ID: 1159567186

View in Genome Browser
Species Human (GRCh38)
Location 18:70064971-70064993
Sequence TTGATCTTCTTAAGAACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 316}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159567186 Original CRISPR TTGATCTTCTTAAGAACAAA AGG (reversed) Intronic
902980439 1:20118987-20119009 TTGGTCTGCTTAAGATCAAATGG + Intronic
903911344 1:26728258-26728280 CTGTTCTTCTTAATATCAAAGGG - Intronic
904289819 1:29477921-29477943 TTGATCTTCTGAACAAAATATGG - Intergenic
906584130 1:46961552-46961574 CTGCTCTTCCTGAGAACAAAGGG + Intergenic
908568946 1:65388587-65388609 TTTATCTTCAGAAGTACAAAGGG + Intronic
908806025 1:67933397-67933419 TTTATCTTCTAAAGAAGATAAGG + Intergenic
909500143 1:76325476-76325498 GTGATATTCTTAGGAAGAAAAGG + Intronic
910162277 1:84286364-84286386 TTGATTTGCTTAAGAATAAAGGG - Intergenic
910406170 1:86892867-86892889 TTAATATTGTTAAGTACAAATGG + Intronic
910781309 1:90937636-90937658 TAGAACTTCTTAAAAATAAAAGG - Exonic
911865961 1:103022158-103022180 ATTATCTTTTTAAAAACAAATGG - Intronic
916471416 1:165126711-165126733 TTGGTCTTCTTAGCTACAAATGG + Intergenic
916563000 1:165949375-165949397 TTGGTATTCTGAAGAACACAAGG - Intergenic
917017968 1:170556066-170556088 ATAAGCTTCTGAAGAACAAAAGG - Intergenic
918710664 1:187725006-187725028 TTTATGGTCTTAAGAAAAAAAGG - Intergenic
920025354 1:202990057-202990079 TTGTTTTTCTTAAGAAAAGATGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921792907 1:219310173-219310195 TTGATCTTCTCAACAACACAGGG - Intergenic
921960826 1:221032672-221032694 TTCTTCTTATTAAGAAAAAAAGG + Intergenic
922024223 1:221736006-221736028 CTCATCTTCTAAAGAATAAATGG - Intronic
923293061 1:232565651-232565673 TTGATTTTCCTACTAACAAATGG - Intergenic
923760847 1:236842736-236842758 TTTATATTCTTAGGGACAAAGGG + Intronic
924207828 1:241732355-241732377 TAGATCTACTCAAGAACAACAGG + Intronic
924372406 1:243365630-243365652 TTGTTCTGGTTAAGAATAAATGG + Intronic
1063036589 10:2291718-2291740 ATGCTCTTGTTAAGAATAAATGG - Intergenic
1064469062 10:15616777-15616799 TTGACCTTCCTAAGCACAGAAGG - Intronic
1064558961 10:16576929-16576951 TTGCTCTTTTTAAGAAAAAGGGG + Intergenic
1065351753 10:24802053-24802075 TTGATCTTCAAAAAAACCAAGGG - Intergenic
1068917449 10:62447615-62447637 TTGACCGTCTTCAGAACAACAGG - Intronic
1069098607 10:64290390-64290412 TTGATCTTCTTAACACCATAAGG - Intergenic
1071246487 10:83770702-83770724 TGGATCTCTTTTAGAACAAAAGG - Intergenic
1071457590 10:85862838-85862860 TTGATCTTCATGAGAAAATAAGG + Intronic
1072516820 10:96191805-96191827 ATGAGCTTCTTAAAAAGAAATGG + Exonic
1073721689 10:106179985-106180007 TTGATGTCATTAAGAACAAACGG - Intergenic
1073897174 10:108175988-108176010 TTTTACTTCTTAAGAGCAAAAGG - Intergenic
1075340018 10:121639530-121639552 ATGTTCTGCTTAAGAACAGAGGG - Intergenic
1075696851 10:124442563-124442585 TTGTTCTCCTTTACAACAAAAGG - Intergenic
1076077742 10:127549185-127549207 TTGTTCTTGTTAAGAAGAAAAGG - Intergenic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1077647047 11:3934522-3934544 TTGAACCTCTTAAGAGCAAGAGG + Intronic
