ID: 1159564856

View in Genome Browser
Species Human (GRCh38)
Location 18:70036979-70037001
Sequence AGGGAGAGAGCAGCGACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 644
Summary {0: 1, 1: 1, 2: 10, 3: 88, 4: 544}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159564848_1159564856 11 Left 1159564848 18:70036945-70036967 CCTGGTATGGCGAGCTAACTTGC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG 0: 1
1: 1
2: 10
3: 88
4: 544

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159564856 Original CRISPR AGGGAGAGAGCAGCGACTGG GGG Intronic
900002192 1:20878-20900 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
900021914 1:191402-191424 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
900757712 1:4448544-4448566 AGGGAGAAAGCAACTTCTGGTGG - Intergenic
900933331 1:5750438-5750460 AGGCACAGAGCGGGGACTGGAGG - Intergenic
900995573 1:6121585-6121607 AGGGAAAGAGCTGAGACAGGTGG + Intronic
901623602 1:10609546-10609568 AGTGACAGAGCAGAGATTGGTGG - Intronic
901779196 1:11581804-11581826 AGGCAGAGAGTAGCAACTCGGGG - Intergenic
902600490 1:17537559-17537581 AGGGAGAGGTCAGGGAATGGAGG + Intergenic
904265020 1:29313169-29313191 AGGGAGAAAGCAGAGAGAGGAGG - Intronic
905170959 1:36109247-36109269 AAGGAGAGAGCAGCGCGGGGCGG - Intronic
905285718 1:36879031-36879053 AGGGAGAGAAGAGCCACTGAGGG - Intronic
906181248 1:43821550-43821572 AAGCAGAGAGCAGTGACTTGAGG + Intronic
906290625 1:44617334-44617356 AGGGCGAGAGAAGCGAGGGGAGG - Intronic
906315993 1:44786728-44786750 AGGGAGAGTGGAGAGCCTGGGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909583164 1:77260783-77260805 AGCGAGGGGGCAGGGACTGGGGG - Intergenic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
913104046 1:115595460-115595482 AGGGGGAAAGCAGCGGGTGGAGG + Intergenic
913583923 1:120254707-120254729 AGGGAGAGAGGAGGGAGGGGAGG + Intergenic
913624249 1:120643613-120643635 AGGGAGAGAGGAGGGAGGGGAGG - Intergenic
913659824 1:120996836-120996858 AGAGAGAGAGAAGTGACTTGTGG + Intergenic
914011181 1:143779974-143779996 AGAGAGAGAGAAGTGACTTGTGG + Intergenic
914166653 1:145181162-145181184 AGAGAGAGAGAAGTGACTTGTGG - Intergenic
914649804 1:149688613-149688635 AGAGAGAGAGAAGTGACTTGTGG + Intergenic
914717981 1:150267463-150267485 AAGGAGAGACCAGAAACTGGGGG + Exonic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
915839927 1:159205454-159205476 AGGGGGAGAGCTCCGCCTGGAGG - Exonic
915991500 1:160521770-160521792 AGGTGGAGAGCAGCCACAGGAGG - Intronic
916119061 1:161511924-161511946 AGGGAGGGAGCAGCGATGGGGGG + Intronic
916128820 1:161593583-161593605 AGGGAGGGAGCAGCGGTGGGAGG + Intronic
916166770 1:161972238-161972260 AGGGAGAGAGGACAGTCTGGGGG - Intergenic
916498423 1:165365860-165365882 GGGCAGAGAGCAGGGACTGGAGG - Intergenic
917154578 1:171983108-171983130 AGGGAGAGGGCAGCTACAGAGGG - Intronic
917300675 1:173570832-173570854 AGGGAGACCACAGCAACTGGGGG - Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917330873 1:173879162-173879184 AAGTAGAGAGAAGCAACTGGGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
917720791 1:177784767-177784789 AGGAAGAGGGCAGCTACTGCAGG + Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919012934 1:191988480-191988502 AGGGAGAACACAGCAACTGGGGG + Intergenic
919729007 1:200901129-200901151 AGGGGGAGAGCAGCAGCCGGAGG - Exonic
919752004 1:201043541-201043563 AGGAGAAGAGCAGTGACTGGGGG + Intronic
919767779 1:201138489-201138511 AGGGAGAGGGGAGGAACTGGTGG - Intronic
920606167 1:207389012-207389034 AGGTAGAGAGTAGTCACTGGAGG + Intergenic
920701222 1:208219278-208219300 AGTCAGAGAGCAGAGCCTGGAGG + Intronic
921033078 1:211350996-211351018 ACAGAGAGAGCAGGGAATGGTGG - Intronic
921053477 1:211527134-211527156 GGGGAGAGAGCAGGGCCTGGGGG + Intergenic
922207055 1:223456945-223456967 TGAGGGAGAGCAGCGAGTGGAGG + Intergenic
922686323 1:227641104-227641126 ATGCAGAGAGAGGCGACTGGAGG + Intronic
923110378 1:230885296-230885318 AGGGAGAGAACATAGCCTGGAGG - Intergenic
923538211 1:234869352-234869374 TGGAAGAGAGCAGTGCCTGGAGG - Intergenic
924459638 1:244247619-244247641 AGAGGGAGAGCAGAGACTGGGGG + Intergenic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
924927407 1:248696365-248696387 AGGCACAGAGCAGAGAATGGTGG - Intergenic
1064295674 10:14076975-14076997 AGGGAGAGGGAAGAGTCTGGAGG + Intronic
1064446466 10:15398348-15398370 AGGGAGAGTGAAGCAATTGGAGG + Intergenic
1064471357 10:15639216-15639238 TTGGAGAGAACAGCGGCTGGTGG + Intronic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1067200926 10:44171601-44171623 AGGGAGAGGGCAGCCACCAGGGG + Intergenic
1067278571 10:44854818-44854840 AGGGAGAGAGCAGGTCCCGGTGG + Intergenic
1067497579 10:46773969-46773991 AGGGAGAGAGCAGGGGCGGTGGG + Intergenic
1067597072 10:47566446-47566468 AGGGAGAGAGCAGGGGCGGTGGG - Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069729679 10:70602620-70602642 AAGGAGAGAGCAGGGATTGGGGG - Intronic
1070804241 10:79261382-79261404 AGGGAGAGAGCAGGCGCTGGAGG + Intronic
1071522524 10:86340044-86340066 GCGGAGACAGCAGGGACTGGAGG + Intronic
