ID: 1159568086

View in Genome Browser
Species Human (GRCh38)
Location 18:70078907-70078929
Sequence GGGTCAAAAGATATGATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159568080_1159568086 6 Left 1159568080 18:70078878-70078900 CCATGTCTTACTCATCTCAAAAT 0: 1
1: 0
2: 5
3: 50
4: 475
Right 1159568086 18:70078907-70078929 GGGTCAAAAGATATGATGCATGG 0: 1
1: 0
2: 0
3: 15
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159568086 Original CRISPR GGGTCAAAAGATATGATGCA TGG Intronic
901564805 1:10105025-10105047 GGTTCAAAAGATTTTATGAAGGG - Intronic
902132692 1:14277244-14277266 GGGTGAAATGATATGATGTATGG - Intergenic
904956053 1:34284857-34284879 GGCTCAAATGACATGATGGATGG + Intergenic
906522140 1:46473945-46473967 GGGTTAAAATATGTGATCCAAGG + Intergenic
906863367 1:49387493-49387515 TGGTGAAAAGATAGGATGAAAGG - Intronic
907318866 1:53590153-53590175 GGGATAAAAGAGATGATGTAAGG - Intronic
911621835 1:100074123-100074145 GGGTCACAAGATAGGCTGTAGGG + Intronic
913126636 1:115796668-115796690 GAGTCAAAATATATGAAGAATGG - Intergenic
914883561 1:151566507-151566529 GCGTTAAAGGATATGATGCCTGG + Intronic
916970704 1:170011992-170012014 GAGTCAAAAGAAATGTTACAAGG + Intronic
919151652 1:193708527-193708549 GTGTTAAAAGATATGGTGAATGG + Intergenic
919784119 1:201247896-201247918 GGGTCAAAAGACATAATTCCTGG - Intergenic
922040610 1:221892671-221892693 GGGTCACAAGATATTAGGAAGGG + Intergenic
1065777472 10:29134269-29134291 GGGTAAAATAAAATGATGCATGG - Intergenic
1066528393 10:36307854-36307876 GGTTCAAAAGAGATCAAGCAAGG + Intergenic
1069659026 10:70111386-70111408 GGGTCAAAGGAGATCATGCATGG + Intronic
1071399252 10:85253435-85253457 GGATCAAATGAGATAATGCATGG + Intergenic
1073160093 10:101385781-101385803 GGGTCCATAGATAGGATTCAGGG - Intronic
1075767359 10:124904234-124904256 GGGTCAGCAGATAGGATGCAGGG - Intergenic
1080226177 11:29963298-29963320 TGGCCAAAGGCTATGATGCAAGG + Intergenic
1080514719 11:33009634-33009656 GGGAAAAAAAAAATGATGCAGGG + Intergenic
1081226889 11:40534969-40534991 GGGTCTAAACATATGGTCCATGG + Intronic
1081256985 11:40909686-40909708 AGGTCAAAAGATATGAGTCATGG - Intronic
1081647660 11:44800989-44801011 GGGTCAGAAGATGTGAGGCTTGG - Intronic
1081729248 11:45357402-45357424 GGGTCAGAAGATTAGAAGCAGGG - Intergenic
1083455532 11:62776337-62776359 GAGTCAAAGGATGTGAAGCAGGG - Intronic
1083619636 11:64042497-64042519 GGGTCAAAGGTTACGCTGCAGGG - Intronic
1083984853 11:66207087-66207109 GGGTGAAATGTTATGATGTACGG - Intronic
1084176550 11:67425278-67425300 GGGTCACAGGACATGATGCAGGG + Exonic
1084771830 11:71348304-71348326 GTGTCAAAAGCTATGGTGAAAGG + Intergenic
1085700061 11:78737858-78737880 GGGTTAGAAGATATGGTGAATGG - Intronic
1089236081 11:117026944-117026966 GGGTAAAAACATATTATTCAAGG + Intronic
1089989742 11:122848091-122848113 GGGTCAGAAGAACTGATGCGTGG + Intronic
1090525673 11:127532393-127532415 GGCTTAAAAAATATGATACATGG - Intergenic
1092663111 12:10761073-10761095 GGGTCAAAATATATATTGAAAGG - Intergenic