1077931078 11:6733650-6733672 TTGATCATCTTAATAAGAAATGG - Intergenic
1077932368 11:6747037-6747059 TTGATCATCTTAATGAGAAATGG + Intergenic
1077996503 11:7457011-7457033 TTGATCTTGTTCAGAATGAAGGG - Intronic
1078123482 11:8534844-8534866 TTGATCTCCTTAAGATCTATAGG - Intronic
1080957818 11:37121242-37121264 CTCATTTTCTTAAGGACAAAGGG - Intergenic
1083048068 11:59754470-59754492 TTTGTCTTCTTGGGAACAAATGG - Intronic
1084852751 11:71956172-71956194 TTGAACATCTTAAGTACTAAAGG + Intronic
1086047932 11:82554650-82554672 TTAATCTTCTTGAAAATAAATGG + Intergenic
1086269392 11:85042483-85042505 TTAATCTGCTTAAGATCACATGG + Intronic
1086397889 11:86434805-86434827 TTGATCTTGTGCAGAACATATGG + Intergenic
1089441000 11:118516844-118516866 GTGAGCTCCTTAAGAACAGACGG + Intronic
1089711667 11:120319346-120319368 TTTATCTTCTTTAAAAAAAAGGG + Exonic
1092596187 12:10007161-10007183 CTAATTTTCTTAACAACAAATGG - Intronic
1092737862 12:11600495-11600517 TTCATTTCCTGAAGAACAAAGGG + Intergenic
1093365342 12:18289165-18289187 TTGATCTTCTTTTGAATTAAGGG - Intronic
1095126293 12:38481925-38481947 TTTATTTTCTTAAGTACAACTGG + Intergenic
1095166981 12:38984424-38984446 TTTAAATTCTTAAGAGCAAATGG - Intergenic
1095813497 12:46396683-46396705 TTGATTTTCTGCAGTACAAATGG + Intergenic
1097698226 12:62795353-62795375 TTGATATTCTAAATAACAAAAGG - Intronic
1098115205 12:67168539-67168561 TTGATGTACTCAAGAAAAAATGG + Intergenic
1098192985 12:67970000-67970022 TTGATCTTCTTAAATACATTTGG + Intergenic
1098379057 12:69849279-69849301 TTGACCTTCTTAATGCCAAAAGG - Intronic
1098578132 12:72067932-72067954 TGGATCTTTTTAAGACCAACTGG + Intronic
1099350446 12:81561817-81561839 TTAATTTTTTTAAGAACATATGG - Intronic
1099590536 12:84582286-84582308 TTGATATTTTTAAGAAGGAATGG - Intergenic
1100123168 12:91393137-91393159 TTGATCTTCTCAAGGAATAATGG + Intergenic
1100671051 12:96813348-96813370 TTGAGCCTCATAAGAACACAAGG - Intronic
1100742541 12:97609364-97609386 TTGATTTTTTTAAGAAAATAAGG - Intergenic
1101820776 12:108182758-108182780 GCTATCTGCTTAAGAACAAAAGG + Intronic
1101864024 12:108506694-108506716 TGGAGCTTATTAAGAACAAAGGG + Intergenic
1101915756 12:108894392-108894414 ATGATCTTCCTATTAACAAAAGG - Intronic
1102847293 12:116199328-116199350 TTGATTTTCTTAAGCAGAAATGG - Intronic
1102971589 12:117172105-117172127 CTGATCTGCTTTGGAACAAAGGG + Intronic
1105294655 13:19076987-19077009 TTGATGTTTTTCAGAACAATGGG - Intergenic
1105602725 13:21901677-21901699 TTGATCATTTTCAGAACACAAGG + Intergenic
1106860915 13:33907346-33907368 TTATTATTTTTAAGAACAAATGG - Intronic
1107267696 13:38577162-38577184 TCCATCTTCCTAAGAACTAAGGG + Intergenic
1107334757 13:39343103-39343125 ATGATATTCTTATGAAGAAAAGG - Exonic
1107780136 13:43891522-43891544 TTGATTTACTTAAAACCAAATGG + Exonic
1108246073 13:48515658-48515680 TAGTTCTTCTTCAGAACAAAGGG + Exonic
1108544763 13:51481785-51481807 TTGAAATTCTTAAGAGGAAAAGG + Intergenic
1109396891 13:61771016-61771038 TTGATTGTCTTAAGTACAAAGGG - Intergenic
1109932029 13:69228425-69228447 TTGATTTACTTGAGAACTAATGG + Intergenic
1110347689 13:74467162-74467184 TTGAACTTCTAAAAAAAAAAAGG - Intergenic
