ID: 1159559104

View in Genome Browser
Species Human (GRCh38)
Location 18:69975344-69975366
Sequence GACAGCTCTTGGCTTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159559104_1159559108 15 Left 1159559104 18:69975344-69975366 CCAGTAACAAGCCAAGAGCTGTC No data
Right 1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225
1159559104_1159559109 16 Left 1159559104 18:69975344-69975366 CCAGTAACAAGCCAAGAGCTGTC No data
Right 1159559109 18:69975383-69975405 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284
1159559104_1159559107 11 Left 1159559104 18:69975344-69975366 CCAGTAACAAGCCAAGAGCTGTC No data
Right 1159559107 18:69975378-69975400 GACTAGTTATCTGCAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159559104 Original CRISPR GACAGCTCTTGGCTTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr