ID: 1159575878

View in Genome Browser
Species Human (GRCh38)
Location 18:70176737-70176759
Sequence GATGCTTGTGCACCACAGAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159575878_1159575882 13 Left 1159575878 18:70176737-70176759 CCATTCTGTGGTGCACAAGCATC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1159575882 18:70176773-70176795 CCAAACTGATACTACTTTTATGG 0: 1
1: 0
2: 1
3: 11
4: 129
1159575878_1159575883 23 Left 1159575878 18:70176737-70176759 CCATTCTGTGGTGCACAAGCATC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1159575883 18:70176783-70176805 ACTACTTTTATGGTAGCACATGG 0: 1
1: 0
2: 2
3: 12
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159575878 Original CRISPR GATGCTTGTGCACCACAGAA TGG (reversed) Exonic
900666241 1:3817386-3817408 GATACTGGTCCACCAGAGAATGG - Intronic
901843742 1:11969503-11969525 GATGCTTGTGCTCCAGTGACAGG + Intronic
903943332 1:26946423-26946445 GAGGCCTGTGCCCCAGAGAAAGG - Exonic
909468543 1:76001315-76001337 CCTGCTTGTGCACTCCAGAATGG + Intergenic
912463323 1:109852054-109852076 GATGCTGGTGACCCACAGATGGG - Intergenic
916680935 1:167104462-167104484 GATGCTTGCTCGCCACAGGAAGG - Intronic
919196210 1:194289881-194289903 TATGCATAAGCACCACAGAAAGG - Intergenic
919902840 1:202056901-202056923 GGTGCTTGAGGAACACAGAAGGG - Intergenic
921971443 1:221153528-221153550 CATGCTTCTGCACCACAGCCTGG - Intergenic
922115355 1:222607914-222607936 TCTGCTAGGGCACCACAGAAGGG - Intergenic
1064384208 10:14876880-14876902 GATGTTTGTGCAACACCTAAGGG + Intergenic
1064918632 10:20490409-20490431 GATGCTTGTGCACAGGGGAAGGG + Intergenic
1068141338 10:53011798-53011820 GATGTCTGTGAACCACTGAATGG - Intergenic
1068147408 10:53088915-53088937 GATGCTGGGTCACCAAAGAATGG + Intergenic
1070824514 10:79382923-79382945 GACGCTGGTGGACCACAGAGGGG + Exonic
1075240998 10:120778805-120778827 GAAGCTTATGCACTACAAAAGGG - Intergenic
1076003444 10:126930138-126930160 AATGCTATTCCACCACAGAAAGG - Intronic
1078878400 11:15422115-15422137 GATGCGTGTGAATCAGAGAAGGG + Intergenic
1082833125 11:57634109-57634131 GATGTTTGTGGACAACAGACGGG + Intergenic
1086922968 11:92608178-92608200 GATACTTGTTCACAACAAAAAGG - Intronic
1088266474 11:107992542-107992564 GATGATTCTGTACCACAGAAGGG - Intergenic
1089015418 11:115161412-115161434 AATGCAGGTGCAGCACAGAAAGG + Intergenic
1090483177 11:127086091-127086113 GATGCTAGGTCACCAAAGAATGG - Intergenic
1098476760 12:70913480-70913502 GATAGTTGTCCACTACAGAATGG - Intronic
1105943201 13:25169735-25169757 GTTGCTGGTGCACCACGGGATGG + Exonic
1106144072 13:27036268-27036290 GACGCGTGTGGATCACAGAAGGG - Intergenic
1106978506 13:35250999-35251021 GATGCATGTGGACATCAGAATGG + Intronic
1107043420 13:35972190-35972212 GATGTTTGAGAGCCACAGAAAGG - Intronic
1107824565 13:44316682-44316704 CATGCATGTGCACCAGAGATGGG + Intergenic
1108483915 13:50905840-50905862 GATGCTTGTGGAGAACAGGATGG + Intergenic
1110361579 13:74631188-74631210 GATTCTTGTGCACCTCAGGTAGG + Intergenic
1113612837 13:111659897-111659919 GAGGGGTGTGCTCCACAGAAAGG + Intronic
1115017178 14:28632074-28632096 GATGATTGTGCACCATAGGATGG + Intergenic