1112799904 13:103099121-103099143 TGGATTTTCTAAAGAATAAAAGG + Intergenic
1112804835 13:103152574-103152596 TTGATTTTCTGAAGAGTAAAAGG - Intergenic
1113301140 13:109020601-109020623 TTGATCTTGTTAAGAAGACAAGG - Intronic
1113377641 13:109780640-109780662 CTGGTCTATTTAAGAACAAAAGG + Intronic
1113663913 13:112127390-112127412 TTGACCTTCTTAGGAACCAGGGG - Intergenic
1115048858 14:29030925-29030947 TTGACCTTCTTCAGAAAAGAAGG + Intergenic
1115711922 14:36060277-36060299 TTGAACTTCTTTAAAACATAGGG + Intergenic
1116099846 14:40419915-40419937 TTCATCTCCATAAAAACAAAAGG - Intergenic
1116572572 14:46536129-46536151 TTGATCTGATTAAATACAAAAGG - Intergenic
1117084648 14:52187010-52187032 GCTATCTGCTTAAGAACAAAAGG + Intergenic
1117509124 14:56431132-56431154 TTTATCTGCTTAGGAACAAAAGG - Intergenic
1118161023 14:63290574-63290596 TTTATGTTCTTAGGAATAAATGG + Intronic
1118284175 14:64456103-64456125 TTGATCTTCACATGAAGAAAAGG + Intronic
1120475002 14:84975820-84975842 TTGATGTTCTTCAGAACTTATGG + Intergenic
1120503648 14:85327173-85327195 GTGTTCATCTTTAGAACAAAGGG + Intergenic
1121191674 14:92036247-92036269 TTGGCCTTTTTAAGTACAAAGGG + Intronic
1122833537 14:104418329-104418351 ATGAAATTGTTAAGAACAAATGG + Intergenic
1123879684 15:24665699-24665721 CTGATCTTCTTTAGAAGAAATGG - Intergenic
1123889548 15:24762922-24762944 TTCACTTCCTTAAGAACAAATGG + Intergenic
1123903340 15:24898002-24898024 TTGATCTTCCTAACACTAAAGGG - Intronic
1124948913 15:34298094-34298116 CTGAACTTCTTGAGAGCAAATGG - Intronic
1125532155 15:40420707-40420729 TTGATCTTTTTAAAAACAAAGGG - Intronic
1126288393 15:47043121-47043143 TTGCTCTTTTTCAGAAAAAAAGG + Intergenic
1126296631 15:47144930-47144952 CTGTTCTTCTTAAGCACACATGG + Intergenic
1126435722 15:48635689-48635711 CTGATTTTCTTAAAAGCAAATGG + Intronic
1126900689 15:53311254-53311276 TTGATCTTCTTAACAATATATGG + Intergenic
1127409548 15:58692163-58692185 TTGACCTTTTTTAGAACAAGAGG - Intronic
1128192843 15:65720083-65720105 TTAATGTTCTTTATAACAAAAGG - Intronic
1128450758 15:67804757-67804779 GTGCCCTTCTAAAGAACAAAGGG - Intronic
1128594216 15:68929911-68929933 TTGACCTTCTTAAAAAGATAGGG - Intronic
1130402773 15:83573076-83573098 TTGATCTTCTTGAGAAGTAATGG - Intronic
1135386129 16:22041983-22042005 TTCATCTTCTTTAAAACAAACGG + Intronic
1138176342 16:54901496-54901518 CAGATCTTGTTAAGAACAGATGG - Intergenic
1139117064 16:63967840-63967862 TTGATGTTATTAAGAGAAAATGG + Intergenic
1141236155 16:82219223-82219245 TTTATATTCTTAAGAGTAAAAGG - Intergenic
1142328320 16:89433113-89433135 TTCAGCTTCTTTAGAACAGATGG + Intronic
1144118206 17:12122111-12122133 GCTATCTGCTTAAGAACAAAAGG - Intronic
1145895241 17:28453628-28453650 GTGATATTCTTTAGAATAAATGG - Intergenic
1146143634 17:30390416-30390438 TTGATTTTCTCTAAAACAAAAGG - Intronic
1146392405 17:32434999-32435021 TTGTTCTTTTAAAGAACACAGGG + Intergenic
1147616773 17:41833991-41834013 TTAATCTTCTTTTGAACAGATGG - Intronic
1148407288 17:47427368-47427390 CTGATATTCTAAAGAAGAAAAGG - Intronic
1149153903 17:53603284-53603306 TTGATGTTCTTAAACAAAAACGG - Intergenic
1151020294 17:70608433-70608455 TTGATCTTCTTATGTAATAATGG + Intergenic
