ID: 1159560518

View in Genome Browser
Species Human (GRCh38)
Location 18:69987816-69987838
Sequence TCTCACTTGTTCATGGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159560518_1159560522 -3 Left 1159560518 18:69987816-69987838 CCATACACCATGAACAAGTGAGA No data
Right 1159560522 18:69987836-69987858 AGATTTATCTCTGGGATGCAAGG No data
1159560518_1159560523 12 Left 1159560518 18:69987816-69987838 CCATACACCATGAACAAGTGAGA No data
Right 1159560523 18:69987851-69987873 ATGCAAGGACAGTTTAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159560518 Original CRISPR TCTCACTTGTTCATGGTGTA TGG (reversed) Intergenic
No off target data available for this crispr