1094351736 12:29533624-29533646 GGTTCTACAGATATGCTGCAGGG + Intronic
1096488546 12:52000599-52000621 GAGTAAAAAGATAGGATGGAAGG + Intergenic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1098501025 12:71191969-71191991 TGGCCAAAAAATAAGATGCAAGG - Intronic
1101083059 12:101208826-101208848 GGATTAAATGAGATGATGCAAGG - Intronic
1102946545 12:116994428-116994450 GGATCAAAAGATAGGAAGGAAGG + Intronic
1108224738 13:48276704-48276726 GGGTGATATGATATGATGCTTGG - Intergenic
1111394806 13:87651597-87651619 GGGTGAAATAATATGATGTAGGG + Intergenic
1121757527 14:96415421-96415443 GTGGCAAAAGATGTGATGCAGGG - Intronic
1122444492 14:101759581-101759603 GGATCAGGAGATATGATACAAGG + Intergenic
1124390595 15:29253011-29253033 GGGTAAAATTATATGATGCCTGG - Intronic
1125812540 15:42553868-42553890 GGGTCAGCTGATATGATGGAAGG + Intronic
1129269596 15:74412325-74412347 GGGTTAAACGAGGTGATGCATGG - Intronic
1130155514 15:81346798-81346820 GGATCAAATGAGATAATGCATGG - Intronic
1140599951 16:76463750-76463772 AGATCAAAAGATATGATACAAGG - Intronic
1140703558 16:77605041-77605063 GGGAGAAAAACTATGATGCAGGG - Intergenic
1142985288 17:3691528-3691550 GGGCCAAGAGAGATGATGGATGG + Intronic
1146533742 17:33632182-33632204 TGATCAAATGATATAATGCACGG + Intronic
1147041966 17:37726383-37726405 GGGTCACATAAGATGATGCATGG + Intronic
1153903863 18:9643117-9643139 GTGTCAAAATATATTCTGCATGG + Intergenic
1157738772 18:50073835-50073857 GGGTAAAAAGATAGGAAGCCAGG - Intronic
1157946203 18:51983506-51983528 GGCACAGAAGATATGAAGCAGGG + Intergenic
1158372735 18:56827898-56827920 GGATTAAATGAGATGATGCATGG + Intronic
1159333794 18:67036656-67036678 GGATGAAAAGATAAGATACAGGG - Intergenic
1159568086 18:70078907-70078929 GGGTCAAAAGATATGATGCATGG + Intronic
1163668077 19:18612392-18612414 GTGTCAAAAGAGAAGATGCCAGG + Intronic
1164110614 19:22154267-22154289 GAGTGAAAACATATGATGCTTGG - Intergenic
925794226 2:7525416-7525438 GGGTTACCAGATATGGTGCAGGG + Intergenic
927544712 2:23942396-23942418 AGGGCCAAAGAGATGATGCAGGG + Intronic
928335428 2:30394062-30394084 GGATCAAACGATAGAATGCACGG + Intergenic
930271086 2:49257528-49257550 GGGTCAAAAGATTTGCTTCTGGG - Intergenic
931087292 2:58846809-58846831 GGATCAAATGATGTGATGTAAGG - Intergenic
932709283 2:74049846-74049868 GGGTGAACAGATATGCTGCCAGG + Intronic
933249614 2:80014494-80014516 GGATCAAATGATATGATATATGG - Intronic
934528608 2:95069802-95069824 GGATCAAATGAGATGATGCAGGG + Intergenic
937746340 2:125420334-125420356 TGGTCAGAAGCTATGTTGCAAGG - Intergenic
939030060 2:137062955-137062977 GTGTCAAAATCTATGAGGCAAGG - Intronic
939680608 2:145127403-145127425 GGGTAAAATGATATGATGTCTGG + Intergenic
943143044 2:184006877-184006899 TGATCAAAAGATATTATGGAAGG + Intergenic
946759879 2:222982943-222982965 GGCTCCAAGGCTATGATGCAAGG - Intergenic
947479418 2:230484674-230484696 CAGTTAAAAGATATAATGCAAGG - Intronic
1169058131 20:2640798-2640820 GGGTCAAAAGTGATGACGGAAGG - Intronic