1156941492 18:42772445-42772467 TTTATGTGCTTGAGAACAAAAGG - Intronic
1158142703 18:54272196-54272218 CTGATTTACTGAAGAACAAAGGG + Intronic
1158601585 18:58860432-58860454 TTGATGTTCTTAAAAAGAAAAGG + Intergenic
1159084296 18:63770941-63770963 TTCATCTTCGTTGGAACAAAGGG + Intronic
1159471610 18:68864679-68864701 ATGATCTTTTTAAGGACAGAAGG - Intronic
1159567186 18:70064971-70064993 TTGATCTTCTTAAGAACAAAAGG - Intronic
1166941144 19:46366638-46366660 TTGAGCTTTTAAAGAAAAAAAGG + Intronic
1167394907 19:49222143-49222165 TTTATCTTCTTCAGAACCCACGG + Intergenic
927436037 2:23067413-23067435 TTGGTCTTCTGAAGAACAGCTGG + Intergenic
928598761 2:32883343-32883365 CACATGTTCTTAAGAACAAAGGG + Intergenic
929132851 2:38595418-38595440 TTGGTCTTCTTACAAAGAAATGG + Intronic
930502672 2:52242197-52242219 TTTATCTGCTTAAGAACTATTGG - Intergenic
931842520 2:66169398-66169420 TTGATATTCATAATATCAAAGGG - Intergenic
933034853 2:77382749-77382771 TTGATCTTGTTAAAAACTGAAGG + Intronic
933242586 2:79939784-79939806 ATGATTTTCTTAAAAACACATGG + Intronic
934632388 2:95942170-95942192 TTGACCTTCTCAACAACATATGG - Intronic
934801114 2:97161092-97161114 TTGACCTTCTCAACAACATATGG + Intronic
936843172 2:116799047-116799069 GTTATCTGCTTAGGAACAAAAGG - Intergenic
937904914 2:127048417-127048439 TTCATCTTTTGAAGAGCAAAGGG - Exonic
938630193 2:133158367-133158389 TTCATATTCTTAAAAATAAATGG - Intronic
939626455 2:144483511-144483533 TTGATCTTCTTCAAAAGTAAAGG - Intronic
939890069 2:147726047-147726069 TTAAACTTCTTTAGACCAAATGG + Intergenic
941224386 2:162828259-162828281 GTGATCTTTTTTAGCACAAATGG + Intronic
941412155 2:165172202-165172224 TTGATGGTCTTAAACACAAAGGG - Intronic
942132461 2:172893689-172893711 TTTGTCTTCTTTAGAAGAAAGGG + Intronic
942486429 2:176444712-176444734 TTTGTTTTCTTAAGAACCAAAGG + Intergenic
942967960 2:181920153-181920175 TTGATTTTGTTAAAAAGAAATGG + Intronic
943451667 2:188049902-188049924 TTTATCTTCTCAAGAAAATATGG + Intergenic
944028794 2:195206629-195206651 TTGATAATCTGAAGAAAAAATGG - Intergenic
944190264 2:196995601-196995623 TTTTTCTTCTCAACAACAAATGG + Intronic
945158868 2:206867814-206867836 ATGATCTTCTCTAGAACCAAAGG - Intergenic
947022902 2:225702456-225702478 TATATCTTCTTAAAAACAATTGG - Intergenic
948189990 2:236051200-236051222 TTTATCTTCTTAGGTGCAAAGGG - Intronic
1170098973 20:12677742-12677764 TTCATCTTCGTAAAAAAAAATGG - Intergenic
1170555564 20:17512289-17512311 TTAATCTTCACAAGAACAACGGG + Intronic
1170660020 20:18329199-18329221 GTTATCTACTTAGGAACAAAAGG - Intergenic
1171511394 20:25687676-25687698 GCTATCTCCTTAAGAACAAAAGG - Intronic
1173790524 20:45824930-45824952 TTGTTCTTCTGGAGAACCAAGGG - Intronic
1174313416 20:49677523-49677545 TAAGTCTTCTTAAGAACAAATGG + Intronic
1176979391 21:15362668-15362690 TTTAGCTTCTGAAGAACATAAGG - Intergenic
1177387065 21:20422448-20422470 TTGGTCTTCTTAAAAACAACAGG - Intergenic
1178200230 21:30394841-30394863 ATGATTTTCTGTAGAACAAATGG - Intronic
1179061393 21:37982740-37982762 TTGATGTTCTTAAGAATCAGAGG - Intronic
1179367284 21:40770138-40770160 ATTATCTTCCTAAAAACAAAAGG + Intronic