1071966598 10:90858122-90858144 AGGGAGCGGGCAGCGGCCGGAGG - Intergenic
1072336605 10:94403251-94403273 AGGGCGCGGGCAGCGACTCGGGG + Exonic
1072710416 10:97712824-97712846 AAGGAGAGAAGAGAGACTGGTGG + Intergenic
1072990185 10:100185688-100185710 AGGGAGAGGGTAGAAACTGGAGG - Exonic
1073027270 10:100497182-100497204 AGGGAGTGTGGAGCGGCTGGTGG - Exonic
1073503918 10:103967331-103967353 TGGGAGAGAGAAGCGGCCGGCGG - Exonic
1073510416 10:104039317-104039339 TGGGAGAGAGAAGAGGCTGGAGG - Intronic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1074351097 10:112737901-112737923 AGGGAGAGAGCTGAGGATGGAGG + Intronic
1074945371 10:118276102-118276124 TGGAAGAGAGTGGCGACTGGGGG + Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075536317 10:123275035-123275057 AGGGAGGGGGCAGGGGCTGGCGG + Intergenic
1075758415 10:124835118-124835140 AGGTAAAGAGCAGCGGATGGAGG - Exonic
1076163940 10:128267474-128267496 AGGGTGAAAGCAGCGTCAGGAGG + Intergenic
1076183700 10:128430636-128430658 AGAGAGAGAGCAGGGACAGAGGG - Intergenic
1076546909 10:131251401-131251423 CAGGAGAGAGCAGGGCCTGGGGG - Intronic
1076768415 10:132650268-132650290 AGGCAGAGGGCAGGGAATGGCGG - Intronic
1076824990 10:132962470-132962492 AGGCAGAGAGCAGCCGCTTGGGG - Intergenic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1081683898 11:45027901-45027923 AGGGAGAGAGCACTGAAGGGAGG - Intergenic
1082825668 11:57576312-57576334 AGAGAGAGACAAGAGACTGGTGG - Intergenic
1083452090 11:62753009-62753031 AGAGAGACATCAGCCACTGGTGG + Exonic
1083891785 11:65599321-65599343 AGGGAGGGAGGAGTGGCTGGTGG - Intronic
1084948417 11:72651475-72651497 AGGGAGAGGCCAGGGTCTGGGGG + Intronic
1084959747 11:72710182-72710204 AGGGCCAGGGCAGGGACTGGAGG + Intronic
1085194851 11:74662957-74662979 AGGGAGAGTGCAGCAACTGTGGG - Intronic
1085415631 11:76317496-76317518 AGGTAGAGACCAGCAGCTGGAGG - Intergenic
1085478949 11:76806111-76806133 AAAGAGAGAGCAGGGAATGGGGG - Intergenic
1085693549 11:78685025-78685047 ATGGAGAGAGGAGGGAGTGGGGG - Intronic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1086595433 11:88565404-88565426 AGGGAGACAGCATGGAGTGGTGG - Intronic
1086935803 11:92744652-92744674 AGGGACACAGTAGAGACTGGTGG + Intronic
1087370595 11:97279249-97279271 AGGGACAGTGCAGGGATTGGAGG + Intergenic
1087746756 11:101956477-101956499 AGGGAGAGAACTGAGGCTGGTGG - Intronic
1091375607 12:22938-22960 CGGGAGTGTGCAGAGACTGGAGG - Intergenic
1091659406 12:2372314-2372336 AGGAAGAGAGCAGCAAGGGGTGG - Intronic
1091784265 12:3232831-3232853 ATGGAGTGAGCAGCCTCTGGAGG - Intronic
1092229946 12:6770677-6770699 AGAGAGAGAGGAGCAATTGGGGG - Exonic
1092232213 12:6782534-6782556 AGGGAGACAGGAGTCACTGGGGG + Intergenic
1093581730 12:20791194-20791216 AGGGAAAGAACAGCAACTGGGGG - Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095851402 12:46811334-46811356 AGGGGCAGAGAAGCTACTGGAGG + Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096347811 12:50866070-50866092 ATGGACAGAGCAGCGTGTGGAGG + Intronic
1096975856 12:55698985-55699007 AGGGAGGGGGCAGGGGCTGGGGG - Intronic
1097187053 12:57201691-57201713 AGTGAGGGAGCAGCCACTGAGGG - Intronic
1097508517 12:60506933-60506955 AGGAAGAACGCAGCGGCTGGGGG + Intergenic
1097899388 12:64857899-64857921 TGGGAGAGTGCAGTGACTAGAGG - Intronic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1098982698 12:76974745-76974767 AGGGATAGAGCTGTGACTGGTGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099803583 12:87488500-87488522 ACGGACAGAGCAGCGTGTGGAGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1101469841 12:104986270-104986292 GGGGAGAGGGCCGCGATTGGAGG - Intergenic
1103604682 12:122078336-122078358 AGGGAAAAAGCAGGGCCTGGAGG + Intergenic
1104076970 12:125398508-125398530 AGGGAGGCAGTAGGGACTGGCGG + Intronic
1104230678 12:126880991-126881013 AGGGAAAGACCAGGGATTGGTGG - Intergenic
1104597946 12:130132723-130132745 AGGCAGAGAGCAGCTCTTGGTGG + Intergenic
1104779854 12:131413120-131413142 AGGCTGAGAGCAGAGACTTGAGG + Intergenic
1104948514 12:132428200-132428222 AGGGCGAGAGCAGCAGCTGCTGG + Intergenic
1104991298 12:132625234-132625256 AGGGAGTGAGCAGGGCCTGGAGG - Intronic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1107210756 13:37851829-37851851 AGGGAGAGCACAGCAACAGGTGG + Intronic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1110476014 13:75914736-75914758 ACAGAGAGACCAGCCACTGGAGG + Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1112210079 13:97367712-97367734 CAGGAGAGAGCAGAGAGTGGGGG + Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113909986 13:113837114-113837136 AGGGATAGAGCAGTGATGGGAGG + Intronic
1114550388 14:23529472-23529494 AGGGAGACAGCAGGAACTTGAGG - Intronic
1114558739 14:23576915-23576937 TGGGAGAGAGCAGAAATTGGGGG + Intronic
1114651003 14:24284568-24284590 AGGGGAAGACCAGGGACTGGAGG + Intergenic
1114985249 14:28218210-28218232 AAGGAGAGTGCAGCAACTGCAGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115186364 14:30692453-30692475 AGGGAGAGAGTAGGGATTGAAGG + Intronic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117474918 14:56084333-56084355 AAAGAGAGAGAAGCAACTGGAGG - Intergenic
