
1093419466 12:18958209-18958231 GAAAATGTACACATACACAATGG - Intergenic
1093947367 12:25124980-25125002 GAAAATGTACATACCCACCATGG - Intronic
1094217059 12:27953794-27953816 GAAAATGTAAGGAAACTCTTTGG + Intergenic
1094218208 12:27968110-27968132 GACAATTTTCAGAAACACATCGG + Intronic
1094367959 12:29704083-29704105 GAAAATGTACAAATACACTTAGG + Intronic
1095130085 12:38530731-38530753 GAAAATGTACATTTACACCATGG - Intergenic
1095195597 12:39312152-39312174 GAAAATGTACATACACACAATGG + Intronic
1095258978 12:40076515-40076537 GAAAATGTACATATACACCATGG - Intronic
1095391048 12:41707061-41707083 GAAAATGTACATATACACCATGG - Intergenic
1095590226 12:43894753-43894775 GAAAATGTACATACACACCATGG - Intronic
1095919399 12:47514235-47514257 GAGGATGTATGGAAACACCTTGG + Intergenic
1096599128 12:52717039-52717061 GGAAATGTACAGAATTCCCTGGG + Intergenic
1097367847 12:58739845-58739867 GAAAATGTACATATACACCATGG - Intronic
1097375335 12:58836407-58836429 GAAAATGTACATATACACCATGG - Intergenic
1097464975 12:59910985-59911007 GAAAATGTACAGAAAATCAATGG + Intergenic
1097600682 12:61688691-61688713 AAAAATGTACATATACACCATGG - Intergenic
1097619094 12:61918517-61918539 GAAAATGTACACATACACAATGG - Intronic
1098225273 12:68315074-68315096 GAAGACGTACAGAAACAGCCCGG - Exonic
1098481737 12:70969681-70969703 GAAAATGTATATATACACCAAGG - Intergenic
1098628354 12:72699828-72699850 GAGGATGTATGGAAACACCTGGG - Intergenic
1098747410 12:74256786-74256808 TAAACTGTACATAAACACATAGG + Intergenic
1098938915 12:76512332-76512354 GAAAATGTACATATACACCATGG - Intronic
1100454531 12:94739588-94739610 GAAAATGTGCATATACACCATGG - Intergenic
1100869796 12:98897844-98897866 GAAAATGTAAATATACACCATGG + Intronic
1101071727 12:101082397-101082419 GAAAATGGACAGATACATCCAGG + Intronic
1101392905 12:104318939-104318961 GAAGCTGTACAGAATCACATTGG + Exonic
1102437154 12:112933589-112933611 TAAAAAGTACAAAAACAGCTGGG + Intergenic
1103089430 12:118087137-118087159 CTAAATGTACAGAAATCCCTTGG - Intronic
1103866877 12:124059661-124059683 GAAAATGTACATATACACCATGG - Intronic
1104147793 12:126052637-126052659 GAAAATGCACAGTAAAACCACGG + Intergenic
1104262353 12:127196101-127196123 GAAAATGTACATATACATCATGG + Intergenic
1104781871 12:131426960-131426982 GACAATGTACACAAACAACATGG + Intergenic
1105260326 13:18774364-18774386 GAGTATGTACGGAAAAACCTGGG - Intergenic
1105976222 13:25475379-25475401 GAAAATGTACATATACACTATGG - Intronic
1106048465 13:26167828-26167850 GAAAATGTACATATACACCATGG + Intronic
1107563092 13:41575044-41575066 GAAAATGTATATATACACCATGG + Intronic
1108315079 13:49228884-49228906 CTAAGTGTACATAAACACCTAGG - Intergenic
1108650018 13:52468738-52468760 GAAAATGTACATATACACCATGG - Intronic
1108968510 13:56342149-56342171 GAGAATGTATGGAAACAACTGGG - Intergenic
1109139744 13:58699593-58699615 GAAGAAGAACAGAAACAGCTTGG + Intergenic
1109167582 13:59055297-59055319 GAAAATGTACATATACACCATGG + Intergenic
1109359141 13:61272844-61272866 GCAAAAGTACAGCAACATCTTGG + Intergenic
1109444901 13:62423033-62423055 GAAAAGGAACAAAAATACCTTGG - Intergenic
1109553034 13:63930915-63930937 AAAAATGCACAGAAACACTCTGG + Intergenic
1109721088 13:66277336-66277358 GAAAATGTATGGAAATGCCTGGG + Intergenic
1109801594 13:67386011-67386033 GAAAATGTACATATTCACCATGG - Intergenic
1109898668 13:68731959-68731981 GAAAATGTACACGTACACCATGG + Intergenic
1110007391 13:70290110-70290132 GAAAATGTACATAAACATCATGG + Intergenic
1110128252 13:71975437-71975459 GAAAATGTACATACACACAATGG - Intergenic
1110378007 13:74815505-74815527 GAAAATGGACTAATACACCTAGG + Intergenic
1110442698 13:75542964-75542986 GAAAATGTACATATACACCATGG + Intronic
1110773633 13:79379554-79379576 GAAAATGTATTGAGACAACTTGG + Intronic
1111272488 13:85904729-85904751 GAAAATGTACACATACACTGTGG + Intergenic
1111296713 13:86288851-86288873 GAAAGAGTTCAGGAACACCTGGG + Intergenic
1111313890 13:86526686-86526708 GTGAATGTACAGAAATAACTTGG + Intergenic
1111548188 13:89771991-89772013 GAAAATGTACCTAAACATTTAGG - Intergenic
1111623927 13:90759107-90759129 GAAAAAGAACAGAAATACTTGGG - Intergenic
1112091019 13:96084246-96084268 GAAAAAGGAGAGAAAAACCTTGG - Intergenic
1112124818 13:96453499-96453521 TAAGATGTGCAGAAACACCGTGG + Intronic
1113395560 13:109944305-109944327 GAAAATCTACAGTAATACTTGGG - Intergenic
1115253809 14:31377212-31377234 GAAAATGTAGTGTAAAACCTGGG + Intronic
1115697792 14:35919291-35919313 CAAAATGTAGAGAAACAACAAGG - Intronic
1115912303 14:38269916-38269938 AAAAATGTACATATACACCATGG + Intergenic
1116088302 14:40270149-40270171 AAAAATGTAAAGACACAACTAGG - Intergenic
1116122432 14:40737487-40737509 AAGGATGTATAGAAACACCTGGG + Intergenic
1116670022 14:47828986-47829008 GAAGATGTGTGGAAACACCTTGG - Intergenic