1169684039 20:8250494-8250516 ATGGCAAAAGATATGATGAAGGG - Intronic
1172479213 20:35261017-35261039 GGGCCAGAAGATAAGAGGCAGGG + Intronic
1174233491 20:49067532-49067554 GGGTGAAATGATATGATGCTTGG - Intronic
1178974328 21:37208670-37208692 GGGACAGAAGAGATGATGGAAGG + Intergenic
1181821837 22:25482387-25482409 GCTTCAAAAGATATGTAGCAGGG - Intergenic
950313987 3:11984245-11984267 GGATTAAATGAGATGATGCATGG + Intergenic
951234354 3:20217361-20217383 AGGTAAAAAGAAATGGTGCAGGG + Intergenic
951851600 3:27147309-27147331 GTGACAGAGGATATGATGCATGG + Intronic
952805645 3:37348695-37348717 GAATCTAAAGCTATGATGCAAGG + Intronic
953390839 3:42532824-42532846 GGATGAAATGACATGATGCATGG - Intronic
954793587 3:53149902-53149924 GGGCCAAAAGTTAAGCTGCATGG - Intergenic
957513669 3:81223382-81223404 GGGTGAAGAGATAAGATGCATGG + Intergenic
958958214 3:100484681-100484703 GGATAAGAGGATATGATGCAAGG - Intergenic
959051399 3:101528033-101528055 GGGTGATAAGATATCATGCATGG + Intergenic
959362366 3:105409464-105409486 GAGTGAAAATATATGATGCTTGG - Intronic
963039149 3:141055986-141056008 AGGTCATAAGAGAAGATGCATGG + Intronic
963392775 3:144689616-144689638 GCTTCAAAATATATGAAGCATGG + Intergenic
963542000 3:146603438-146603460 GGCTCAAAATATTTAATGCATGG - Intronic
963989698 3:151638980-151639002 GGGTCAAAAGTTATGATCAAAGG - Intergenic
965313294 3:167158675-167158697 GGTTGAAAAGAAATGAGGCAAGG + Intergenic
966507719 3:180725819-180725841 GGGTGAAATGATATGATGTCTGG - Intronic
968326075 3:197817751-197817773 GCGTCTAAAGATATAATGTAAGG - Intronic
969231314 4:5833619-5833641 GGATTAAATGAGATGATGCATGG + Intronic
971268239 4:25113359-25113381 GGGTCAAAGAATATGCTCCATGG - Intergenic
972234551 4:37115776-37115798 GGGTCAAAAAAAATGAAGTAAGG + Intergenic
972408866 4:38771795-38771817 GGGCCCAATGATAGGATGCAAGG + Intergenic
976089066 4:81436328-81436350 GTCTCAAAACATATTATGCAAGG - Intronic
978631710 4:110754502-110754524 GGGTAAAAGGAAATGAAGCAAGG + Intergenic
978646505 4:110938968-110938990 GGGTAAAAAGATATAAGGCCAGG + Intergenic
979882093 4:125972123-125972145 GAGTCAAAATTGATGATGCAAGG - Intergenic
981303909 4:143225314-143225336 GTGTGAAAAAAAATGATGCAAGG - Intergenic
984297434 4:177870246-177870268 GGGGCAAAATATTTGAGGCAAGG + Intronic
984559050 4:181246839-181246861 GGGACAAAAGAAATGCTTCAAGG + Intergenic
987750649 5:22034443-22034465 AGGAAAAAACATATGATGCACGG + Intronic
988985197 5:36611934-36611956 GGGTCATAAGATCAGCTGCAAGG + Intronic
992217284 5:74538430-74538452 GGGTCAGGAGACAGGATGCAGGG + Intergenic
994203147 5:97001614-97001636 GGGTCCAAAGATCAGATGCAAGG + Intronic
994729446 5:103474925-103474947 GTCTCAGAAGATATGATGTAAGG - Intergenic
996151396 5:120040182-120040204 GGGTAAAGAGAAGTGATGCAGGG + Intergenic
998933888 5:147213542-147213564 AGGTCATAAGATATGTTCCATGG + Intergenic
1000346987 5:160322452-160322474 AGGTCAAATGATATGATGCCTGG + Intronic
1005134501 6:22552258-22552280 GAGTTAAAAGAGATAATGCAGGG - Intergenic