1179603926 21:42499760-42499782 TTGTCCTTCTTAAGTATAAATGG + Intronic
1181368213 22:22396489-22396511 TTGAGCTTCTTCAGAACTAAGGG - Intergenic
1182401632 22:30082063-30082085 TGGATCTTCTTTAAATCAAAGGG + Intronic
1182581486 22:31315038-31315060 TTGTTTTACTTCAGAACAAAGGG + Intergenic
1182944153 22:34306269-34306291 TTGATCTTCTTGGAAACAAAAGG - Intergenic
1184036820 22:41922313-41922335 TTGATCTTCATAAGAGCACCTGG - Intergenic
949146767 3:710201-710223 TTTATCTTCAAAAGAAAAAAAGG - Intergenic
949277112 3:2296672-2296694 TTGATATTGTATAGAACAAAAGG + Intronic
950980242 3:17296463-17296485 TTGACTTTCCTAAGTACAAATGG + Intronic
951366069 3:21784250-21784272 TAGATATTCTTAAAAACAGAAGG + Intronic
951598979 3:24351574-24351596 TTGACCTAAATAAGAACAAAAGG - Intronic
951602939 3:24396966-24396988 TTGCTATTCTTAAGCACAATTGG + Intronic
952165234 3:30740791-30740813 TTAATGTTCTTAATAATAAAGGG - Intronic
952531866 3:34271174-34271196 TTGAGCTTGGTAAAAACAAATGG - Intergenic
952969981 3:38644667-38644689 TTGATCATCTTAAAAAGACACGG + Intronic
955436217 3:58901635-58901657 GTGATTTTTTTAATAACAAAAGG + Intronic
956551521 3:70465776-70465798 TAGATCTTCTTAAGGAGAATTGG + Intergenic
958150575 3:89688854-89688876 ATTATTTTCTTAAGAAGAAAAGG - Intergenic
958820854 3:98972130-98972152 TTTATCTTCTTAAAATCAGAAGG - Intergenic
960191606 3:114713224-114713246 TTCATTTTCTTCAGAAGAAAAGG + Intronic
960441934 3:117699139-117699161 TTTATCTCATTAAGAAGAAATGG + Intergenic
961349405 3:126290083-126290105 TCTATCTGCTTAGGAACAAAGGG + Intergenic
961574212 3:127822019-127822041 AGCATTTTCTTAAGAACAAATGG - Intronic
961626282 3:128266097-128266119 TTGAAGGCCTTAAGAACAAAAGG - Intronic
962026189 3:131550196-131550218 TTTATGTTCTTAAGATAAAAAGG + Intronic
962189266 3:133293033-133293055 ATAATATTCTTAAGAACAATAGG + Intronic
962701705 3:138007143-138007165 TAGAGCTTTTTAAGAATAAAAGG + Intronic
963914301 3:150843401-150843423 AAGATCTGCTTAGGAACAAAAGG - Intergenic
964466307 3:156997079-156997101 AAGATATTCTGAAGAACAAATGG + Intronic
964885334 3:161475915-161475937 ATTATATTCTTAAAAACAAAAGG + Intergenic
965183584 3:165435340-165435362 TTTATCTTCTTAAAAAAAAAAGG + Intergenic
965980970 3:174689961-174689983 TTGATCTTCTAAAAAAAAAAAGG + Intronic
966047815 3:175574290-175574312 TGTATTTTCTGAAGAACAAAGGG + Intronic
966630158 3:182063803-182063825 TGGATTTTCTTAAAAGCAAATGG + Intergenic
967012568 3:185450446-185450468 TTGATATACTGAAGAGCAAAAGG - Intronic
967247966 3:187507486-187507508 TTTGTCTTCTGAACAACAAAAGG - Intergenic
967468412 3:189834744-189834766 TTGTGCTTCTTATGAAAAAAGGG - Intronic
967480937 3:189972686-189972708 TGGAACTTCAGAAGAACAAAAGG + Intronic
968254789 3:197258730-197258752 TTGATTTTCTTTTGAACTAAAGG - Intronic
969252599 4:5978947-5978969 TTGATCTTACAAAGAACACATGG + Intronic
970146504 4:13041873-13041895 TTAATTTTCTTAAAGACAAAAGG + Intergenic
971515466 4:27481029-27481051 TTGGTATTTTTAAGAATAAATGG - Intergenic
973574313 4:52270916-52270938 TTGATCTGCCTAATAATAAAGGG - Intergenic
973602384 4:52554852-52554874 TTTATTTTCATAAAAACAAATGG - Intergenic