1115449773 14:33533420-33533442 GATGCTTTTGCTTCACAGATTGG + Intronic
1115698376 14:35924392-35924414 CATGCCTGTCCACCACAGAGGGG - Intronic
1116655997 14:47654588-47654610 GATGCTGGGTCACCAGAGAATGG + Intronic
1121197569 14:92087722-92087744 AATGCTTGGGCCCCACAGTAGGG + Intronic
1127795788 15:62437247-62437269 GATGAATGTGCTCCTCAGAAAGG - Intronic
1128226943 15:66008492-66008514 GATGCTTCTGCCCCTCAGGAGGG + Intronic
1131319885 15:91377208-91377230 GAAGCTAGTGTACCACAGGATGG - Intergenic
1132032753 15:98451798-98451820 AATGCTTCTGCACGACACAAGGG + Intronic
1132261345 15:100427621-100427643 GATGTTTGTGCAGCACACAAGGG - Intronic
1139169100 16:64609599-64609621 GATGCATGTGCAGAACATAAAGG + Intergenic
1141298185 16:82789566-82789588 TATCCTTGTGCAGCCCAGAATGG - Intronic
1141758836 16:86013456-86013478 TCTGCTTTTGGACCACAGAAAGG + Intergenic
1141818597 16:86429984-86430006 GCTGCTTGTGACCCCCAGAAGGG - Intergenic
1148567084 17:48639806-48639828 GGTGGTTGTGCAGCACAGAGAGG + Intergenic
1154306174 18:13232498-13232520 GAGGCTTGTGGAGCACAGCACGG - Intronic
1154306191 18:13232574-13232596 GAGGCTTGTGGAGCACAGCACGG - Intronic
1159549935 18:69884314-69884336 GATGTTGGTGTTCCACAGAATGG + Intronic
1159575878 18:70176737-70176759 GATGCTTGTGCACCACAGAATGG - Exonic
1160218572 18:76956086-76956108 GGTGCTCATGCACCACAGCAAGG + Exonic
1163419680 19:17206963-17206985 GATGCTTCCGCAGCACAGAGAGG - Intronic
1167106952 19:47435980-47436002 GCTCCTTGTGGACCACAGTAGGG - Intronic
1168408771 19:56125372-56125394 GATGCTGATGCACCCCTGAAAGG - Intergenic
1168499449 19:56881051-56881073 GATGTTTGAGCAGCACGGAAGGG - Intergenic
926080772 2:9984382-9984404 GATGCATGTGCACCACATAGTGG - Intronic
928696362 2:33853632-33853654 AATGGTTTTGCACAACAGAATGG - Intergenic
929273405 2:39999315-39999337 GATGCTTGCTCACGACAGAATGG - Intergenic
936120254 2:109736214-109736236 GAGGCTAGAGAACCACAGAAGGG - Intergenic
937386414 2:121437754-121437776 GATGATTGTGCAGGACATAAAGG - Intronic
937600437 2:123725137-123725159 GATGCTTGTGAACAAAGGAAAGG - Intergenic
939547904 2:143576183-143576205 GATGCTTATGTGCCACTGAAGGG + Intronic
940340017 2:152570497-152570519 GATGCTTGTACACAAAAGAAGGG - Intronic
942176042 2:173335548-173335570 CACCCTTGTGCACCAAAGAAAGG + Intergenic
943972165 2:194424498-194424520 TATACTTATGCACCATAGAAGGG + Intergenic
1168745074 20:232486-232508 GAAGTTTTTGCACAACAGAAAGG + Intergenic
1168941106 20:1712080-1712102 GCTGCCTGTGCTGCACAGAAGGG - Intergenic
1169340586 20:4793499-4793521 TATACTTCTGAACCACAGAATGG + Intronic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
953648772 3:44780151-44780173 GATTCTAGTGCACCACAGCCTGG + Intronic
955379047 3:58422140-58422162 GAAGCTTGTGGACCATGGAAAGG + Intronic
957506316 3:81125588-81125610 GATGGTGCTGCACAACAGAAAGG + Intergenic
959502814 3:107126156-107126178 GAGCATTGTGCACCACATAAAGG + Intergenic
961486750 3:127222220-127222242 GGTGCTTGTGCACCACATTGGGG - Intergenic
962257297 3:133881137-133881159 GATGCTTGGGCACCAGGGCAAGG + Intronic
963231315 3:142911094-142911116 TATACTTTTGAACCACAGAATGG + Intergenic
965847032 3:172975219-172975241 CATGCTTGTGAACCACAACATGG + Intronic
970904378 4:21198780-21198802 GCTTCTTCTGCAGCACAGAAAGG + Intronic
975059924 4:69985053-69985075 GATGCACCTGCACCCCAGAAAGG + Intergenic
976045246 4:80938850-80938872 GATTTTTGTTCACCAGAGAAAGG + Intronic
978729391 4:112007308-112007330 GATGCTGGTGGATCACAAAATGG + Intergenic
979001336 4:115224379-115224401 GATGCTTAGGGACGACAGAAAGG + Intergenic
980095235 4:128483180-128483202 GTTGCTTGTTCACCTCTGAATGG + Intergenic
980513199 4:133820886-133820908 GATTTTTGTCCACCACAAAAAGG - Intergenic
982024904 4:151242348-151242370 GATGCATATGGCCCACAGAATGG - Intronic
982288509 4:153758633-153758655 GGGGCTTGTGTACCACAAAATGG - Intronic
985004890 4:185524318-185524340 GATCCTTCTGTACCACAGCACGG + Intronic
985987058 5:3524613-3524635 GATGCTTGTGAAACAATGAATGG - Intergenic
997267074 5:132501171-132501193 GATGCTTGGGCACAGCAGGAAGG + Intergenic
1000960178 5:167591717-167591739 GGGGCTTGTGTACCACAGAAAGG + Intronic
1002947992 6:1781027-1781049 GATGCTTTTACAACACAGATTGG - Intronic
1003574747 6:7282463-7282485 GCTGCTTGTGGTCCACACAAGGG - Exonic
1004331000 6:14720954-14720976 GATATTTGTGCACCACAGCTGGG + Intergenic
1005771024 6:29071681-29071703 TATGCTTTTGTACCACACAATGG - Intronic
1007451822 6:41945917-41945939 GATGCATGTTCATAACAGAAAGG - Intronic
1009396239 6:63203698-63203720 TCTGCTTGGGCAGCACAGAAGGG - Intergenic
1009633165 6:66226280-66226302 GATGTCTGGGCACCACAGAGTGG - Intergenic
1010456104 6:76057381-76057403 GGTGCTTGTGCACCAGAGGTTGG + Intronic
1010634709 6:78243492-78243514 GATGCCTGGGGACCACACAATGG + Intergenic
1014942955 6:127465040-127465062 AATGCTTGTCCACCACAAGAGGG + Intronic
1017539472 6:155385455-155385477 GCTGCTTTTGCACCCCAGACTGG + Intergenic
1020603944 7:10311266-10311288 CATGATTGTGCTCCAAAGAAGGG - Intergenic
1023135832 7:37050463-37050485 AAGGCTTGTGCACCATAGCAGGG - Intronic
1027513747 7:79115228-79115250 GATGCTTTGGGACCAGAGAAAGG + Intronic
1029223193 7:99006487-99006509 AATGCTTGGTCAGCACAGAATGG + Intronic
1032808531 7:135383681-135383703 GATGATTGAGAACCAGAGAAAGG - Intronic
1037953663 8:23036457-23036479 GATGGTTCTGCACCACATACAGG + Intronic
1039010751 8:33090279-33090301 TCTGCATGTGCACCACAGACTGG + Intergenic
1043992872 8:86777756-86777778 GATGCTTGGTGATCACAGAATGG + Intergenic
1044409735 8:91869451-91869473 GATGCCTATGAACCAAAGAATGG + Intergenic
1049996443 9:1039343-1039365 GTGACTTTTGCACCACAGAAGGG - Intergenic
1050164282 9:2747909-2747931 AATGCTTGTTAAACACAGAAAGG + Intronic
1051760831 9:20462053-20462075 GATGCTTGTGCAGAACAGTTTGG - Intronic
1056829862 9:89907070-89907092 GATGCTGGTGACCCACAGATGGG - Intergenic
1059674632 9:116526216-116526238 TATGCATGTGCACCACATTATGG + Intronic
1059825425 9:118023201-118023223 CAAGTTTGTGGACCACAGAAAGG + Intergenic
1061665067 9:132155945-132155967 GCTGCCTGTGCACCTCACAAAGG - Intergenic
1061895518 9:133644890-133644912 GATGCTGGTGCAACAGAGAGAGG - Intronic
1192708770 X:73557787-73557809 GAAATTTGTCCACCACAGAAAGG + Intergenic
1195364771 X:104115303-104115325 GATGCTTCTGAGCCACAGTAAGG + Exonic
1195930176 X:110066611-110066633 GATGTTTGAGCACCACTGCATGG + Intronic
1196047070 X:111267651-111267673 GTGGCTTGTGAACCACAGACAGG - Intronic