1117768335 14:59107017-59107039 ATGGACAGAGCAGCGTGTGGAGG + Intergenic
1118175177 14:63432651-63432673 AGGAAAAGAGAAGAGACTGGGGG + Intronic
1118548314 14:66919738-66919760 AAGTAGAGAGAAGCAACTGGGGG - Intronic
1119199447 14:72742031-72742053 AGGAAAGGAGCAGGGACTGGGGG - Intronic
1119850669 14:77864377-77864399 AGGCAGAGAGCAGGCACTGTAGG + Intronic
1121011377 14:90522197-90522219 AGGGAGCGAGCAGAGAATGGAGG - Intergenic
1121441986 14:93955284-93955306 TGGGAGAGTGCAGGGGCTGGTGG - Intronic
1121765189 14:96479845-96479867 GGGTAGAGAGCAGCCCCTGGAGG - Intronic
1121979471 14:98442270-98442292 TGGGAGAAAGCAGAGCCTGGTGG - Intergenic
1122628941 14:103098707-103098729 GGGGAGAGAGAAGCGAGTGGAGG + Intergenic
1124152725 15:27196327-27196349 AGAGAGAGAGCAGGAACAGGAGG - Intronic
1124720052 15:32104097-32104119 AGGGAGACAGGAGCCCCTGGAGG - Intronic
1125512240 15:40298321-40298343 AGCCAGAGAGCAGCACCTGGCGG + Exonic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128360681 15:66959459-66959481 GGGGACAGAGCAGGGACAGGAGG + Intergenic
1128387366 15:67159654-67159676 AGGGAGGGAGTAGGGATTGGAGG - Intronic
1128701956 15:69811153-69811175 AGGGAGGGAGAAGAGACTGAAGG - Intergenic
1128945139 15:71814674-71814696 AGGCAGAGGGCAGCTACTGCAGG + Intronic
1129030751 15:72616017-72616039 AGGGAGAATGCAGCAACTGTGGG - Intergenic
1129835661 15:78703818-78703840 AGGGAGAATGCAGCAACTGTGGG - Intronic
1130010937 15:80152727-80152749 AGGGAGGGAGGAGAGACTGGAGG + Intronic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1131033546 15:89206230-89206252 ATGGAGACAGCAGAGTCTGGAGG - Intergenic
1132119754 15:99166668-99166690 AGAAAGAGAGCAGCGACTTGAGG - Intronic
1132451318 15:101970061-101970083 TGGGAGTGTGCAGAGACTGGAGG + Intergenic
1133974118 16:10588250-10588272 TGGGAGACAGCACCGAGTGGAGG + Intergenic
1134091433 16:11393598-11393620 GGGGAGAGACCAGGGACAGGTGG - Intronic
1135296012 16:21279908-21279930 AGAGAGAGAGAAGACACTGGTGG + Intronic
1135325877 16:21525632-21525654 GGAGAGGGAGCAGCGCCTGGAGG + Intergenic
1135334911 16:21593138-21593160 AGGGAGAGAGTAGCAGCTGAGGG - Intergenic
1136343169 16:29658335-29658357 AGGGAGGGAGCAGGGAAGGGAGG - Intergenic
1136600980 16:31288147-31288169 AGGGAGAGAGAATGGAATGGAGG + Intronic
1136615479 16:31395758-31395780 AGGGAGAGAGCAGACCCAGGAGG + Intronic
1136679124 16:31945057-31945079 AGGGAGATTGCAGCAACTGGGGG + Intergenic
1136913098 16:34159916-34159938 AGGGAGGGAGCAGCGCGGGGCGG - Intergenic
1137053826 16:35734224-35734246 ATGGGGAGACCAGCGGCTGGAGG + Intergenic
1138049143 16:53758143-53758165 GAGGAGACAGCAGGGACTGGTGG + Intronic
1138316833 16:56077530-56077552 ACGGAGAGAGCAGTGACCAGAGG + Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1139492350 16:67293083-67293105 TGGGAGTGAGCAGCGTCTGAAGG - Intronic
1140083938 16:71777345-71777367 AAAGAGAGAGGAGCAACTGGGGG + Intronic
1140456848 16:75110777-75110799 AGGGAGAGCGCAGCTGCTGCAGG + Exonic
1140481640 16:75265668-75265690 GGGGAGAGCGCACCGGCTGGGGG - Intronic
1141398217 16:83723603-83723625 AGGGAGTGACCAGTGACAGGTGG - Intronic
1141485008 16:84333167-84333189 AGGAAGACTGCAGCCACTGGGGG + Intergenic
1141617960 16:85220950-85220972 AGGGGGAGAGGGGCCACTGGAGG - Intergenic
1141621446 16:85238589-85238611 AGGGGGAGTGCAGAGGCTGGCGG - Intergenic
1141675386 16:85514727-85514749 AGGCAGAGAGCAGGCACTCGGGG - Intergenic
1142540699 17:656814-656836 AGAGAGAGACAAGAGACTGGCGG - Intronic
1143861852 17:9897065-9897087 AGTCAGAGAGGAGCAACTGGGGG - Exonic
1144404474 17:14939502-14939524 AGGGAGAGGGGAGCGACGGAGGG + Intergenic
1144457575 17:15431711-15431733 AGAGAGAGAGAAGGGACGGGAGG - Intergenic
1144844036 17:18206684-18206706 AGGTACAGAGCAGAGACTGCTGG + Intronic
1145069085 17:19787910-19787932 AGGGAGAGTGCAGCAATTTGGGG + Intronic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146519946 17:33518532-33518554 AGGGAGAGAACAGCTGGTGGAGG - Intronic
1146916259 17:36680269-36680291 AGAGACAGAGCAGGGAGTGGAGG + Intergenic
1147210058 17:38867854-38867876 AGGGAGAGAACAGCAACCAGAGG + Intergenic
1147661233 17:42118146-42118168 AGAGAGAAGGCAGGGACTGGGGG + Intronic
1147914571 17:43878827-43878849 AGGGAGCAGGCAGCGCCTGGAGG - Intronic
1147963028 17:44179186-44179208 AGTGTGAGAGGAGCCACTGGAGG - Intergenic
1150325827 17:64256539-64256561 AGGAAGAAACCAGCAACTGGGGG - Intronic
1150587447 17:66531661-66531683 AGGGAGACAGCAGTGACAGGAGG - Intronic
1150978980 17:70120631-70120653 AGAGAGAGAGAAGTGTCTGGGGG + Intronic
1151125043 17:71835468-71835490 AGGGAGCAAGCAGGGAGTGGAGG - Intergenic
1151384885 17:73748919-73748941 AGGTACAGAGCAGCGGGTGGGGG - Intergenic
1151715331 17:75828120-75828142 GGGGAGAGGGCAGTGCCTGGTGG + Intronic
1152829021 17:82486037-82486059 TGGGAGAGAGCAGTGAGAGGTGG + Intronic
1152891969 17:82887299-82887321 AGGGAAACAGCAGGGACTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1155868599 18:30997396-30997418 AGGGAGAGAGGAGCAACAGGGGG + Intronic
1157494091 18:48142871-48142893 AGGGAGAGAGGAGCAAAAGGAGG - Intronic