974287244 4:59884468-59884490 TTTATCTTCTTAAACACACAGGG - Intergenic
974546342 4:63313243-63313265 TTGATCTTTTTAATAAAAACTGG + Intergenic
974696410 4:65380301-65380323 TTAATCTGCTGAAGGACAAATGG - Intronic
975123972 4:70761089-70761111 TTAGTCTTCCTAAGAAGAAATGG + Intronic
977890338 4:102302753-102302775 TTGATCTTCCTAATAACCTAGGG - Intronic
978760333 4:112350549-112350571 TTTATCTTCAGAAGAAGAAATGG - Intronic
979508328 4:121523556-121523578 TTTTTCTTTTTAAGTACAAAAGG - Intergenic
979742029 4:124162962-124162984 TTGATCTCATGAAGAAGAAAGGG - Intergenic
980094126 4:128472222-128472244 TTAATCTTCTTAACAAACAAAGG + Intergenic
982828014 4:160024478-160024500 TTAATCTACTATAGAACAAATGG - Intergenic
983061210 4:163162897-163162919 TTGATCTTCTGATGAAAACAGGG + Intronic
984566513 4:181337045-181337067 TTGCTCTTCCTAAGCACAGATGG - Intergenic
984613599 4:181869725-181869747 TTGACATTCTTCAGAAAAAAGGG + Intergenic
984841483 4:184072104-184072126 TGGATTTTCTCAAGAATAAAAGG - Intergenic
987935884 5:24464373-24464395 GTTATCTGCTTAGGAACAAAAGG - Intergenic
988174206 5:27700021-27700043 TTTTTCTTCTTAAAAACAGATGG - Intergenic
989076240 5:37565491-37565513 CTCATCTTGTTAAGATCAAAAGG - Intronic
990844980 5:60127289-60127311 TTAATAGTCTTAAGAACAATGGG + Intronic
990958513 5:61367557-61367579 TTGCACTTCTCAACAACAAAAGG - Intronic
992093033 5:73336258-73336280 TTTATCTTTTGATGAACAAATGG - Intergenic
992641425 5:78771469-78771491 TTTATCTGCTTAGGAACAGAAGG + Intergenic
993362214 5:86991512-86991534 TTGATCTTTTGAAGAAAAACAGG - Intergenic
993404999 5:87500163-87500185 GTGATCTTCCTAACACCAAATGG - Intergenic
993627923 5:90248098-90248120 TTGATGTTCTATAGAACAATTGG - Intergenic
994830556 5:104776784-104776806 TTGTCCTTTTTAAAAACAAAAGG + Intergenic
995774247 5:115708929-115708951 ATGAACTTTTTAAGATCAAAGGG - Intergenic
997723537 5:136100837-136100859 TCTATCTCCTTATGAACAAAGGG - Intergenic
998904508 5:146890077-146890099 TTAACCTTCTTAAGAAAAAGTGG - Intronic
999902235 5:156096728-156096750 TTTAGCTTCTTAAGAAATAAAGG - Intronic
1000627223 5:163552857-163552879 TTAATATTTTTCAGAACAAAAGG - Intergenic
1001989588 5:176105251-176105273 TTAGTCTTCTTTAAAACAAAAGG + Intronic
1002227284 5:177732887-177732909 TTAGTCTTCTTTAAAACAAAAGG - Intronic
1002227905 5:177737901-177737923 TTAGTCTTCTTTAAAACAAAAGG - Intronic
1002266858 5:178040883-178040905 TTAGTCTTCTTTAAAACAAAAGG + Intronic
1004849157 6:19678450-19678472 TTAATCTTCTGAATACCAAATGG + Intergenic
1005162349 6:22878520-22878542 TTGATGTGTTTAATAACAAAGGG + Intergenic
1006977781 6:38119797-38119819 TTGCTCTTTTGAAGATCAAAGGG - Intronic
1008279549 6:49579541-49579563 ATAGTATTCTTAAGAACAAAAGG - Intergenic
1008821432 6:55636389-55636411 TTGTTCTCACTAAGAACAAAGGG + Intergenic
1009697811 6:67132137-67132159 TTCATCTTATTAAATACAAATGG + Intergenic
1010097348 6:72062476-72062498 TTGAGATTCTTTAGAAAAAACGG - Intronic
1010417703 6:75632615-75632637 TTGATCTCTTTTCGAACAAATGG + Intronic
1010550443 6:77215817-77215839 ATGTTCTTATTAAGAAAAAATGG + Intergenic
1010590544 6:77707109-77707131 TGGAACTTCTTAAGACTAAATGG + Intronic
1010988328 6:82451159-82451181 TTGCTTTTCTTAAGATCAACTGG - Intergenic
