ID: 1159557582

View in Genome Browser
Species Human (GRCh38)
Location 18:69961615-69961637
Sequence GAGTCGTGGGTGAAGTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159557582 Original CRISPR GAGTCGTGGGTGAAGTTTGC TGG (reversed) Intronic
905705085 1:40049966-40049988 GATTCGTGGGTGGAAGTTGCAGG + Intronic
907291940 1:53420606-53420628 GAGTGGTGGGTGAAGGTGGGAGG - Intergenic
920665007 1:207956950-207956972 GAGACGTGGGAGAAGCTTGCTGG - Intergenic
921156674 1:212444419-212444441 GTGTCATGGGTGAGGTCTGCAGG - Exonic
921970054 1:221137834-221137856 GAGTTGTGGGTGTGGTTTGGGGG + Intergenic
922177023 1:223204802-223204824 GAGTGGTGTGTGACATTTGCTGG + Intergenic
1064003326 10:11681489-11681511 GAGCAGTGGGTGAACTTTCCTGG - Intergenic
1067755498 10:49001556-49001578 GAGTCCTGGGAGAAGATTCCAGG + Intergenic
1069583708 10:69582639-69582661 GAGTGGTCGCTTAAGTTTGCAGG - Intergenic
1069773740 10:70915098-70915120 GAGGGGTGGGTGTAATTTGCAGG + Intergenic
1069786903 10:70994306-70994328 GAGTTCTGGGTGAAGTTTCTGGG + Intergenic
1070849362 10:79551175-79551197 GAGGCCTGGGTGAGGTTTGCAGG + Intergenic
1081716989 11:45257479-45257501 GAGTAGTGGGTGCAGATGGCTGG + Intronic
1086486963 11:87315780-87315802 GACTCATGGGTCAACTTTGCAGG - Intronic
1086923326 11:92612719-92612741 AAGTGCTGTGTGAAGTTTGCAGG + Intronic
1093801222 12:23375644-23375666 GAGTTGTGGGGTAAGTTTGTGGG - Intergenic
1096144512 12:49268738-49268760 GAGTCATGGCTATAGTTTGCTGG + Intronic
1100857301 12:98768784-98768806 GAGGCGGGGGTGGAGTGTGCGGG - Intronic
1101850004 12:108394224-108394246 GAGTTCTGGGTGAACTTGGCAGG - Intergenic
1104812216 12:131626240-131626262 GGGCCGTGGGTGAAGTTGGGGGG - Intergenic
1107099301 13:36572256-36572278 GACCAGTGGGTCAAGTTTGCTGG + Intergenic
1111699023 13:91662368-91662390 AAGTCACTGGTGAAGTTTGCAGG + Intronic
1121173930 14:91876386-91876408 GATTCCTGGGTGCAGTATGCTGG + Intronic
1121818082 14:96943606-96943628 GAGACGTGGGCGGAGTGTGCAGG + Intergenic
1123487170 15:20751745-20751767 GAGTCGTGGGAGAAGGTGGTAGG - Intergenic
1123543660 15:21320800-21320822 GAGTCGTGGGAGAAGGTGGTAGG - Intergenic
1124155583 15:27222544-27222566 GAGTCATGGGTGCATATTGCAGG + Intronic
1129107602 15:73320310-73320332 GAGAAGTGGGTGAAGGTTCCTGG - Exonic
1129923035 15:79336784-79336806 GTGTAGTGGGTGGAGTTTGCTGG - Intronic
1202951977 15_KI270727v1_random:47926-47948 GAGTCGTGGGAGAAGGTGGTAGG - Intergenic
1134517125 16:14896233-14896255 GAGTCCTGAGTGAAGCTGGCTGG + Intronic
1134704793 16:16294887-16294909 GAGTCCTGAGTGAAGCTGGCTGG + Intergenic
1134962749 16:18417227-18417249 GAGTCCTGAGTGAAGCTGGCTGG - Intergenic
1134967044 16:18499826-18499848 GAGTCCTGAGTGAAGCTGGCTGG - Intronic
1143814345 17:9499770-9499792 GGGGTGTGGGTGGAGTTTGCGGG - Intronic
1146256428 17:31393521-31393543 GAGAAGTGGGTGAGGCTTGCTGG - Intronic
1146376640 17:32298932-32298954 GTGAGGTGGGTGAAGTTAGCTGG + Intronic
1147457347 17:40546034-40546056 GAGAGGTGGGAGATGTTTGCAGG + Intergenic
1154338071 18:13481875-13481897 GAGAGGTGAGTGGAGTTTGCTGG + Intronic
1155087392 18:22471638-22471660 GAGTTGTGGCTGAAGCATGCTGG - Intergenic
1159557582 18:69961615-69961637 GAGTCGTGGGTGAAGTTTGCTGG - Intronic
1168113909 19:54210129-54210151 GAGTCGTGGGTGAAGCTGATAGG + Intronic
926207098 2:10841535-10841557 GTGTAGGGTGTGAAGTTTGCTGG + Intergenic
926218569 2:10920401-10920423 CAGTCGTGGGTGAGGGTTGATGG - Intergenic
927353582 2:22147558-22147580 GATTGCTGGGTGAAGTTTTCTGG + Intergenic
932797805 2:74712587-74712609 GAGGCGTGGATGCAGTTTGCTGG + Intergenic
