ID: 1159564087

View in Genome Browser
Species Human (GRCh38)
Location 18:70028292-70028314
Sequence TCGGTGGATGTGGCCACACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159564082_1159564087 25 Left 1159564082 18:70028244-70028266 CCATGTAAATGGTCACAGGGAGT 0: 1
1: 0
2: 0
3: 12
4: 105
Right 1159564087 18:70028292-70028314 TCGGTGGATGTGGCCACACTAGG 0: 1
1: 0
2: 0
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159564087 Original CRISPR TCGGTGGATGTGGCCACACT AGG Intronic
900331446 1:2136674-2136696 TGGCTGGAGGTGGCCACATTGGG + Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
906245525 1:44270829-44270851 CTGGTGGGTGTGGCCACACAGGG - Intronic
910297516 1:85664972-85664994 TAGGTGTATGCTGCCACACTCGG + Intronic
911125771 1:94339774-94339796 GGGGTGGCTGTGGCTACACTTGG + Intergenic
916178342 1:162061753-162061775 TAGGTGTATGTTGCCACACCTGG + Intergenic
924945289 1:248842467-248842489 TCGGGTGCTGTGGCCACTCTGGG - Intronic
1069676475 10:70252317-70252339 TCTGTGAATTTGGCCACTCTAGG - Exonic
1072743339 10:97923382-97923404 TCGGTGTACGTGGCCACCCCTGG + Exonic
1075394566 10:122117667-122117689 TCTGTGGTTGTGTCCACGCTTGG + Intronic
1075406866 10:122200998-122201020 ACTGTAGATGTGGCCACTCTGGG - Intronic
1075952238 10:126490311-126490333 TCTGTGAATGTGACCACTCTAGG - Intronic
1076246693 10:128952526-128952548 TCTGTGAATGTGGCCTCATTTGG + Intergenic
1076701201 10:132274180-132274202 ACGCTGGGTGTGGCCACACTGGG + Intronic
1077187508 11:1241936-1241958 AGGGTGGATGTGGCCACCCCTGG - Exonic
1084043307 11:66555147-66555169 TCGGTGGATGAGGGCACAGAGGG - Exonic
1084116486 11:67045666-67045688 TCGGTGGGTGGAGCCAAACTGGG + Intronic
1084658039 11:70530672-70530694 TCTGTGGATTTGGCTACTCTAGG - Intronic
1085428287 11:76424244-76424266 TCAGGTGATCTGGCCACACTAGG - Intergenic
1091174596 11:133546896-133546918 TAGGGGGAGGAGGCCACACTGGG - Intergenic
1091641716 12:2242086-2242108 TCGGAGGATGCGGCCTGACTGGG - Intronic
1097424532 12:59427150-59427172 TCAGTGTATGTGGCTACATTAGG - Intergenic
1103997393 12:124839260-124839282 TCTGTGGATCTGGCTACTCTAGG + Intronic
1104003379 12:124874855-124874877 TCTGTGGATCTGGCTACTCTAGG - Intronic
1106639797 13:31572216-31572238 TTAGTGGATGTGGCATCACTTGG - Intergenic
1106676361 13:31963030-31963052 TCTGTGCATGGGGCCAGACTGGG - Intergenic
1107618712 13:42201284-42201306 TCCTTGGGTGTGGCCAAACTGGG - Intronic
1112295450 13:98182612-98182634 TGGCTGGATGCGGCCACACTGGG - Intronic
1112567530 13:100564005-100564027 TCGGTGCCTGTGGCCACCCTGGG + Intronic
1113502611 13:110788981-110789003 TCTGTGGCTGTGGCCCCTCTTGG + Intergenic
1119367961 14:74111508-74111530 TAGGAGGATGTGGCCAGCCTGGG - Intronic
1119536705 14:75408865-75408887 TCTGTGGCTGTTGCCACAGTTGG - Intergenic
1119696840 14:76719973-76719995 GCGCTGGGAGTGGCCACACTAGG + Intergenic
1119712276 14:76830891-76830913 TCACTGGATGTGGCCAACCTGGG + Intronic
1121585660 14:95061385-95061407 CCTGTGAATGTGGCCACATTTGG - Intergenic
1122744943 14:103891929-103891951 TGGGTGATTGTGGGCACACTTGG + Intergenic
1123427908 15:20187778-20187800 TCGGAGGAGCTGGCCACAGTGGG - Intergenic
1123993380 15:25701353-25701375 GTGGTGGCTTTGGCCACACTGGG + Intronic
1124349691 15:28945958-28945980 TTGGTGTTTGTGCCCACACTGGG + Intronic