1158497657 18:57970843-57970865 AGGTGGAGAGCAGAGACCGGAGG + Intergenic
1159545790 18:69838904-69838926 AGGGAAAGAGGAGCTAATGGAGG - Intronic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1159758991 18:72401471-72401493 AGTGACAGAGCAGAGATTGGAGG - Intergenic
1160100777 18:75917401-75917423 AGTGAGAGAGGAGAGACGGGAGG - Intergenic
1160327609 18:77965518-77965540 AGGAAGAGAGCACTCACTGGAGG - Intergenic
1160633945 19:62486-62508 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
1161007070 19:1942043-1942065 AGGGGGAGAGCAGGGGGTGGTGG + Intronic
1161009822 19:1954760-1954782 GGGGAGAGAGCAGCCCCTTGTGG + Intronic
1161045119 19:2130447-2130469 AGGCAGGGCGCAGCGACTCGGGG + Exonic
1161206235 19:3042455-3042477 AGGGGGAGGTCAGCGGCTGGGGG + Intronic
1161550822 19:4911097-4911119 AGGGAGAAAGTATCGGCTGGTGG - Intronic
1162341467 19:10093767-10093789 ATGGTGTGAGCAGCAACTGGAGG - Exonic
1162525361 19:11203430-11203452 GGGGAGAGATCAGAGACGGGAGG + Intronic
1162585486 19:11555664-11555686 AGGGAGAGAGGAGGGACAGGTGG + Intronic
1162792315 19:13069485-13069507 AGTGAGAGAGCAGACACTGGAGG + Intronic
1163468227 19:17481973-17481995 AGGGAGAGAGCAGCCACCCGTGG - Intronic
1164394598 19:27851745-27851767 AGGGAGTGAGGAGCAGCTGGTGG - Intergenic
1164925072 19:32124159-32124181 AGGGAGAGAGAAAGGAATGGAGG + Intergenic
1165186042 19:34022675-34022697 AGGGAGAGACAAGAGACTGGTGG - Intergenic
1165315372 19:35052143-35052165 TTGGAGAGAGTAGGGACTGGTGG - Intronic
1165875101 19:39001048-39001070 AGGGAGAGAGGAGCGCAAGGTGG + Intronic
1165982574 19:39737145-39737167 AGGGAGAGACCTGAGGCTGGAGG + Intronic
1166408459 19:42540421-42540443 AGGGTGAGTGCGGCCACTGGAGG - Intronic
1167407837 19:49325293-49325315 GGGGAGAGAGCAGGGAGTTGGGG - Intergenic
1167492922 19:49802237-49802259 ATGGAGAGAGGAGCGAGTCGGGG - Intronic
1167766698 19:51488076-51488098 AGGGACAGAGGAGGGACTAGTGG - Intronic
1167793469 19:51694446-51694468 AGGGAGGGAGCAGGGGCTGGGGG - Intergenic
1168229844 19:55023507-55023529 AGAGAGAGAGTTGGGACTGGGGG - Intronic
925115313 2:1373744-1373766 AGGGAGAGCGGAGAGACTGTGGG - Intergenic
925146861 2:1587867-1587889 AGGGACAGAGCAGGGACAGAGGG - Intergenic
925306010 2:2848833-2848855 AGGGAGAGGGGAGGGCCTGGGGG + Intergenic
925590077 2:5500783-5500805 AGGGAGAGAGAAGGGAGAGGAGG + Intergenic
927764568 2:25793552-25793574 AGGGAGAGATCAGACACTGAAGG + Intronic
927865024 2:26582746-26582768 ATGGAGTGAGGAGAGACTGGGGG + Intronic
928022616 2:27716014-27716036 AGGGAGGGAGCAGAGAGGGGTGG - Intergenic
928118215 2:28563335-28563357 AAGGAGAGAGCAGGAAGTGGAGG + Intronic
928495741 2:31829723-31829745 AGGGAGAGTGCTGCAATTGGAGG - Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
929493595 2:42419857-42419879 AGCAAGAGAGCAGAGACTGCCGG + Intronic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
931248458 2:60510200-60510222 AGGGAGATGGAAGCCACTGGAGG - Intronic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
931880210 2:66560824-66560846 AGGTAGAGAACAGCGGCAGGAGG - Intronic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
932518306 2:72378147-72378169 TGGCAGAGAACAGCCACTGGAGG - Intronic
932764697 2:74462315-74462337 TGGGAGGGAGCAGATACTGGGGG - Exonic
933351545 2:81158734-81158756 ATGGAGAGAGCAGTGACTGCGGG + Intergenic
933722818 2:85409270-85409292 AGGCAGAGAGCAGGGGCTAGGGG + Intronic
933939432 2:87233105-87233127 AGGCAGAGAGCTGAGAATGGTGG + Intergenic
934777228 2:96947182-96947204 AGGGAGGGTGCAGCCACTAGGGG + Intronic
934935712 2:98463874-98463896 ACGGAGCGAGCAGAGACTGGAGG - Intronic
935263310 2:101373729-101373751 AGGGAGAAAGAAGTGACTGCAGG + Intronic
935437954 2:103056898-103056920 AGGGAGAGTGCCGTGACTAGGGG - Intergenic
935737702 2:106119516-106119538 TGCGAGAGAGCAGGAACTGGGGG - Intronic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
935835671 2:107050630-107050652 ATGGAGAGTGCAGCCACTGGGGG - Intergenic
936567533 2:113592542-113592564 TGGGAGTGTGCAGAGACTGGAGG + Intergenic
936641539 2:114317355-114317377 AAGGAGAGCTCAGCGACTGGGGG - Intergenic
936758225 2:115740167-115740189 GGGGAGAGAGAAGCAATTGGGGG + Intronic
937613670 2:123893905-123893927 AGGGAGAGTGCAGATACTGGGGG - Intergenic
937628242 2:124068286-124068308 AGACAGAGCGCAGCAACTGGTGG + Intronic
938059284 2:128239572-128239594 AGAGAGAGAGCAGCCACTCCAGG - Intronic
938211214 2:129466941-129466963 AAGGGGAGAGCAGAGACTTGAGG + Intergenic
938266039 2:129929019-129929041 AGAGAGAGAGAGGCCACTGGGGG + Intergenic
940639566 2:156332607-156332629 AGGGAGGGAGCAGGGACAGGCGG + Exonic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941631767 2:167891916-167891938 ATGGACAGAGCAGCGTGTGGAGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
943913010 2:193592441-193592463 AGGGAGAGGACCGTGACTGGGGG + Intergenic
944096050 2:195968931-195968953 AGGGACAGCGTAGTGACTGGGGG - Intronic
944543032 2:200771960-200771982 AGGGAGAGATCAGACACAGGGGG + Intergenic
944605609 2:201349186-201349208 AGCGAGTGAGCAGGGAGTGGTGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944688790 2:202140864-202140886 AGGGAGGGGGCAGCCAGTGGGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945158322 2:206862321-206862343 AGAGAGAGAGCAGCTGCAGGAGG + Intergenic