1011206205 6:84901945-84901967 TTAATCTTCTTAAGAAAAGCAGG + Intergenic
1011285858 6:85721927-85721949 GATATCTGCTTAAGAACAAAAGG + Intergenic
1012215528 6:96578336-96578358 TTTTTCTTCTTAAGAAAACAAGG + Intronic
1012348868 6:98226305-98226327 TTGTTCTTCTGAAAAAGAAATGG - Intergenic
1013298920 6:108784929-108784951 TTAAACTTCTTAATGACAAATGG - Intergenic
1014208684 6:118685161-118685183 CTTATATTCTTAAAAACAAAAGG - Intronic
1014538341 6:122644558-122644580 TTAATCTTCTTAAGAACGCTGGG - Intronic
1014973928 6:127854868-127854890 TTGATCATTTTAAGAACGAATGG - Intronic
1015665459 6:135623377-135623399 TACATCTTCATAAAAACAAAAGG - Intergenic
1016438671 6:144062937-144062959 TTCCTCTTCTCAAGAACCAAAGG - Intronic
1017437826 6:154434139-154434161 TTATTCAGCTTAAGAACAAAAGG + Intronic
1019829216 7:3309934-3309956 CTGAACTACTTAAGAAAAAAAGG + Intronic
1020362744 7:7347273-7347295 TTGATTTGCTTAATGACAAAGGG - Intergenic
1020699833 7:11466386-11466408 TTTATTTTCTTCACAACAAAAGG + Intronic
1022625666 7:32033424-32033446 TTTATCCCCTTAATAACAAAGGG - Intronic
1022670878 7:32454542-32454564 AAGATATTCTTAAGAAGAAAGGG + Intergenic
1022778548 7:33554125-33554147 TTGATCTTGATGAGGACAAATGG + Intronic
1022922443 7:35029274-35029296 TTTATTGTTTTAAGAACAAATGG + Intronic
1023708858 7:42970525-42970547 ATGATCTGTTTAAGAACAAAAGG - Intergenic
1024322093 7:48080798-48080820 TTAATCTTCTTAAGAACCCTGGG + Intergenic
1024476473 7:49817153-49817175 ATAATCTTCTAAAGAACAGAGGG - Intronic
1025629032 7:63250961-63250983 TTATTCTTTTTAAGAACAATTGG - Intergenic
1026736130 7:72949845-72949867 CTGCTCTTCTGAAGAACCAAGGG - Exonic
1026786473 7:73304746-73304768 CTGCTCTTCTGAAGAACCAAGGG - Exonic
1027107597 7:75415213-75415235 CTGCTCTTCTGAAGAACCAAGGG + Intergenic
1028166775 7:87547296-87547318 TGTATCTTTTTAAGAAAAAAGGG + Intronic
1028451898 7:90994479-90994501 TTGACATTCTTATGTACAAATGG - Intronic
1028561098 7:92177419-92177441 TTCTTCTTCTTGAGAACATATGG + Intronic
1028657699 7:93229587-93229609 TTGATCTGATTCAGAACAATAGG - Intergenic
1030850461 7:114478449-114478471 TTGACCTTATTGAGAACCAAAGG + Intronic
1030938043 7:115610870-115610892 ATGATATTCTTAAAAAGAAAAGG - Intergenic
1030982916 7:116207641-116207663 GTAAACTGCTTAAGAACAAAGGG + Intergenic
1031198306 7:118644733-118644755 GTGATCTGCTTAAAAACCAATGG + Intergenic
1033905379 7:146195228-146195250 TTGATTTTCTTTGGAAAAAACGG + Intronic
1033932411 7:146540486-146540508 TGGATCTTCTGAAGAAGACAGGG - Intronic
1037536887 8:19833024-19833046 TTGATCATCTGAGGAAGAAACGG - Intronic
1038101616 8:24383635-24383657 TTCATCTTCTTATGCAGAAAAGG - Intergenic
1038392202 8:27212527-27212549 TTGATCCTCCTAAAAATAAAAGG - Intergenic
1038732363 8:30138899-30138921 CTTTTCTTCTGAAGAACAAAAGG - Intronic
1040598638 8:48863549-48863571 TTCAGTTTTTTAAGAACAAATGG + Intergenic
1041093844 8:54329858-54329880 GTGATCTTTTTAAAAAGAAAAGG - Intergenic
1041127894 8:54663863-54663885 TTAATCTTTTTAAAATCAAAGGG - Intergenic
1042143544 8:65703859-65703881 TTGCTATCCTTAAGAACAGAGGG - Intronic
1042360410 8:67876552-67876574 ATTATCTGCTTAGGAACAAAAGG + Intergenic