1124422038 15:29531047-29531069 TCAGTGGCTCTGGCCACACATGG + Intronic
1124621716 15:31277791-31277813 TCTGTGGATTTGGCTACTCTGGG - Intergenic
1126438547 15:48662170-48662192 CAGGTGCATGTGGCCACACCTGG - Intergenic
1131798337 15:96043756-96043778 TCGGTGGAGATGCCCACACATGG - Intergenic
1132030286 15:98433417-98433439 TCAGTGGTTGTGGTCACATTAGG + Intergenic
1132633146 16:929378-929400 TCAGGGGATGGGGCCAAACTGGG + Intronic
1134259478 16:12639374-12639396 TGGGTGGCTGTGTCCACCCTGGG + Intergenic
1136021279 16:27441866-27441888 CAGGTGGATGCGACCACACTTGG - Intronic
1136543936 16:30944999-30945021 TCGTAAGATGTGGCCTCACTAGG - Intronic
1136856388 16:33661983-33662005 TCTGAGGAGCTGGCCACACTGGG + Intergenic
1137442100 16:48506489-48506511 CAGGTGGATGATGCCACACTGGG - Intergenic
1140509138 16:75494895-75494917 GCGGGGGATGTCCCCACACTCGG - Intronic
1142006563 16:87692148-87692170 TCCTTGGAAGTGGCCACCCTGGG + Intronic
1142218928 16:88843470-88843492 TACGTGGGTGTGGCCACATTTGG + Intronic
1203117971 16_KI270728v1_random:1510460-1510482 TCTGAGGAGCTGGCCACACTGGG + Intergenic
1143666444 17:8364639-8364661 TCGGCATATGTGGCCACAGTGGG - Intergenic
1145117704 17:20226956-20226978 GCGGTGGGGGTGGCCACACCAGG + Intronic
1151231913 17:72690973-72690995 AGGGAGGAAGTGGCCACACTGGG + Intronic
1152890861 17:82880967-82880989 TTTGTGGCTGTGGCCACACAGGG + Intronic
1159564087 18:70028292-70028314 TCGGTGGATGTGGCCACACTAGG + Intronic
1159784914 18:72701907-72701929 TCTTTGGATGTTGCTACACTCGG + Intergenic
1160539520 18:79612823-79612845 TAGGTACATGTGGGCACACTTGG + Intergenic
1163714489 19:18865985-18866007 TGGGTGGATGTGAGCACCCTTGG + Intronic
1163759541 19:19128062-19128084 TCTGTGAATGTGACCACTCTGGG - Intronic
1165802715 19:38562758-38562780 ACGGTGGACGTGGGCACACGGGG - Intronic
1167897088 19:52590723-52590745 TCTGTGGATGTGTCCTCTCTAGG + Intergenic
1168648542 19:58077548-58077570 TCCTGGGATGGGGCCACACTTGG - Intronic
926726718 2:16004411-16004433 TCCCTGGATGTAGCCTCACTTGG - Intergenic
935806179 2:106749970-106749992 GAGTTGGATGTGGCCACACTGGG + Intergenic
936475395 2:112835347-112835369 TTGGTGGTGGTGGCCACACTTGG - Intronic
938722139 2:134076448-134076470 TGGCTGGGTGTGCCCACACTTGG - Intergenic
946419306 2:219556111-219556133 GCGGTGGATGTGCCCATCCTGGG + Exonic
946896890 2:224333180-224333202 TAGGTGCATGTCACCACACTTGG - Intergenic
947498915 2:230658329-230658351 TAGGTGCATGTTGCCACACCTGG - Intergenic
1171017211 20:21552890-21552912 TCTATGAATGTGGCCACTCTAGG + Intergenic
1171450652 20:25233712-25233734 GCAGGGGATGTGGCCACTCTGGG - Intergenic
1174290767 20:49506937-49506959 TTGGTATATCTGGCCACACTGGG - Exonic
1174411925 20:50341921-50341943 TGGGAAGATGTGGCCATACTGGG + Intergenic
1175072059 20:56343254-56343276 TCAGTGGATGTGGCCACCTTAGG + Intergenic
1179614866 21:42576109-42576131 GGGGTGGTTGTGCCCACACTGGG + Intronic
1181089611 22:20463651-20463673 CCAGTGGGTGTGGCCACACTAGG - Intronic
1183784776 22:40023043-40023065 TCTGTGGCTGTGGGCACAGTGGG + Intronic
1184538539 22:45104140-45104162 TCGGAAGATCTGGCAACACTGGG + Intergenic
953908425 3:46880197-46880219 ACGGAGGATGTGGGCACACAAGG + Intronic
956129956 3:66043736-66043758 CAGGTGGATGTCACCACACTTGG - Intergenic