1117422706 14:55562746-55562768 GAAAATGTAAAGAATAACATTGG - Intronic
1118146937 14:63147899-63147921 GTAAATGTACATATACACCATGG - Intergenic
1118580145 14:67287906-67287928 GAGATTATACAGAAACTCCTTGG + Intronic
1119532620 14:75373645-75373667 GAAAATGAACAGAAATTGCTAGG - Intergenic
1120267824 14:82274193-82274215 GAAAATATAGAGATACAACTAGG + Intergenic
1120625115 14:86815862-86815884 GAAAATGTACATATATACCATGG + Intergenic
1120638423 14:86980245-86980267 TAAAATTTACAGACACACATTGG + Intergenic
1121491227 14:94362563-94362585 GCAAACACACAGAAACACCTAGG + Intergenic
1121805420 14:96816033-96816055 GAAAATGTACAGAAGGAACCTGG + Intronic
1122559692 14:102603546-102603568 AAAAATTTACAGACACCCCTGGG - Intronic
1123138253 14:106050510-106050532 GAAGATGTATGAAAACACCTGGG + Intergenic
1202835318 14_GL000009v2_random:73873-73895 GAGTATGTACGGAAAAACCTGGG + Intergenic
1123469089 15:20536809-20536831 GGAACTGTACAGGAACACGTAGG - Exonic
1123648972 15:22463882-22463904 GGAACTGTACAGGAACACGTAGG + Exonic
1123682353 15:22771687-22771709 GGAACTGTACAGGAACACGTAGG - Intergenic
1123729364 15:23131797-23131819 GGAACTGTACAGGAACACGTAGG - Exonic
1123747532 15:23329279-23329301 GGAACTGTACAGGAACACGTAGG - Intergenic
1123762327 15:23442445-23442467 GGAACTGTACAGGAACACGTAGG - Exonic
1124078404 15:26468664-26468686 GAAAATGTACATGTACACCATGG + Intergenic
1124279893 15:28353131-28353153 GGAACTGTACAGGAACACGTAGG - Intergenic
1124302805 15:28558473-28558495 GGAACTGTACAGGAACACGTAGG + Intergenic
1124531906 15:30516123-30516145 GGAACTGTACAGGAACACGTAGG + Intergenic
1124561118 15:30774267-30774289 CAAACTGCACAGAAACACATGGG - Intergenic
1124669412 15:31624792-31624814 CAAACTGCACAGAAACACATGGG + Intronic
1124698949 15:31894386-31894408 GAATATGTGCATAAAAACCTTGG + Intergenic
1124766747 15:32491522-32491544 GGAACTGTACAGGAACACGTAGG - Intergenic
1125972221 15:43921154-43921176 GAAATTGCTCAGAAACAACTGGG + Intronic
1126982437 15:54259283-54259305 GAAAATGTACTAATACACTTGGG - Intronic
1127154876 15:56113282-56113304 GAAAATGTACATATACACCATGG + Intronic
1127174059 15:56335279-56335301 GAAAATGTACATATACACAATGG + Intronic
1127224496 15:56916171-56916193 GAAAATGAACTAAAACACATGGG + Intronic
1127547210 15:60002910-60002932 GAGAATGTGCAGAAACCCGTGGG + Intergenic
1128789763 15:70424335-70424357 GAAAAGGTACAGTAACAATTTGG - Intergenic
1129593976 15:76944739-76944761 GAAAATGTACATATACACAATGG - Intronic
1129891393 15:79074227-79074249 GAGCATGTACGGAATCACCTAGG - Intronic
1130415720 15:83692990-83693012 GACAAAGTCCAGAAACACGTCGG - Intronic
1130439432 15:83937290-83937312 AAAAATGTACATATACACCATGG + Intronic
1130768490 15:86899168-86899190 GAAAATGTACATATACACCATGG + Intronic
1131556672 15:93405383-93405405 GAAAATGGACTAATACACCTGGG + Intergenic
1131591351 15:93752421-93752443 GAAAATGTACATTTACACCATGG + Intergenic
1132413111 15:101600391-101600413 CAAACTCTACAGAAAAACCTTGG - Intergenic
1134768459 16:16783043-16783065 GAAAATGGACTAATACACCTGGG + Intergenic
1135219131 16:20598263-20598285 GAAAATGTACATATACACAATGG + Intergenic
1135837947 16:25844831-25844853 GAAAATGTACATATACACCAGGG + Intronic
1137002732 16:35244868-35244890 GAAAATATACAAATATACCTTGG - Intergenic
1137012265 16:35334236-35334258 GAAAATATACAGATATACCTTGG - Intergenic
1137016629 16:35383017-35383039 GAAAATATACAGATATACCTTGG - Intergenic
1137019013 16:35404678-35404700 GAAAATATACAGATATATCTTGG - Intergenic
1138812024 16:60162284-60162306 TAAAATGTACACTAAGACCTTGG - Intergenic
1139562559 16:67752884-67752906 GAAAATGTAAATAAACAAATAGG + Intronic
1139679388 16:68549323-68549345 GAGAGTGTCCAGAATCACCTGGG - Intronic
1140125529 16:72114891-72114913 GGAAATGTACATACACACCATGG - Intronic
1140151958 16:72376490-72376512 GGAGATGTACAGAACCACATAGG + Intergenic
1140655796 16:77138001-77138023 GAAAATGTACATATACACCATGG - Intergenic
1140953557 16:79841688-79841710 GAAACTGTATATAAACAACTTGG + Intergenic
1143599654 17:7936160-7936182 GAAAAGGTACAGAAACATGTTGG + Intronic
1143601688 17:7950740-7950762 GAAAATGTACATATACACCATGG + Intergenic
1143893132 17:10117492-10117514 GAACATTTAAAGAAACACCACGG + Intronic
1145212273 17:21022959-21022981 GAAAATGTACATATATACCATGG + Intronic
1148775240 17:50091550-50091572 GAAAATTAACAGAAGGACCTAGG - Intergenic
1148882357 17:50739362-50739384 GAAAATATAGAGAAAAAACTAGG + Intronic
1149720631 17:58840576-58840598 GAAAATGTACAGAACCAGCCTGG + Intronic
1149726811 17:58903342-58903364 AAAAATGTTCAGCAACACCAGGG - Intronic
1151096501 17:71504960-71504982 GAAAATTGACAGAAACTCCATGG + Intergenic
1151280545 17:73070942-73070964 GAAAATGAACTAATACACCTAGG + Intronic
1152787793 17:82259478-82259500 GGAAATCTACATAACCACCTTGG + Intronic
1153595762 18:6723860-6723882 TAAAATGTAAAGAAACAAGTAGG - Intergenic
1154237080 18:12616256-12616278 GAAAATGAAAAGAAAGCCCTGGG + Intronic
1154257725 18:12798616-12798638 GAAAATGTACATATACAGCATGG - Intronic
1154431605 18:14312980-14313002 GAGTATGTACGGGAACACCTGGG + Intergenic
1154434294 18:14332282-14332304 GAGTATGTACGGGAACACCTGGG + Intergenic
1155662375 18:28264773-28264795 GAAAATGTACATATACACCATGG - Intergenic
1157755830 18:50216992-50217014 GAAAAAGTACAAAACTACCTTGG - Intergenic
1158543658 18:58378350-58378372 TAAAAGGTAGAGAAACACTTGGG + Intronic
1158842564 18:61403864-61403886 GAAAATGTACATATACACCATGG + Intronic
1158902189 18:61974313-61974335 GATAATGCACAGAGATACCTGGG + Intergenic
1159304821 18:66627015-66627037 GAAAATGTACACATACACTGTGG + Intergenic
1159555510 18:69941134-69941156 GAAAATGTACAGAAACACCTGGG + Intronic
1159863239 18:73673972-73673994 GAAAATGTACAGAATGAGCCTGG - Intergenic
1160041960 18:75353528-75353550 GAGAATGTAATAAAACACCTGGG + Intergenic
1161729873 19:5952744-5952766 GAGAATGTACACAAATTCCTAGG + Intronic
1162593213 19:11606719-11606741 GAAGATGTACAAAAACGCCTGGG - Intronic
1164449585 19:28349208-28349230 AACATTGTGCAGAAACACCTTGG + Intergenic
925325264 2:3014686-3014708 GAAAATGAACAAAGACACTTTGG + Intergenic
926186569 2:10695479-10695501 GAGAATGGACTGAGACACCTGGG + Intergenic
927253208 2:21017073-21017095 GAAAAGGTAGAGAAACTCCAAGG + Intronic
927333488 2:21893122-21893144 GGAAATGTACACATACACCATGG - Intergenic
927454020 2:23233798-23233820 GGCAATGCACAGGAACACCTTGG + Intergenic
927567929 2:24130171-24130193 GAAAATGTACATATACACCATGG - Intronic
929260192 2:39858528-39858550 GAAAATTTACAGAAACTCATTGG - Intergenic
929278468 2:40051152-40051174 GAAAATGTCATGAAACACATAGG - Intergenic
930227581 2:48809984-48810006 AAAAATGTACAGAAATAGATGGG - Intergenic
930458063 2:51631995-51632017 GAAAATGTACTGAAGCATGTTGG + Intergenic
930491746 2:52082525-52082547 GAAAATGTATGGGAAAACCTGGG + Intergenic
930846970 2:55916933-55916955 GAAAATAAACAGAAAACCCTAGG + Intronic
931904411 2:66826807-66826829 GATAATGCACAGAAACAGCATGG + Intergenic
932103132 2:68919175-68919197 GAAAAGGCACAGAAACATCCAGG + Intergenic
932121884 2:69108825-69108847 GAAAATGTATATATACACCGTGG - Intronic
932789709 2:74644195-74644217 GATAATTTTCAGAAACACTTTGG + Intronic
932857451 2:75251367-75251389 TAAAATGGTCAGAAACACTTGGG - Intergenic
933102834 2:78282177-78282199 GAAGATGTACGGAAATGCCTGGG + Intergenic
933566503 2:83957061-83957083 GAAAAGGCACAGAAACCCCAGGG + Intergenic
933695576 2:85214849-85214871 GACTGTGAACAGAAACACCTTGG + Intronic
933763199 2:85688761-85688783 GTAAATGTAAACAAATACCTGGG + Intronic
933874517 2:86605430-86605452 GAAACTGTAAATAAACAGCTAGG + Intronic
933904881 2:86882084-86882106 GAAAATGTATATATACACCATGG + Intergenic
934491803 2:94766210-94766232 GAGTATGTACAGAAAAACCTGGG - Intergenic
934492823 2:94773353-94773375 GAGTATTTACAGAAAAACCTCGG - Intergenic
935026391 2:99281378-99281400 TGAAATGTAAATAAACACCTAGG - Intronic
935832005 2:107010363-107010385 GGAAATCTACAAAAACACCCAGG + Intergenic
935851797 2:107229721-107229743 GAAAATGTATATATACACCATGG - Intergenic
936367347 2:111870078-111870100 GAAAATGTATATATACACCATGG - Intronic
936482831 2:112900984-112901006 GAAAATGTACAAAAACCCCTAGG - Intergenic
936788780 2:116125541-116125563 GAGGATGTATGGAAACACCTGGG - Intergenic
937448453 2:121978651-121978673 GAAAATGGACTAATACACCTGGG - Intergenic
937731376 2:125234796-125234818 GAAAATGTACATACACGCCATGG - Intergenic
939823634 2:146987239-146987261 AAAAATATACAGAACAACCTGGG + Intergenic
939998424 2:148942418-148942440 GAATATGTACTCAAAAACCTAGG + Intronic
940675152 2:156718255-156718277 GAAAATGTACATATACACCATGG + Intergenic
940752838 2:157646545-157646567 GAAAAAGAAAAGAAAAACCTTGG + Intergenic
941847336 2:170146601-170146623 GAAAAAGTACAGAAACCCTAAGG + Intergenic
943153702 2:184146970-184146992 AAAAATGTATATAAACACTTTGG - Intergenic
943200874 2:184822192-184822214 GAAAATGTACATATACACCATGG + Intronic
944359845 2:198840860-198840882 AAAAATGTTCAGAGACAACTTGG + Intergenic
944411897 2:199454339-199454361 GAAAAAGTTCTGAAACTCCTTGG - Intronic
945027493 2:205632908-205632930 GAAAATGAAGACAGACACCTTGG - Intergenic
945479647 2:210330003-210330025 GAAAATGTACATACACACCATGG - Intergenic
945621052 2:212137535-212137557 GAAAATGTACATATACACCATGG - Intronic
946974632 2:225134465-225134487 GTAAAGGTACAGAAAAATCTGGG + Intergenic
947488720 2:230575701-230575723 GGAAAAGTACAGAGACACCTGGG - Intergenic
1169644899 20:7799211-7799233 GAAAATCTACAAACTCACCTTGG + Intergenic
1169743157 20:8917125-8917147 AAAATTGTACACAAACCCCTGGG - Intronic