1042491722 8:69407171-69407193 CTGATCTTCTGTAGAGCAAAGGG + Intergenic
1042686249 8:71444073-71444095 TACTTCTTCTTAGGAACAAATGG - Intronic
1042727722 8:71895275-71895297 TGGATTTTCTAAAGAACAAAGGG + Intronic
1043843546 8:85137774-85137796 TAGAACTTTTTAAGAGCAAAAGG - Intronic
1043962706 8:86435438-86435460 TTGTTTTTCTTTAGAACTAAAGG + Exonic
1044210976 8:89550932-89550954 TTACTCTTCATAAAAACAAAAGG - Intergenic
1044942179 8:97354430-97354452 TTGATCAGGTTAAGAATAAAGGG - Intergenic
1045276732 8:100713347-100713369 TTTACCTTCTTAATAATAAAAGG - Intronic
1046476230 8:114747893-114747915 TTGATCCTCTGAAGCACCAAAGG + Intergenic
1046545816 8:115648635-115648657 TTTTTCTTCTTAAAAACAAAAGG + Intronic
1046600350 8:116309554-116309576 TTGATTTTCTCAACTACAAAAGG + Intergenic
1046766686 8:118076734-118076756 TTGATTTACTTAAGAAACAAAGG - Intronic
1048828298 8:138451254-138451276 TTGATCATCTTAAACAAAAAGGG - Intronic
1050291727 9:4162214-4162236 TTGATGTTCTTAAAAAAAGAAGG - Intronic
1050716165 9:8528772-8528794 TTGATCTTCTGCAAGACAAAAGG + Exonic
1050876714 9:10648236-10648258 TTGATGTTTTTGAGAATAAAAGG + Intergenic
1050978843 9:11980942-11980964 TTGATGTTCTTAAAGACCAATGG + Intergenic
1050982928 9:12043091-12043113 TAGATATTCTTAAGAGAAAAAGG - Intergenic
1051076209 9:13239813-13239835 TTATGCTTGTTAAGAACAAATGG + Intronic
1052216654 9:25973894-25973916 TACATATTCTTAAAAACAAAGGG + Intergenic
1054935686 9:70685171-70685193 TTGATATTCTTAACAACACTGGG - Intronic
1054978930 9:71181149-71181171 GTGCTCTTCCTGAGAACAAAGGG + Intronic
1055011035 9:71565809-71565831 GTTATCTGCTTAGGAACAAAGGG - Intergenic
1055361702 9:75497842-75497864 ATGATCTTTTTAATACCAAAGGG + Intergenic
1056893527 9:90518588-90518610 TTGCTCTTCTTAAAAACAACTGG + Intergenic
1059330757 9:113534004-113534026 TTGATCTTCCTAAGAGCATCTGG - Intronic
1059983464 9:119798408-119798430 TTAACCTTATGAAGAACAAATGG - Intergenic
1060871055 9:127040441-127040463 TTGGTCTGCTTAAGAGGAAAAGG + Intronic
1061460337 9:130732799-130732821 TTGCTCCTCTGAAGAACAGACGG - Intronic
1061710292 9:132482742-132482764 TTTTTTTTCTTAAGAACACATGG + Intronic
1061836717 9:133334304-133334326 TTTTTTTTCTTAAGAGCAAAGGG + Intronic
1186509304 X:10118430-10118452 TTGATCCTCTTTAAAACCAAAGG - Intronic
1188781167 X:34287272-34287294 TTGCTTTTCTTAAGATCACAGGG - Intergenic
1188917323 X:35928046-35928068 TTGACCTGTTGAAGAACAAAGGG + Intronic
1190846455 X:54196768-54196790 TTAACCTTCTTAAAAACCAAAGG + Exonic
1191090654 X:56616979-56617001 TCTATCTGCTTATGAACAAAAGG + Intergenic
1192197037 X:69035285-69035307 GTCTTTTTCTTAAGAACAAAGGG - Intergenic
1193184468 X:78495889-78495911 TTAATCTTCCTCAGAACAAAGGG - Intergenic
1193416161 X:81227157-81227179 ATGATATTCTTATGAAAAAATGG + Intronic
1194651590 X:96521675-96521697 TTCTTTGTCTTAAGAACAAAAGG + Intergenic
1196046471 X:111261004-111261026 TTAATCTTATTAAGCCCAAAGGG - Intronic
1196888676 X:120271508-120271530 TTGATCTCCTGAGGAAAAAATGG - Intronic
1198738393 X:139812822-139812844 TTGATCAGCGTAAGAACCAAAGG - Intronic
1201374490 Y:13301952-13301974 TTCATCTTATTAAAAACATAAGG - Intronic