933080273 2:77976931-77976953 GTGTGGTGGCTGTAGTTTGCTGG - Intergenic
933598883 2:84309448-84309470 GAGTCATGGGTGAGGACTGCTGG + Intergenic
934616318 2:95773398-95773420 GGGTCATGGGTGGAGTTTTCTGG + Intergenic
934644578 2:96051162-96051184 GGGTCATGGGTGGAGTTTTCTGG - Intergenic
934837993 2:97607252-97607274 GGGTCATGGGTGGAGTTTTCTGG - Intergenic
935786826 2:106557129-106557151 GAGGAGGGGGTGAAGTTGGCAGG + Intergenic
938596914 2:132796712-132796734 GAGACGTGAGTGAAGTTTCTAGG + Exonic
939776348 2:146392498-146392520 GGGTCGCGGGTGAAGTTGGGGGG - Intergenic
941079617 2:161045529-161045551 GAGTGGTGGGTGAAGATGGAAGG - Intergenic
945684270 2:212950211-212950233 GAGTTGTGGGTGAAGTTCTATGG - Intergenic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
1169899599 20:10539445-10539467 GAGTGGAGGGTGACATTTGCAGG + Intronic
1172785339 20:37464801-37464823 GTGTCCTGGGTGAACTTTGTGGG - Intergenic
1177646867 21:23909790-23909812 GAGTAGTTGGTGAATTTTTCTGG - Intergenic
1184874372 22:47263957-47263979 GAGGTGTGGCTGAAGTTGGCTGG - Intergenic
957289737 3:78264030-78264052 GAGTTGTTGGTGAAGTCTTCGGG + Intergenic
961641045 3:128365030-128365052 GAGTCCTGGGAGAAGGCTGCAGG - Intronic
965981081 3:174691513-174691535 GAGTCTTGGCTGAAGGTTGATGG + Intronic
969505131 4:7581609-7581631 CTGTCCTGGGTGGAGTTTGCTGG - Intronic
971033773 4:22670154-22670176 GAGTAGTGGGTGCTGTTGGCTGG + Intergenic
979438243 4:120720446-120720468 GAATCGTGGGTGAAATTTAGAGG + Intronic
982996925 4:162360726-162360748 GAAACTTGGGTGAGGTTTGCTGG + Intergenic
986991059 5:13553828-13553850 GAGTCATGGGTGAGTTTTGCAGG + Intergenic
988785693 5:34564048-34564070 GAGTCATGGCTGTAGTTTCCGGG - Intergenic
993114999 5:83709842-83709864 GACTGATGGGTGAGGTTTGCAGG + Intronic
996980907 5:129493169-129493191 GAGTCATCAGTGAAGTTTGAAGG + Intronic
998578368 5:143342939-143342961 CAGTCATGTGTGAAGTTTCCTGG + Intronic
999060114 5:148624719-148624741 GTGTTGTGGGTGAAGTTTCAGGG + Intronic
999759254 5:154687863-154687885 GAGTCCTGGGTGAATCCTGCAGG + Intergenic
1001435945 5:171699399-171699421 TAGTCATGGATGAAGTTTGGTGG + Intergenic
1009624370 6:66120159-66120181 CAGTCCTGGGTGAAGTTTTCTGG - Intergenic
1010987567 6:82442630-82442652 GAGATGTGAGAGAAGTTTGCTGG + Intergenic
1013122323 6:107151717-107151739 GAGTAGTGAGTGAGGTTTGCAGG + Intergenic
1019442046 7:1052419-1052441 GAGTCGTGGGGGAGGGTTTCGGG + Intronic
1022036668 7:26541262-26541284 GAGTCCTGTGTGAAGTTTAAGGG - Intergenic
1035313612 7:157984565-157984587 GAGTGGTGAGTGATGGTTGCTGG + Intronic
1035956758 8:4088877-4088899 GAGTAGAGGGGGAAGATTGCGGG - Intronic
1046192423 8:110814112-110814134 GTGTAGTTGGTGTAGTTTGCAGG - Intergenic
1051272942 9:15372598-15372620 GTGTGGTGGGTTAAGTGTGCTGG - Intergenic
1051378696 9:16432626-16432648 GAGTGGGGGCTGAAGTGTGCAGG - Intronic
1057400772 9:94721048-94721070 GAGTCATGGGTGATGTGTCCAGG + Intergenic
1057881400 9:98795656-98795678 GAGACGTGGGGGAAGGTTTCTGG - Intronic
1058159863 9:101557969-101557991 GAGTTGTGGGTGAGGTTAGGAGG + Intronic
1058160071 9:101560337-101560359 GAGTTGTGGGTGAGGTTAGGAGG + Intronic
1060528351 9:124333080-124333102 GAGTCGTCGGGGAAGCTGGCAGG - Intronic
1061189269 9:129072154-129072176 GTGCCGTGGGTGAAGGTTCCAGG + Intergenic
1062595846 9:137298823-137298845 GAGGCGTGGGGAAAGTTTGTGGG + Intergenic
1186248213 X:7637430-7637452 GTTTCGTTGGTGAAATTTGCTGG - Intergenic
1187469223 X:19553250-19553272 GAGTCCTGGCAGAAGTTTCCTGG - Intronic
1202038989 Y:20663440-20663462 GAGTAGTAGGTGCAGATTGCAGG - Intergenic