1170424492 20:16225265-16225287 GAGTATGTACAGAAATAACTTGG + Intergenic
1172402486 20:34661577-34661599 GAAAATGTACATATACACCATGG - Intronic
1173968608 20:47132927-47132949 TAAGATGTAAAGAAACACTTGGG + Intronic
1174968760 20:55249913-55249935 GAAAAAGTACTGCAACATCTAGG + Intergenic
1175587651 20:60157617-60157639 GAAAATGTACATATACACCATGG + Intergenic
1176845427 21:13872783-13872805 GAGTATATACAGAAAAACCTGGG - Intergenic
1177751549 21:25291077-25291099 GTAAATGTAGAAAAACATCTAGG - Intergenic
1178600882 21:33993371-33993393 GACAAGGTACAGAAAGATCTAGG + Intergenic
1180105368 21:45614988-45615010 GAAAGTGAACAGACACACCACGG + Intergenic
1182758784 22:32704425-32704447 GAAAATGTACATATACACCATGG - Intronic
949342280 3:3042950-3042972 GAAGATAAACAGAAAGACCTTGG - Intronic
949386861 3:3512524-3512546 GAAAATGTACATATACACCATGG + Intergenic
950074188 3:10175592-10175614 GAAAAGGTACAAAATCAGCTGGG + Intronic
951096502 3:18638055-18638077 GAAAATGTACATATACACAATGG + Intergenic
951269863 3:20610861-20610883 GAAAATGTACCTATACACCATGG + Intergenic
951380242 3:21975193-21975215 GAAAATGTACATATACACAATGG + Intronic
952362120 3:32641286-32641308 GAAGATGGACACAAACTCCTTGG + Intergenic
952737526 3:36705218-36705240 GAAAATAAACAGAAGCACCATGG - Intergenic
952809943 3:37392750-37392772 CACAATGTACAGACACATCTTGG + Intronic
953276602 3:41506963-41506985 GAAATTTTACAGAAACTCATGGG - Intronic
955720529 3:61875706-61875728 TAAAAGGAACAGAAAGACCTCGG - Intronic
957380415 3:79421004-79421026 CAAAATGTACATATACACCATGG + Intronic
957953151 3:87150134-87150156 GAAGATGTAGGGAAACACCTAGG - Intergenic
957977637 3:87467976-87467998 TAAATTGTACAAAAACACTTAGG + Intergenic
958735951 3:98009918-98009940 GGAAATGAACTGAAACACCTCGG - Intronic
958776541 3:98490001-98490023 GAAAATCCACACAAACACGTAGG + Intergenic
958866682 3:99508948-99508970 GCAAAAGTACAGAACCACCAAGG - Intergenic
959245330 3:103861136-103861158 GAAAATGTATATATACACCATGG - Intergenic
959356212 3:105332426-105332448 GAAAATATAGAGAAAGAGCTTGG + Intergenic
959469891 3:106737359-106737381 GAACATGTACATGAACAACTTGG - Intergenic
959496049 3:107053120-107053142 GGAAATCTACAGAGACAGCTTGG - Intergenic
959788814 3:110332628-110332650 GAGGATGTATGGAAACACCTTGG - Intergenic
959977223 3:112474179-112474201 GAAAATGTCCAAAATCACTTCGG + Intronic
960022203 3:112967366-112967388 GAAGATGAACAGAAACAGCGAGG - Intronic
960033797 3:113082900-113082922 GAAAATGTACATATACACTATGG + Intergenic
960242955 3:115366857-115366879 GAAAATGTATATATACACCATGG + Intergenic
960453069 3:117834376-117834398 CAAAATATTGAGAAACACCTAGG - Intergenic
960791977 3:121442651-121442673 GAAAATGTACAGGTACACAATGG - Intronic
961106093 3:124242829-124242851 AAAACTGAACACAAACACCTGGG - Intronic
961334626 3:126164581-126164603 TAAAATGTACATATACACCATGG - Intronic
962221777 3:133570521-133570543 GAAGATGTGCAGAAATACCTGGG + Intergenic
962531588 3:136286102-136286124 GTAAATGGACAGAAAGACCAAGG + Intronic
963261720 3:143198820-143198842 CAAAATGTATTGAAACACTTTGG - Intergenic
963858676 3:150283666-150283688 GAAAATGTACATATACACAATGG + Intergenic
963989770 3:151639736-151639758 GTAAATGATCAGAAACACCAAGG - Intergenic
964031204 3:152140973-152140995 GTAAATGTAAAGAAAGACCAGGG + Intergenic
964208981 3:154207876-154207898 GAAAATGTACATATACACCATGG + Intronic
965407131 3:168284277-168284299 GAAACTGTACATATACACATAGG - Intergenic
965521963 3:169677285-169677307 GCAAATGTACCAAAAAACCTAGG - Intergenic
965885406 3:173439542-173439564 AAAAAAGTACAGGAACACCTTGG + Intronic
966325248 3:178746173-178746195 GAAGATGTATGGAAACACCTGGG - Intronic
966517763 3:180837974-180837996 GAAAATGTACATATACACCATGG + Intronic
967777014 3:193395297-193395319 GAGGATGTATGGAAACACCTGGG - Intergenic
967866002 3:194190362-194190384 GAAAATGTACATATACACCATGG - Intergenic
970044362 4:11833743-11833765 GAAAATGTACATATATACCATGG - Intergenic
970163959 4:13216568-13216590 GAAAACTTACACAAACATCTTGG + Intergenic
970269112 4:14324294-14324316 AAAAATGAACTGAAACACTTTGG + Intergenic
970801327 4:19976461-19976483 GAAAATGTATGGAAATGCCTGGG - Intergenic
970992467 4:22228684-22228706 TAAAATGTACAAATAAACCTTGG + Intergenic
971729350 4:30357198-30357220 GAAAATGTACATATACACCATGG - Intergenic
971901855 4:32670251-32670273 GAAAATGGACCGATATACCTAGG + Intergenic
972101311 4:35421676-35421698 CAAAATATACAGAAACACACAGG - Intergenic
972792560 4:42387112-42387134 GAAAATGTACTAATACACCATGG - Intergenic
973065678 4:45788679-45788701 GAATATTTACAGAAAAACATTGG + Intergenic
973349186 4:49091010-49091032 GAATATGCACAGAAACATTTGGG + Intergenic
973393497 4:49575589-49575611 GAGTATGTACGGAAAAACCTGGG + Intergenic
974172254 4:58281594-58281616 GAGAATGTATGGAAACACCTGGG + Intergenic
974848244 4:67377375-67377397 GAAAATATGCAAAAACAACTAGG + Intergenic
975253810 4:72211984-72212006 GAAAATGGACCAATACACCTGGG - Intergenic
975739031 4:77410410-77410432 GAAAAGGTACTTAAACCCCTAGG - Intronic
977801181 4:101234104-101234126 GAAAATGTACATATACGCCATGG - Intronic
979158089 4:117423531-117423553 GAAAATGTACATATACACAATGG - Intergenic
979506543 4:121503477-121503499 GAAAATGTATATATACACCATGG - Intergenic
980519493 4:133911925-133911947 GAAAATGTACATATAAACCATGG + Intergenic
980751868 4:137100891-137100913 GAAAATGTACATATACATCAAGG + Intergenic
981467539 4:145091558-145091580 GAAAATGTACATATACACTATGG - Intronic
981843296 4:149137078-149137100 CAAAATGTACAGCAAAACCTTGG - Intergenic
982195204 4:152904755-152904777 GAAAATGTACATATACACCATGG - Intronic
982632735 4:157852773-157852795 GAAAATGTACATATACACCATGG - Intergenic
982974183 4:162032458-162032480 GAAAATGCACAGAAATAGTTTGG + Intronic
983450416 4:167903401-167903423 GAGAATGAACACAAACACATAGG - Intergenic
985080948 4:186263298-186263320 TAAAATGTACAAAATCAGCTTGG + Intergenic
985140699 4:186837653-186837675 GAAAATGCACATATACACCATGG - Intergenic
985236029 4:187875358-187875380 GAAAATGTACATATATACCATGG - Intergenic
985474119 5:68601-68623 GAGGATGTATGGAAACACCTGGG + Intergenic
986060619 5:4186939-4186961 GAAAATGGACAAATACACCATGG - Intergenic
986296280 5:6441338-6441360 GAAAATGTACATATACACCAAGG - Intergenic
986945393 5:13012287-13012309 GAAACTGTACAGATACACCATGG - Intergenic
987490515 5:18575280-18575302 GAAAATGTACATATACACCATGG + Intergenic
988514630 5:31893836-31893858 GAAGTTGTACAGAAATTCCTGGG + Intronic
988950187 5:36248599-36248621 GAACATTTTCAGAAACATCTTGG + Intronic
989244637 5:39240950-39240972 GAAAATGTACATATACACCATGG + Intronic
989297518 5:39847285-39847307 GAAAATATACATATACACCACGG - Intergenic
989610353 5:43284901-43284923 GAAAATGTATATAAACACAATGG - Intergenic
989651453 5:43695648-43695670 GAAAATGGACTAATACACCTTGG - Intronic
989693932 5:44177015-44177037 GAAAATGTATATATACACCATGG - Intergenic
989989327 5:50742620-50742642 GAAAATTTGCAAAAACAACTAGG + Intronic
990215381 5:53526020-53526042 GAAAATGTACATGTACACCATGG - Intergenic
990228922 5:53689390-53689412 GAAAATGTACGTATACACCCTGG + Intergenic
990479296 5:56192704-56192726 GATAATGGACAGAATCATCTAGG + Intronic
990544584 5:56810003-56810025 GAAAATGTACAGTAAAAACATGG + Intergenic
991228243 5:64298224-64298246 GAAAATGTACATTTACACCATGG - Intronic
991229398 5:64313514-64313536 GGAAATGTACACATACACCATGG - Intronic
991327988 5:65459172-65459194 GAAAATGTAGAGAAACAGGCCGG - Intronic
992229354 5:74648631-74648653 GAAAGTGAACAGGAACACCTAGG + Intronic
993161796 5:84300972-84300994 AAAATTGTACAGAATCAGCTGGG + Intronic
993221390 5:85101931-85101953 GAAAATGTACATATACACCATGG + Intergenic
993484324 5:88463686-88463708 GAAAATGTATATATACACCATGG - Intergenic
993853661 5:93043746-93043768 GAAAATGTACATTACCACTTGGG - Intergenic
994351184 5:98748407-98748429 GAAAATGTACATATACACCATGG + Intergenic
994472559 5:100226767-100226789 AAAAATGTACATATACACCATGG - Intergenic
995312688 5:110731480-110731502 GAAGATGTATGGAAACACCTGGG - Intronic
995372602 5:111436031-111436053 AAAAATGAACAGAAAAAGCTAGG - Intronic
995431082 5:112078310-112078332 GAAAATGTACACATACATCATGG - Intergenic
996060964 5:119032925-119032947 GACAATGAACAGAAACACAGAGG + Intergenic
996845731 5:127896739-127896761 GAAAATGAAAAGAATCAGCTGGG - Intergenic
997082860 5:130761397-130761419 AAAAATGGACAGTAACACATTGG + Intergenic
997750823 5:136344058-136344080 GAAAATGTACATAAATACCATGG + Intronic
997785993 5:136714512-136714534 GAAAATGTACATATACACCATGG - Intergenic
1000445640 5:161315434-161315456 GAAAATGAAAAAAGACACCTAGG - Intronic
1000488258 5:161876265-161876287 GAAAATATTCAGAAACACCTTGG + Intronic
1000777869 5:165442148-165442170 GAGGATGTATGGAAACACCTGGG - Intergenic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1003037454 6:2656483-2656505 GTAATAGTACAGAGACACCTAGG - Intergenic
1004410381 6:15376232-15376254 TAAAAAATACAGAGACACCTCGG + Intronic
1004624331 6:17360630-17360652 GAAAATGTACATATACATCACGG + Intergenic
1004727325 6:18323816-18323838 TAAAATGCACAGAACCACCAAGG - Intergenic
1005909704 6:30297745-30297767 GAAAATGTACATATACACCGTGG - Intergenic
1006261343 6:32874151-32874173 GAAAATGTACATATGCACCATGG - Intergenic
1007185921 6:39972291-39972313 GAAGTTGTATGGAAACACCTGGG + Intergenic
1007362076 6:41365915-41365937 GAAAATGTACATATACACAATGG - Intergenic
1007911234 6:45516560-45516582 GATAATGTATAAAATCACCTGGG - Intronic
1008596980 6:53052260-53052282 GAAAATGTACATATACACCATGG - Intronic
1008811142 6:55500905-55500927 GAACATGTAAATAAATACCTTGG - Intronic
1009492533 6:64310362-64310384 GAAAATGTACATAGACACAATGG + Intronic
1009528085 6:64773339-64773361 GAAAATGTACATATATACCATGG - Intronic
1009757324 6:67956499-67956521 GAGGATGTATGGAAACACCTGGG + Intergenic
1010103534 6:72140404-72140426 CTAAATGTACTGAAATACCTTGG - Intronic
1010477331 6:76304095-76304117 GAAAATGTACATATACACCATGG - Intergenic
1010986574 6:82432129-82432151 GAAAATGTACATAAACTGATTGG - Intergenic
1011301547 6:85879365-85879387 TAAAATGTATAGAAGCACATTGG - Intergenic
1011396249 6:86911926-86911948 GAAAATGTACATACACACCATGG + Intergenic
1011900392 6:92287519-92287541 GAAAATGTACATATACACGATGG - Intergenic
1012110636 6:95227069-95227091 GCAAATTAACAGAATCACCTAGG - Intergenic
1012241041 6:96872317-96872339 GAGAATCTACTCAAACACCTTGG - Intergenic
1012342383 6:98143097-98143119 GAGGATGTACGGAAACACTTTGG - Intergenic
1012765437 6:103361855-103361877 AAAAATGTAATGAAATACCTAGG + Intergenic
1012832635 6:104224929-104224951 GAAAATGTAAAGAATTGCCTAGG + Intergenic
1014821586 6:125994735-125994757 GAAAATGTACATATACACCATGG + Intronic
1014863235 6:126496584-126496606 GAAGATGTATGGAAACACCTGGG - Intergenic
1014866201 6:126533326-126533348 GAAAATTTACAGAAACATGTAGG - Intergenic
1015160679 6:130149494-130149516 GAAAATGTACATGTACACCATGG + Intronic
1015462349 6:133505907-133505929 CCAAATGCACAGACACACCTGGG - Intronic
1015756035 6:136607810-136607832 GAAAACATATAGAAATACCTGGG + Intronic
1016249949 6:142028758-142028780 GAAAATGTATATATACACCATGG - Intergenic
1016601978 6:145872816-145872838 GAAAATGTACATATACAACATGG + Intronic
1018691381 6:166346747-166346769 TAAAATGTACAGAAAACTCTAGG + Intergenic
1019052832 6:169196763-169196785 GAAAATGTGCACACACACCATGG + Intergenic
1019052835 6:169196800-169196822 GAAAATGTGCACACACACCATGG + Intergenic
1019052849 6:169196996-169197018 GAAAATGTGCACACACACCATGG + Intergenic
1019052852 6:169197033-169197055 GAAAATGTGCACACACACCATGG + Intergenic
1019052860 6:169197185-169197207 GAAAATGTGCACACACACCATGG + Intergenic
1019052862 6:169197222-169197244 GAAAATGTGCACACACACCATGG + Intergenic
1019052864 6:169197259-169197281 GAAAATGTGCACACACACCATGG + Intergenic
1019052872 6:169197375-169197397 GAAAATGTGCACACACACCATGG + Intergenic
1019052886 6:169197572-169197594 GAAAATGTGCACACACACCATGG + Intergenic
1019052889 6:169197609-169197631 GAAAATGTGCACACACACCATGG + Intergenic
1019052897 6:169197761-169197783 GAAAATGTGCACACACACCATGG + Intergenic
1019052903 6:169197838-169197860 GAAAATGTGCACACACACCATGG + Intergenic
1019052911 6:169197955-169197977 GAAAATGTGCACACACACCATGG + Intergenic
1019052913 6:169197992-169198014 GAAAATGTGCACACACACCATGG + Intergenic
1019052917 6:169198068-169198090 GAAAATGTGCACACACACCATGG + Intergenic
1019052924 6:169198178-169198200 GAAAATGTGCACACACACCATGG + Intergenic
1019191072 6:170251302-170251324 GAAAATCTCCAGAAATACTTGGG - Intergenic
1020515839 7:9117939-9117961 GAAAATGGAAAGAGACACATGGG - Intergenic
1020528317 7:9294406-9294428 GAAAATGCACATAAAGCCCTTGG - Intergenic
1020597902 7:10232986-10233008 GTAAATGTACAGAAGCAAATCGG - Intergenic
1020716907 7:11685997-11686019 GAAAATGTACATATACACCATGG + Intronic
1020808738 7:12825079-12825101 GAAAATGTACATATACACCATGG + Intergenic
1022313502 7:29220352-29220374 GAAAATTAACAAAAACAACTGGG + Intronic
1022971744 7:35524499-35524521 GAAAATGTACAGTAAAAACAGGG + Intergenic
1022984865 7:35642588-35642610 GAAAAAGTACATATACACCATGG + Intronic
1023747679 7:43336906-43336928 GAAAATGTATATATACACCATGG - Intronic
1024912164 7:54458212-54458234 GAGGATGTAGAGAAACACCTGGG + Intergenic
1025784256 7:64630084-64630106 GAAAATGTACATATACACCATGG + Intergenic
1026295107 7:69044775-69044797 GAAAATGGACTAATACACCTGGG - Intergenic
1026507935 7:71002572-71002594 TAAAAATTACAGAATCACCTTGG - Intergenic
1027544351 7:79507687-79507709 GGAAATGCACAGTTACACCTTGG + Intergenic
1027984333 7:85267057-85267079 GAAAATGTACAAAGAAACATTGG + Intergenic
1028099084 7:86798044-86798066 GAGGATGTATGGAAACACCTGGG + Intronic
1029162580 7:98563216-98563238 GAAAATGCACAGAACAGCCTGGG - Intergenic
1030332836 7:108291013-108291035 GAAAATGAACAAAACCACTTGGG + Intronic
1030401511 7:109057439-109057461 GAAAATGTATATATACACCATGG - Intergenic
1030422212 7:109321723-109321745 TAAAATGTACAGACACCTCTTGG + Intergenic
1031258239 7:119483586-119483608 GAAAATGTATATATACACCATGG - Intergenic
1031441279 7:121797579-121797601 GAAAATGTAGAGAAAACCTTGGG + Intergenic
1031473168 7:122191457-122191479 GAGGATGTACAGAAATGCCTGGG + Intergenic
1032726462 7:134593922-134593944 GAATATGTACAGAAACAAACAGG - Intergenic
1032801329 7:135319385-135319407 TAAAATGTATAAAACCACCTTGG + Intergenic
1032937665 7:136752072-136752094 CAAAATTTATTGAAACACCTGGG + Intergenic