945946823 2:216002787-216002809 AGGGAGAAAGGAGGGACTGAAGG - Intronic
946182924 2:217959821-217959843 AGGGAGAGAGGGGCAAGTGGGGG + Intronic
947374919 2:229486019-229486041 AGGGTGAGAGCTGAGACTGGTGG - Intronic
947860297 2:233353628-233353650 GGGGAGTGACCAGCGACTGGAGG - Intergenic
947875730 2:233467264-233467286 AGGGAGAAAGCAGAGACCAGGGG - Intronic
947928169 2:233939179-233939201 AGGGTGGGAGCAGCGACCGCGGG + Intronic
948045031 2:234936939-234936961 AGTGAGAGAGGAACGAGTGGAGG + Intergenic
948394412 2:237633598-237633620 AAGGAGAGAGGGGCGAATGGAGG + Intronic
948692456 2:239715287-239715309 AGGGAGAGAGGGGCTGCTGGTGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948892671 2:240915016-240915038 AGGGAGGGCGCAGGGACTGTAGG - Intergenic
1170000027 20:11605423-11605445 AAGTAGAGAGAAGCAACTGGGGG - Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171037187 20:21724523-21724545 AGGGAGAGAAGAGCCACTGAAGG - Intergenic
1171209920 20:23309288-23309310 AGGGAGACAGGAGGGAGTGGGGG - Intergenic
1171355733 20:24544265-24544287 AGGGTGAGAGCAGCTGCTGCAGG + Intronic
1171767867 20:29300249-29300271 AGGGAGAGAGCAGCGCGGGGCGG + Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1173836185 20:46127755-46127777 GGGCAGAGAGCAGGGAGTGGCGG + Intronic
1174447243 20:50598322-50598344 AGGGAGGGAGCTGGCACTGGAGG - Intronic
1175466089 20:59192032-59192054 AGTGTGAGAGCACCGACTCGGGG + Exonic
1176180462 20:63747317-63747339 AGGGGGTGAGCAGGGCCTGGTGG + Intronic
1176180480 20:63747355-63747377 AGGGGGTGAGCAGGGCCTGGTGG + Intronic
1176180510 20:63747431-63747453 AGGGGGTGAGCAGGGCCTGGTGG + Intronic
1176180549 20:63747512-63747534 AGGGGGTGAGCAGGGCCTGGTGG + Intronic
1177167958 21:17624161-17624183 AGGGAGAAAGCATGGGCTGGGGG - Intergenic
1179520737 21:41942776-41942798 AGGGAGAGGCCAGCCCCTGGGGG - Intronic
1179585357 21:42370883-42370905 AGGGACTGAGCAGTGACCGGAGG - Intergenic
1179585528 21:42371653-42371675 AGGGAGTGAGCAGTGGCCGGAGG - Intergenic
1179811427 21:43873103-43873125 AGGGAGATGGCATCGAGTGGCGG + Intronic
1180032292 21:45220765-45220787 AGGGAGGGAGCAGCCACGGGCGG - Intronic
1180127687 21:45803435-45803457 AGGGCGAGAGCAGAGCTTGGGGG + Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1180342527 22:11629432-11629454 AGGGAGGGAGCAGCGCGGGGCGG - Intergenic
1180926743 22:19560224-19560246 GGGGAGGGGGCAGCAACTGGAGG + Intergenic
1180990426 22:19932485-19932507 AGGGATGGAGAAGGGACTGGAGG + Intronic
1181603355 22:23965290-23965312 GGGGAGAGGGCAGGGACAGGTGG - Intergenic
1181605159 22:23976017-23976039 GGGGAGAGGGCAGGGACAGGTGG + Intronic
1182903529 22:33918910-33918932 AGAGAGAGAGGAGGGAGTGGGGG - Intronic
1183201198 22:36387078-36387100 AGGGCTGGAGCAGGGACTGGGGG + Intronic
1183325327 22:37188286-37188308 AGGGAGAGAGGAGGGGATGGAGG + Exonic
1184339802 22:43880052-43880074 ATGGGGAGAGCAGTGACTCGTGG + Exonic
1184421577 22:44385461-44385483 AGGGGGAGTGCAGCCACTGTGGG - Intergenic
1184769484 22:46589182-46589204 GGGAAGGCAGCAGCGACTGGAGG - Intronic
1185030670 22:48441333-48441355 AGGGACAGAGGCGCCACTGGAGG - Intergenic
1185408181 22:50668142-50668164 AGGATGAGAGGAGCGATTGGAGG + Intergenic
950050922 3:9988839-9988861 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950058011 3:10043956-10043978 AGAGAGAGAAGAGTGACTGGAGG - Intronic
950299187 3:11860602-11860624 AGAGAGAGAAGAGTGACTGGAGG - Intergenic
950495847 3:13333940-13333962 AGGGAGAAAACAGGGAGTGGCGG + Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
952066559 3:29577719-29577741 AGGGAGAATACAGCAACTGGGGG - Intronic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952698057 3:36293544-36293566 GAGGAGAGAGCAGCAACTGAGGG - Intergenic
952999248 3:38916816-38916838 GGGGAGGAAGCAGTGACTGGAGG + Intronic
953339129 3:42119028-42119050 AAGGAGAGAGCAGCAGCCGGTGG - Intronic
953545353 3:43860277-43860299 AGGAAGACAGCAGCGAGTGATGG - Intergenic
953774560 3:45804123-45804145 AGGGAGAGAGGAATGACTGACGG - Intergenic
953912373 3:46899511-46899533 AGGGAGAGGGCAGCCCCTGGGGG + Intronic
954669948 3:52285116-52285138 AGGGAGAGAGCTGGAAGTGGGGG + Intronic
955130163 3:56158005-56158027 AGGGAGAGGGCAGGGACTGCTGG + Intronic
955477513 3:59353321-59353343 ATGGACAGACCAGCGAGTGGAGG - Intergenic
956531688 3:70226879-70226901 AAGGAGAGAAGAGGGACTGGTGG + Intergenic
956733411 3:72217446-72217468 AGTGAGATGGCAGCCACTGGAGG - Intergenic
956927050 3:74000857-74000879 AGGCAGTGAGGAGCCACTGGAGG + Intergenic
958134867 3:89475888-89475910 ATGGAGACAGCAGCAACTGGGGG + Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
960438514 3:117657391-117657413 AGGCAGAGAGGATCAACTGGGGG + Intergenic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
962827667 3:139111762-139111784 AGGCAGAGAGCAGGGATTTGGGG + Intronic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
965211656 3:165797340-165797362 AGGAAGAAAGGAGAGACTGGAGG - Intronic
965353153 3:167640772-167640794 AGGGAGAGAGAAGGAAATGGTGG + Intronic