1007283478 6:40730144-40730166 GGATAAAATGAGATGATGCAGGG + Intergenic
1009601254 6:65803186-65803208 GGGTCCAAAGATAGAATGCTGGG + Intergenic
1010396587 6:75399957-75399979 GGGTGAAATGATAGGATGCCTGG - Intronic
1012642936 6:101644438-101644460 GGATCAAAAGAGATCATGAAGGG + Intronic
1014585891 6:123197339-123197361 GGGTGAAAATCTAGGATGCAAGG + Intergenic
1015199453 6:130562738-130562760 GGATAAAATGATATGATGCCTGG - Intergenic
1015313957 6:131795843-131795865 GGGTAAAAAGATAAGAATCATGG - Intergenic
1017853939 6:158332282-158332304 GGGCCGAAGGAGATGATGCAAGG + Intronic
1025104437 7:56159475-56159497 GGGAGAAAAGAGAAGATGCATGG + Intergenic
1025157101 7:56616914-56616936 GGGTCCTGAGATATGTTGCAGGG + Intergenic
1026425454 7:70288032-70288054 GCCTCTAAAGATATGAGGCATGG + Intronic
1028344059 7:89758665-89758687 GGGTGATAAGATATTAAGCATGG + Intergenic
1029995310 7:105001708-105001730 GTGTCATCAGATATGATGCTGGG - Intergenic
1030490480 7:110227019-110227041 GTGACAAAAGAAATGGTGCAGGG - Intergenic
1030711525 7:112755867-112755889 AGTTCTAAAGAAATGATGCATGG - Intergenic
1030995878 7:116357845-116357867 GGGTAAAAGGATATGACTCACGG + Intronic
1033790207 7:144783502-144783524 GGGTAAAAAGAAAAGATGTAGGG - Intronic
1034823726 7:154240972-154240994 GGGTCAAAAGGTGTGATTTAAGG + Intronic
1039209932 8:35202548-35202570 AGGTCAAAAGACATGGTGGAAGG + Intergenic
1046678348 8:117137976-117137998 GGGTAAAAAAATATGGTTCATGG - Intronic
1046992565 8:120476115-120476137 GTGACAAAAGAAATCATGCATGG - Intronic
1055621332 9:78127844-78127866 GGGTCAGAAGAGATGATGATGGG + Intergenic
1055796084 9:79976198-79976220 TAGTCAACAGATTTGATGCATGG + Intergenic
1056218464 9:84428133-84428155 GGTTCAAATGATGTGATGCCTGG - Intergenic
1058166928 9:101630423-101630445 GGATCAAAGGAGATAATGCACGG - Intronic
1059533281 9:115057774-115057796 TGGTCAAAAGATATGAGTCCTGG + Intronic
1059625164 9:116056178-116056200 GAGTCAAAAAATATGATACTTGG + Intergenic
1060472565 9:123960744-123960766 AGTTCAAATGAGATGATGCATGG + Intergenic
1188090433 X:25957682-25957704 GGGTAAAATGATATGATGTCTGG - Intergenic
1189859358 X:45257358-45257380 GGATGAAATGAGATGATGCAGGG + Intergenic
1189912713 X:45827352-45827374 GGATTAAAAGAAATGATGTATGG - Intergenic
1192026083 X:67453810-67453832 AGGTCAAAAGATATTAGGCAGGG + Intergenic
1193139730 X:78015151-78015173 TAGTCAAATGCTATGATGCATGG - Intronic
1194829874 X:98609549-98609571 TGGGCTAAAGATATGATGGAAGG - Intergenic
1195832829 X:109078243-109078265 GGGTGAAAAGAAATGATACCAGG - Intergenic
1198162277 X:134019510-134019532 GGCTCAAAGGAGATGATGAAAGG - Intergenic
1201667766 Y:16478312-16478334 GGCTCAAAAGGTCAGATGCAGGG + Intergenic
1202270845 Y:23072732-23072754 GGGTCCTGAGATATGTTGCAAGG - Intergenic
1202295181 Y:23347950-23347972 GGGTCCTGAGATATGTTGCAAGG + Intergenic
1202423840 Y:24706476-24706498 GGGTCCTGAGATATGTTGCAAGG - Intergenic
1202446949 Y:24963609-24963631 GGGTCCTGAGATATGTTGCAAGG + Intergenic