1033471503 7:141653638-141653660 GACAACTTACAGAATCACCTGGG - Exonic
1033983939 7:147199756-147199778 GAGGATATACAGAAACATCTAGG + Intronic
1034381473 7:150698399-150698421 GAAAATGTACATATACACTATGG + Intergenic
1035135424 7:156698478-156698500 GAAGATGTATGGAAACACCTGGG - Intronic
1035764672 8:2096468-2096490 AAAAATGTAAAGAACCACCCAGG - Intronic
1035833044 8:2718766-2718788 GAAAACATAAAGAAACAACTTGG - Intergenic
1036103607 8:5815290-5815312 GAAAATGTACATATATACCATGG + Intergenic
1036189767 8:6659594-6659616 GGTAATGTACAGAAACAACTGGG + Intergenic
1038304824 8:26389986-26390008 GAAAATGTACCCAAGCAGCTTGG - Intronic
1039249581 8:35647850-35647872 AAAAATGTAGAGGAACACCCAGG - Intronic
1039332211 8:36550433-36550455 TACGATGTACAGAAAAACCTAGG - Intergenic
1039956268 8:42209355-42209377 GAAAATGCACATATACACCGAGG + Intergenic
1039984022 8:42432970-42432992 CACCATGTACAGGAACACCTGGG - Intronic
1040449891 8:47534411-47534433 GAAAATGTACATATACACCATGG + Intronic
1041172417 8:55157884-55157906 GAAAATGTACATAGACACCATGG - Intronic
1041499401 8:58523577-58523599 GAAAATGGACAGTAACTTCTGGG - Intergenic
1041610801 8:59845839-59845861 GAAAATGTACCTATACACCATGG + Intergenic
1042438134 8:68791920-68791942 AAAAATGTAAAGATACACATAGG + Intronic
1042523939 8:69744614-69744636 GAAGATGTACAGATACCCCAAGG - Intronic
1043087732 8:75856346-75856368 GAAAATGTGAAGAAACACCGAGG + Intergenic
1043945441 8:86246168-86246190 GAAAATGTACATATACACAAGGG - Intronic
1044052704 8:87528024-87528046 GAGGATGGGCAGAAACACCTGGG + Intronic
1044749720 8:95404492-95404514 AAAAATTCAAAGAAACACCTTGG + Intergenic
1046202457 8:110945170-110945192 GAAAATGTATATATACACCATGG - Intergenic
1046681827 8:117179027-117179049 GGAAATATAGAGAAACACATGGG + Intergenic
1046838709 8:118832257-118832279 GAAAATGTACATATACACCATGG + Intergenic
1046886157 8:119369510-119369532 GAAAATGTACATATACACCATGG + Intergenic
1047342527 8:123996194-123996216 GAAAATCAACAGAAAAACATTGG - Intronic
1047404133 8:124570966-124570988 GAAAATATGCTGAAACACCCAGG - Intronic
1047519136 8:125580947-125580969 AAAAATGGACAAATACACCTTGG - Intergenic
1048417721 8:134245011-134245033 GAAAATGTACATATACACCATGG - Intergenic
1048761410 8:137799475-137799497 GAAAATGTACATATACACCACGG - Intergenic
1048907284 8:139100428-139100450 GAAAAGATACAGAAACAGCATGG - Intergenic
1049737210 8:144215328-144215350 GGAAATGTACAGAAACACCGTGG + Intronic
1049962394 9:749198-749220 GGCTATGTTCAGAAACACCTGGG - Intergenic
1050036810 9:1445026-1445048 AGAAATGGAAAGAAACACCTGGG - Intergenic
1050045708 9:1542675-1542697 GAAAATGTACATATACATCATGG - Intergenic
1050252659 9:3761452-3761474 GAAAATATACAGCACCTCCTAGG + Intergenic
1050552981 9:6763588-6763610 GAAAATGCACATAAACACAAAGG - Intronic
1051116980 9:13706945-13706967 GAAAATGAACACAATCACCCAGG - Intergenic
1051193795 9:14541725-14541747 AAAAATGTACAGAAATAACGGGG + Intergenic
1051509333 9:17860113-17860135 TAGAATGTAAAGAAACAACTTGG - Intergenic
1051852461 9:21525544-21525566 GAAAATGTACATATACACCATGG - Intergenic
1052089296 9:24307783-24307805 GAAAATGTACATAAACTCAATGG + Intergenic
1052636771 9:31116561-31116583 GAAAATGTACAAATACATCATGG - Intergenic
1052636815 9:31117059-31117081 GAAAATGTACATATACACCATGG - Intergenic
1052694714 9:31862686-31862708 GAAAATGTATATAAACACAATGG - Intergenic
1052768934 9:32669856-32669878 GAAAATGTACATACACACCATGG + Intergenic
1052877781 9:33580368-33580390 GAGGATGTACAGAAAAGCCTGGG + Intergenic
1052879533 9:33592759-33592781 GAGCATGTACAGAAAAACCTGGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053496447 9:38551473-38551495 GAGCATGTACAGAAAAACCTGGG - Intronic
1053498204 9:38563837-38563859 GAGGATGTACAGAAAAGCCTGGG - Intronic
1053558417 9:39162598-39162620 GAAAATGTACATATATACCATGG + Intronic
1053663931 9:40304328-40304350 GAGGATTTACAGAAAAACCTGGG + Intronic
1053665333 9:40313636-40313658 GAGTATGTACGGAAAAACCTGGG + Intronic
1053822532 9:41982823-41982845 GAAAATGTACATATATACCATGG + Intronic
1053914472 9:42935584-42935606 GAGGATTTACAGAAAAACCTGGG + Intergenic
1053914919 9:42938683-42938705 GAGTATGTACGGAAAAACCTGGG + Intergenic
1054138697 9:61456344-61456366 GAAAATGTACATATATACCATGG - Intergenic
1054376057 9:64450562-64450584 GAGGATTTACAGAAAAACCTGGG + Intergenic
1054376484 9:64453666-64453688 GAGTATGTACGGAAAAACCTGGG + Intergenic
1054519282 9:66062648-66062670 GAGTATGTACGGAAAAACCTGGG - Intergenic
1054520683 9:66071957-66071979 GAGGATTTACAGAAAAACCTGGG - Intergenic
1054608044 9:67204543-67204565 GAAAATGTACATATATACCATGG - Intergenic
1055387619 9:75780282-75780304 GAAAATGTACATATACACAATGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056927579 9:90847918-90847940 GAAAGTGTGAGGAAACACCTTGG + Intronic
1057161380 9:92890714-92890736 GAGGATGTACAGAAAAGCCTGGG - Intergenic
1057492845 9:95535733-95535755 GAAAATGTAAATAAAAACCACGG + Intergenic
1057644700 9:96862040-96862062 GAAAATGTACATATACACAATGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057676366 9:97139013-97139035 GAGCATGTACAGAAAAACCTGGG - Intergenic
1057677670 9:97148333-97148355 GAGGATGTACAGAAAAGCCTGGG - Intergenic
1058289720 9:103224028-103224050 GAAAATGAAAAGTAACACTTAGG + Intergenic
1058516883 9:105785050-105785072 GAAAATGTACATATACACCATGG - Intergenic
1058559496 9:106210002-106210024 GAAAATGTAAAGAAAGACATTGG - Intergenic
1059478664 9:114570702-114570724 GAAAATGTTCAGAAACAAGCAGG + Intergenic
1060111525 9:120910038-120910060 GAACATGCACAGAAACCCCCTGG + Intronic
1060570239 9:124632029-124632051 GAAAATGTACATATACATCATGG - Intronic
1062302979 9:135886194-135886216 GAAAATGTACAAAAATGCCAGGG + Intronic
1203545373 Un_KI270743v1:124220-124242 GAGTATGTACGGAAAAACCTGGG - Intergenic
1185841179 X:3392735-3392757 GAAAATGCACATATACACCATGG + Intergenic
1187193492 X:17058878-17058900 GAAAATGGCCAGAACCACCTAGG + Intronic
1187574766 X:20542520-20542542 GAGGATGTATGGAAACACCTTGG + Intergenic
1187653645 X:21442782-21442804 GAAAATGTATATATACACCATGG + Intronic
1187756407 X:22531961-22531983 GAAAATGTACATATACACTGTGG + Intergenic
1188287263 X:28343012-28343034 GAAAATGTACATATACACAACGG - Intergenic
1188289500 X:28370022-28370044 GAAAATGTACATACACACCACGG - Intergenic
1188295897 X:28447903-28447925 GAAAATGTACATATACACCATGG + Intergenic
1188705254 X:33320336-33320358 GAATATGTACAGGTATACCTTGG + Intronic
1188707008 X:33347121-33347143 GAAAATGTATATATACACCATGG + Intergenic
1189106480 X:38241047-38241069 GAAAACGTAGAGAAGCACATAGG - Intronic
1189132040 X:38509695-38509717 GAAAATGTACATATACACCATGG + Intronic
1189237603 X:39499762-39499784 GAAAATGTACATATACACCATGG - Intergenic
1189842613 X:45096991-45097013 GAAAATGTATATATACACCATGG + Intronic
1190707277 X:53040552-53040574 TAAAAAGTACATAAACACCTTGG + Intergenic
1190967465 X:55314233-55314255 GAAAATGTATAAATACACCATGG - Intergenic
1191189015 X:57645978-57646000 GAAAATGTACATATACACATTGG + Intergenic
1191878688 X:65822726-65822748 GAAAATGTACATATAAACCATGG + Intergenic
1191959188 X:66680810-66680832 AAATATGTACATAAACACCATGG - Intergenic
1192688896 X:73338294-73338316 GAAAATGTACATATACACAATGG + Intergenic
1192742552 X:73907268-73907290 GAAAATGCACATATACACCATGG - Intergenic
1192975568 X:76280498-76280520 GAAAATGTACATATACACAACGG - Intergenic
1193371054 X:80697679-80697701 GAAAATGTACATAGACATCATGG - Intronic
1193378027 X:80784747-80784769 GAAAAGGTACATATACACCATGG - Intronic
1193504740 X:82328489-82328511 GAAAATATACATATACACCATGG + Intergenic
1193638220 X:83979426-83979448 GAAAATGTATATATACACCATGG + Intergenic
1193826491 X:86232971-86232993 GAAAATGTACATATACACCATGG + Intronic
1193920236 X:87415931-87415953 GAAAATGTACATATACATCATGG - Intergenic
1194137664 X:90166628-90166650 GAAAATGTACATATACACGATGG + Intergenic
1194373995 X:93110152-93110174 GAAAATGTATGGAAAAGCCTGGG - Intergenic
1194391293 X:93321096-93321118 GAAAATGTACATATACACAATGG - Intergenic
1194575172 X:95604135-95604157 GAACATGTACATAAACACAATGG + Intergenic
1194671499 X:96739436-96739458 AAAAATGTACAGTAACATGTGGG - Intronic
1195960520 X:110381702-110381724 GAAAATGTACACGTACACCATGG + Intronic
1196286557 X:113888015-113888037 GAAAGTGTACATAAAAACCCTGG - Intergenic
1196357133 X:114808328-114808350 GAAAATGTACACATACACAATGG - Intronic
1196985930 X:121270914-121270936 GAAAATGTACACATACACCGTGG + Intergenic
1197564891 X:128070830-128070852 GAAAATGTAGATATACACCATGG - Intergenic
1197599017 X:128505186-128505208 GAAACTGTTCAGAAAAGCCTGGG - Intergenic
1197893910 X:131290655-131290677 GAAAATGTACATAAAAGGCTGGG - Intronic
1198619955 X:138496279-138496301 GAAAATGTATACAAACACTTTGG - Intergenic
1198906722 X:141570335-141570357 GAGGAGGTACAGAAACACATAGG + Intergenic
1198917017 X:141684007-141684029 GAGGAGGTACAGAAACACATAGG + Intronic
1199049135 X:143215512-143215534 GAAACTATGCAGAACCACCTAGG + Intergenic
1199099146 X:143778745-143778767 GAAAATGTACATATACACAATGG + Intergenic
1199534523 X:148887218-148887240 GTAAATGTACAGCAAGCCCTTGG - Intronic
1199623263 X:149717515-149717537 TAAAATGTATTAAAACACCTGGG - Intergenic
1199869792 X:151888161-151888183 GAGGATGTATGGAAACACCTCGG + Intergenic
1200354013 X:155528692-155528714 GAAAATGTATATATACACCATGG - Intronic
1200483450 Y:3736896-3736918 GAAAATGTACATATACACGATGG + Intergenic
1200682024 Y:6224223-6224245 GAAAATGTATGGAAAAGCCTGGG - Intergenic
1201704609 Y:16922362-16922384 GAAAATGTACATATACACCCTGG - Intergenic