965415299 3:168385161-168385183 AGGGAGAGCGCACTGAATGGGGG - Intergenic
965881867 3:173396802-173396824 AGAGAGAGAGCAGAGAAGGGTGG - Intronic
966435632 3:179880968-179880990 AGTGAAACAGCAGGGACTGGTGG - Intronic
966686779 3:182703937-182703959 ACGGACAGAGCAGCGTGTGGAGG - Intergenic
966883621 3:184362777-184362799 GGGAAGAGAGCAGGGCCTGGGGG + Intronic
967408862 3:189147387-189147409 AGGTAGAGAGCAGGGAGGGGTGG - Intronic
968467716 4:760883-760905 GGGGAGACAGCAGCGACTGCAGG - Intronic
968864934 4:3202665-3202687 AGGGACAGAGCACGGATTGGTGG - Intronic
969411488 4:7031306-7031328 AGGCAGAGAGGAGCCACTGCTGG - Exonic
969648908 4:8451530-8451552 AGGGCGACAGCAGCCACTGATGG + Intronic
969828916 4:9780229-9780251 AGGGTCAGGGCAGAGACTGGAGG + Intronic
969900850 4:10347979-10348001 ATGGAGAGAGCAGCCATTAGAGG + Intergenic
970224561 4:13844135-13844157 AGGGAGAGAGATGGGAATGGAGG - Intergenic
970854690 4:20638193-20638215 AGGCTGAGAGCAGAGACTGCAGG - Intergenic
971028137 4:22608381-22608403 AGGGAGAGTGGAGCCCCTGGCGG - Intergenic
971302857 4:25456240-25456262 AGAGAGGGAGCAGGGCCTGGGGG - Intergenic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973763206 4:54139672-54139694 AGGGAGAGCACAGCAACCGGGGG + Intronic
973786941 4:54341375-54341397 CTGGAGAGAGCAGCGTGTGGAGG + Intergenic
973831589 4:54764963-54764985 ACGGACAGAGCAGCGTGTGGAGG - Intergenic
974474597 4:62362361-62362383 ATGGACAGAGCAGCGTGTGGAGG - Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
975888240 4:78991807-78991829 AGTGAGAGAGCAGCAGCAGGAGG + Intergenic
976205492 4:82619683-82619705 AGGGAGAGAGAATCCAGTGGTGG + Intergenic
976266778 4:83192586-83192608 AGGGAGAGAACAGGGGCTGAAGG + Intergenic
977325803 4:95573082-95573104 AAGGAAAGTGCAGTGACTGGAGG - Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
978976995 4:114889712-114889734 AGGGAGACAGCCTTGACTGGGGG + Intronic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
980442487 4:132867115-132867137 AGGGAGAACACAGCAACTGGAGG + Intergenic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
981996046 4:150976809-150976831 TGGGAGAGTGCAGCGACTGTGGG + Intronic
982683486 4:158459943-158459965 AAGGAGAGTGCAGTGGCTGGGGG - Intronic
982899626 4:160981601-160981623 AGGCAGAGCACAGAGACTGGGGG - Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984634236 4:182093533-182093555 AGGCAGAGTGCAGAGACAGGTGG + Intergenic
984837090 4:184032344-184032366 AGAGAGAGAGAAAAGACTGGAGG - Intergenic
985097115 4:186423922-186423944 AGGGAGAGAGCAGTCATAGGTGG - Intergenic
985485383 5:145760-145782 GGGGAGAGACCAGGGACAGGGGG + Intronic
985580851 5:694410-694432 AGGGACAGAGCCGGGGCTGGGGG - Intergenic
985595475 5:785742-785764 AGGGACAGAGCCGGGACTGGGGG - Intergenic
986076872 5:4346959-4346981 AGGGAGAGAGTAGCTAATGTCGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986450367 5:7857537-7857559 AGGAAGAGAGCAGGGTCTAGGGG - Intronic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
986928549 5:12790366-12790388 AGGGAGAGAGCTGTCAGTGGGGG + Intergenic
986941960 5:12964363-12964385 AGGGAGAGAGCAGGAACTTAAGG + Intergenic
987370515 5:17188532-17188554 AGCGAGTGAGCAGAGCCTGGTGG - Intronic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
989133939 5:38134860-38134882 AGGCAGAGGGCAGCCACGGGAGG - Intergenic
989135819 5:38153675-38153697 AGGAAGAGAGAAATGACTGGTGG + Intergenic
989641569 5:43588178-43588200 AGGGACCGAGAAGCGGCTGGAGG - Intergenic
989987450 5:50717858-50717880 AGGGAGAGAGAAGTGACTGATGG + Intronic
990267445 5:54092701-54092723 AGGGAGAGAGCAGCCTCTCGAGG - Intronic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991923735 5:71683603-71683625 AGGGACAGAGCAGCATGTGGAGG + Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993233462 5:85270127-85270149 GGGGAGAGGGCAGGGGCTGGAGG - Intergenic
993256985 5:85604471-85604493 AGGGAGGGAGCAGTGACGGTGGG + Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995278760 5:110308617-110308639 AGGGTGAGAGCAGTGAGTTGGGG - Intronic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995468799 5:112478803-112478825 TGGGAGTAAGCAGCTACTGGGGG - Intergenic
995552942 5:113298441-113298463 AGGGAGTGAGGAGAAACTGGGGG + Intronic
996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG + Intergenic
997786352 5:136717546-136717568 AGGGAGAGAGGAAAGAATGGAGG - Intergenic
998529519 5:142871847-142871869 AGGGAGAGATCGGAGACTGTTGG + Intronic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
998647269 5:144076218-144076240 AGTCAGAGAGCTGCTACTGGTGG + Intergenic
999010552 5:148034045-148034067 AGAGAATGAGCAGTGACTGGAGG + Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
999676960 5:154014328-154014350 ATGGACAGAGCAGCGCGTGGAGG + Intronic
1000794459 5:165647565-165647587 AGGAAGAGAGCAGGGATGGGAGG + Intergenic
1001311314 5:170612906-170612928 AGGGAGAGAGGAGAGACCTGGGG - Intronic
1001743483 5:174072170-174072192 AGGGAGAGGGCTGGGACAGGTGG - Intronic
1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1002313424 5:178328299-178328321 ATGGAAAGAGCAGAGCCTGGGGG - Intronic
1002417385 5:179127572-179127594 ACGGAGAGAGAAGCCTCTGGAGG + Intronic
1002539837 5:179899155-179899177 AGGGTGAGAACAGAGAGTGGCGG + Intronic
1003410088 6:5854447-5854469 AGGGAGAGAGCAAAGAGGGGTGG + Intergenic
1004197924 6:13522009-13522031 AGAGAGAGACAAGAGACTGGTGG + Intergenic
1005404124 6:25467332-25467354 TGGGAAAGAGGAGCCACTGGAGG + Intronic
1005456117 6:26021486-26021508 ATGGCGGGAGCAGCGATTGGGGG - Intergenic
1005920734 6:30398194-30398216 TGGCAGAGAGCAGGGCCTGGAGG - Intergenic
1006063512 6:31443005-31443027 TGGCAGAGAGCAGGGCCTGGGGG - Intergenic
1006420509 6:33931039-33931061 AGGCAGTGAGAAGCGGCTGGAGG + Intergenic
1006670174 6:35725498-35725520 TGGGAGAGAGAAAGGACTGGGGG + Intronic
1006808801 6:36806530-36806552 AGGGATAGAGCATCACCTGGGGG - Intronic
1007267166 6:40605378-40605400 AGGGAGAGTGCAGCTATTGATGG - Intergenic
1008101147 6:47392495-47392517 AGGGAGACAACAGTGACTGTGGG - Intergenic
1008124229 6:47650541-47650563 AGGGAGAGAGGAGAGAAGGGAGG + Intergenic
1008707661 6:54182318-54182340 AGGAAGAGCACAGCAACTGGGGG - Intronic
1008940396 6:57040183-57040205 AGGGAAAGCACAGCAACTGGAGG + Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1011102965 6:83744386-83744408 AGGGAGAGGGCAGCAATGGGGGG - Intergenic
1011195706 6:84777204-84777226 TGGGAGAGAGCAGTGAGTGCTGG + Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1013119192 6:107126329-107126351 TGGGACACAGCAGGGACTGGTGG + Intergenic
1014275609 6:119384876-119384898 AGGAAGAGTGCAGCGACTGCGGG - Intergenic
1014916996 6:127162787-127162809 ATGAAGACAGCAGCTACTGGTGG - Intronic
1015569295 6:134604724-134604746 AGGGACAGAGCAGTGGCAGGTGG - Intergenic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016010352 6:139133091-139133113 AGGCAGAGAACAGAGTCTGGAGG + Intergenic
1016086684 6:139923444-139923466 AGGGAGATAGCAGTGGCTGCAGG - Intergenic
1017924847 6:158901826-158901848 AGGGAGAGCACAGCAACTAGGGG - Intronic
1018687931 6:166318100-166318122 AGAGCCAGAGCAGGGACTGGTGG - Intergenic
1019162322 6:170076832-170076854 AGGGAGATAGCAGCAGCTGCAGG - Intergenic
1019173037 6:170145506-170145528 AAGGAGAGAGCAGGGAGAGGAGG + Intergenic
1019751720 7:2734936-2734958 AGGGAGAGAGCAGGCACGAGAGG - Intronic
1020624195 7:10557901-10557923 AGGGAAAGCACAGCAACTGGGGG + Intergenic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1022090192 7:27103025-27103047 AGGCAGAGGGCAGCCACCGGCGG - Intergenic
1023735621 7:43233774-43233796 AGGAAGAGAGGAGCAAGTGGAGG - Intronic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024586798 7:50849300-50849322 TGGTAGAGAGCAGAGCCTGGTGG + Intergenic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025083786 7:56006232-56006254 AGGGAGAGAGAAGAGAATGAAGG + Intergenic
1025206173 7:56994446-56994468 AGGGAGGGAGCAGAGAGTTGGGG + Intergenic
1025665767 7:63582493-63582515 AGGGAGGGAGCAGAGAGTTGGGG - Intergenic
1027470493 7:78567657-78567679 GGGGAAAGAGCAGCCACTGCAGG - Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029187293 7:98748303-98748325 AGGGAGAGAGGAAGGAATGGGGG + Intergenic
1030248229 7:107409852-107409874 AATGAGAGAGAAGAGACTGGAGG + Intronic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031746638 7:125506473-125506495 AGGGAGAACACAGCAACTGGAGG - Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032005965 7:128302185-128302207 AGGGAGAGAGCAGAGACAAATGG + Exonic
1032069006 7:128792289-128792311 AGGGAGAAAGGAGGGGCTGGGGG - Exonic
1032939028 7:136767577-136767599 AGAGAGAGCACAGCAACTGGGGG + Intergenic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034026271 7:147707991-147708013 GGGGAGAGAGCCAGGACTGGTGG + Intronic
1034415544 7:150962644-150962666 AGAGAGAGAGGAGTGACTGCTGG + Intronic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035075287 7:156173758-156173780 AGGGAGAGAGAGGAAACTGGAGG - Intergenic
1035173314 7:157032981-157033003 AGGGTGAAAGCAGTGACCGGGGG - Intergenic
1035524641 8:302934-302956 AGGGAGGCAGCGGGGACTGGTGG - Intergenic
1035574432 8:695901-695923 AGGGTGAGAGGAGCGAGTGCAGG - Intronic
1035574443 8:695950-695972 AGGGTGAGAGGAGCGAGTGCAGG - Intronic
1035574495 8:696164-696186 AGGGTGAGAGGAGCGAGTGCAGG - Intronic
1035574553 8:696429-696451 AGGGTGAGAGGAGCGAGTGCAGG - Intronic
1035756581 8:2037272-2037294 AAAGAGAGAGCAGCAGCTGGAGG + Intergenic
1036662167 8:10715604-10715626 AGGAAGAGGGCGGCGGCTGGAGG - Intergenic
1037902115 8:22694501-22694523 AGGGGGAGGGCAGAGACTAGGGG - Intergenic
1037995989 8:23352733-23352755 CGCGAGAGAGCAGAGAATGGGGG + Intronic
1038434855 8:27528381-27528403 AGGTACAGAGCTGGGACTGGAGG + Intronic
1040299903 8:46182536-46182558 AGCGAGACAGCAGGGAATGGTGG - Intergenic
1040596090 8:48839167-48839189 AGGGAGATGGCAGCCAATGGAGG - Intergenic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1042664169 8:71188252-71188274 AGGGAGACAGTAGAGAGTGGGGG - Intergenic
1042941392 8:74112314-74112336 AGGGTTACAGCAGGGACTGGGGG + Intergenic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043499483 8:80838602-80838624 AGGAAGAGAGCAGACCCTGGAGG + Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044744738 8:95361370-95361392 AGGGGGAGGGCAGAGAATGGTGG + Intergenic