966460393 3:180169375-180169397 TAGGTGTTTGTGGCCACAATGGG + Intergenic
966640447 3:182183716-182183738 TCAGTCCTTGTGGCCACACTGGG - Intergenic
969364297 4:6685071-6685093 TCAGATGATGTGACCACACTGGG - Intergenic
969675751 4:8613503-8613525 ACGGTGACTGTGGCTACACTGGG + Intronic
972029411 4:34434489-34434511 TCTGTGGATGTGGACTCTCTCGG + Intergenic
977533050 4:98222805-98222827 TAGGTGGGTGTGGCCAAAGTAGG - Intergenic
984581854 4:181518830-181518852 TCTGTGGATCCAGCCACACTGGG + Intergenic
985493547 5:192554-192576 CCTGTGGCTGTGGCCACACCCGG - Intronic
986282377 5:6334178-6334200 TGAGTGGAAGTGGCCACATTTGG - Intergenic
994632936 5:102308426-102308448 GGGGTGGATGAGGCCACAGTGGG - Intergenic
1002421289 5:179150340-179150362 TGGGTGGTTCTGGCCTCACTGGG + Intronic
1004883343 6:20029836-20029858 TCTGTGGATTTGGCTACTCTAGG + Intergenic
1007602133 6:43089016-43089038 TAGGTAGATGTGCCCACGCTTGG + Intronic
1007713408 6:43838944-43838966 GCGGTGCATGTGCCCAGACTTGG + Intergenic
1009546729 6:65030106-65030128 TCGGGGAATGTGGCCAGACTTGG - Intronic
1017002298 6:150005009-150005031 TCGGGGGCTGGGGCCAAACTTGG - Intergenic
1019603594 7:1897552-1897574 AGGGTGGAGGTGGCCCCACTTGG - Intronic
1021994827 7:26169451-26169473 TCATGGGATGTGGGCACACTGGG + Intronic
1025271537 7:57524388-57524410 TCTGTGGATGTGGACTCTCTCGG - Intergenic
1029596108 7:101538386-101538408 TTGGTGGATGAGGCACCACTAGG + Intronic
1035769282 8:2134007-2134029 ACGGTGGAGGTGGCTACACAAGG - Intronic
1046261624 8:111775641-111775663 TTGGTGCATGTGGCCAGACGTGG - Intergenic
1046570603 8:115960659-115960681 TCAGTGAATGTGGCAACAATAGG - Intergenic
1048011527 8:130460493-130460515 TCTGTGAATGTGACTACACTAGG + Intergenic
1048022721 8:130555364-130555386 GTGGGGGATTTGGCCACACTGGG + Intergenic
1049318147 8:141980633-141980655 TCTGTGGCTCTGCCCACACTTGG + Intergenic
1051029792 9:12659278-12659300 CCAGTGGTGGTGGCCACACTAGG + Intergenic
1056798219 9:89673874-89673896 TGGGGGGATGTGTACACACTGGG - Intergenic
1056935155 9:90910738-90910760 TCTGTGGATGTGGCCTTATTTGG + Intergenic
1057421247 9:94914605-94914627 TTGAAAGATGTGGCCACACTAGG - Intronic
1057609156 9:96525415-96525437 TCGGTGGCAGTGGCAGCACTGGG - Intronic
1059383071 9:113943570-113943592 TCAGAAGATCTGGCCACACTGGG - Intronic
1060077748 9:120608547-120608569 TCAGTGGATGAGGCCACCCATGG - Intronic
1060249340 9:121972466-121972488 TCGGTGGAAGAAGCCACACCTGG + Intronic
1060585942 9:124785969-124785991 TAGGTGCATGAGACCACACTCGG - Intronic
1061029998 9:128075562-128075584 TAGGTGTAAGTCGCCACACTTGG - Intronic
1061213069 9:129204515-129204537 CTGGGGGATGAGGCCACACTGGG - Intergenic
1062415642 9:136448261-136448283 TCTGTGGATCTGGCGACTCTGGG - Intronic
1185658147 X:1702577-1702599 TTGGTGGAGGTGGCCTCTCTCGG + Intergenic
1185658161 X:1702663-1702685 TCGGTGGAGGTGGCCTCTCTCGG + Intergenic
1187043009 X:15616822-15616844 GCGGGGGAAGAGGCCACACTGGG - Intergenic
1189563434 X:42214675-42214697 TCAGAGGATGTGGCCACAAATGG - Intergenic
1193449461 X:81647561-81647583 TAGGTGGTCGTGGCCACTCTGGG + Intergenic
1199282833 X:146022135-146022157 TCAGTGGTTGTGGCCACCGTGGG - Intergenic
1200059948 X:153479757-153479779 CCAGTGGTTGTAGCCACACTTGG + Intronic