1045491299 8:102671327-102671349 AGGGACAGAGAAGGGAGTGGAGG - Intergenic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048214420 8:132481358-132481380 AGGAAGGGAGGAGGGACTGGGGG + Intergenic
1048427787 8:134338768-134338790 AGGGAGAGAAGAGAGGCTGGAGG - Intergenic
1049298176 8:141854922-141854944 AGGGAAGGAGCAGGGAGTGGAGG + Intergenic
1049299741 8:141863173-141863195 AAGGAGAGAGCAGCCGCCGGGGG + Intergenic
1049379324 8:142304208-142304230 AGGAAGTGAGCAGTGCCTGGCGG + Intronic
1049428696 8:142549385-142549407 AGGGGGAGGGCAGGGCCTGGAGG + Intergenic
1049592506 8:143469002-143469024 AGGGAGGCAGCAGGGACAGGCGG - Intronic
1049873577 8:145000648-145000670 AGCACGAGGGCAGCGACTGGTGG + Intergenic
1049885000 9:20991-21013 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG + Intergenic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052027553 9:23590399-23590421 AGAGAGAGAGCAGGAAGTGGAGG + Intergenic
1052283798 9:26761955-26761977 AGGGAGGGAGCAGGGGATGGAGG + Intergenic
1052841551 9:33295577-33295599 GGGCAGGGAGCAGCGAGTGGTGG - Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1056180251 9:84075995-84076017 GGAGGGAGAGCAGTGACTGGGGG + Intergenic
1056470901 9:86903660-86903682 AGGGAGTGAGCAGCAGCAGGTGG - Intergenic
1057464555 9:95300827-95300849 AGAGACACATCAGCGACTGGGGG + Intronic
1057549301 9:96040214-96040236 AGGAAGAGTGCAGAGGCTGGCGG - Intergenic
1057755505 9:97831825-97831847 AGGGAGAGAGAAGGGAGTAGAGG + Intergenic
1057804033 9:98208140-98208162 AAGGAGAGAGCAGGGACGAGGGG + Intronic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059841046 9:118216859-118216881 ATGGTGAGGGCAGAGACTGGAGG - Intergenic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1060974106 9:127754789-127754811 AGGGAGAGAGCTGGGGCAGGGGG - Intronic
1061271674 9:129547239-129547261 AGGGAGAGTGCAGCCCATGGGGG - Intergenic
1061422245 9:130478711-130478733 AGGGAGAGAGGAGAGGCGGGGGG + Intronic
1061481621 9:130900284-130900306 AGGGCCAGCACAGCGACTGGTGG - Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1062114923 9:134803229-134803251 GGGGAGAGAGCAGAGGGTGGAGG - Intronic
1062185388 9:135215552-135215574 AGGGAGACAGCAGCGTGAGGAGG + Intergenic
1062194189 9:135264013-135264035 GGGGAGAGGGCAGGGAGTGGGGG - Intergenic
1062354315 9:136154512-136154534 TGGGAGAGCGGAGAGACTGGAGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186369034 X:8927717-8927739 AGGGAGACAGCAGTGGCGGGAGG - Intergenic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1186806268 X:13143201-13143223 AGGGTGAGAGCCGATACTGGAGG + Intergenic
1187390550 X:18884005-18884027 AGGGAGAGAGCCGGGGATGGGGG - Intergenic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188539447 X:31233193-31233215 CAGGAGAGAGCAGTGACTGAAGG - Intronic
1188625199 X:32276065-32276087 AGGGACAGTACAGCTACTGGGGG + Intronic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1189197262 X:39162693-39162715 TGGGAGAGAAGAGCGGCTGGAGG + Intergenic
1189405609 X:40720355-40720377 AGGGAGAGAATAGTGACTGGGGG + Intronic
1190245275 X:48686783-48686805 AGGGAGAGCGGACCCACTGGAGG - Exonic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1190537135 X:51440588-51440610 AGGGACAGCACAGCAACTGGGGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193138717 X:78002696-78002718 AGGTAGAGAGCAGCGAGTGGAGG + Intronic
1193650158 X:84122235-84122257 AGGGAAAGCTCAGCAACTGGGGG + Intronic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194288654 X:92040482-92040504 AGAGAAACAACAGCGACTGGAGG - Intronic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194414517 X:93593870-93593892 AGGGAGAGAGCACCAAGTGATGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194882685 X:99273459-99273481 AGGGAGAATACAGCAACTGGAGG + Intergenic
1195199244 X:102532133-102532155 AGGAAGAGTGCAGCAACTGGGGG + Intergenic
1195343643 X:103927463-103927485 AGGGAAAGAGCAGCTACTCCTGG - Intronic
1195489469 X:105450215-105450237 AGGGCGAGTGCAGTGACTTGGGG - Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195765266 X:108289715-108289737 AGGGAGAGAGAAGTGAGTGCAGG - Intronic
1196270183 X:113700451-113700473 AGGGAGAGTGTAGCATCTGGGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1197072826 X:122321355-122321377 AAGGAGAGCACAGCAACTGGGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197953034 X:131918400-131918422 AGGGAGAGTGCAGCAACTGTGGG + Intergenic
1198278062 X:135116200-135116222 AGGGAGAGTGCAGCAAGTGGGGG - Intergenic
1198292900 X:135256316-135256338 AGGGAGAGTGCAGCAAGTGGGGG + Intronic
1198770683 X:140126903-140126925 AGGGAGAGTGTAGTGACTAGGGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1200154429 X:153967894-153967916 AGGGACAGAGGAGAGAATGGAGG + Intronic
1200370089 X:155715867-155715889 AGGGCAAGCACAGCGACTGGGGG - Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200606175 Y:5265047-5265069 AGAGAAACAACAGCGACTGGAGG - Intronic
1200920260 Y:8606866-8606888 AGGGAGAAAAAAGGGACTGGGGG + Intergenic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic