ID: 1159580983

View in Genome Browser
Species Human (GRCh38)
Location 18:70234612-70234634
Sequence CCTCCTCCTGTCTCATGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159580983_1159580993 12 Left 1159580983 18:70234612-70234634 CCAGCCCATGAGACAGGAGGAGG No data
Right 1159580993 18:70234647-70234669 GGGGACTGATTCTAAAACTAGGG No data
1159580983_1159580994 22 Left 1159580983 18:70234612-70234634 CCAGCCCATGAGACAGGAGGAGG No data
Right 1159580994 18:70234657-70234679 TCTAAAACTAGGGCATGAGCAGG No data
1159580983_1159580989 -8 Left 1159580983 18:70234612-70234634 CCAGCCCATGAGACAGGAGGAGG No data
Right 1159580989 18:70234627-70234649 GGAGGAGGAAGGAATCCATAGGG No data
1159580983_1159580990 -7 Left 1159580983 18:70234612-70234634 CCAGCCCATGAGACAGGAGGAGG No data
Right 1159580990 18:70234628-70234650 GAGGAGGAAGGAATCCATAGGGG No data
1159580983_1159580988 -9 Left 1159580983 18:70234612-70234634 CCAGCCCATGAGACAGGAGGAGG No data
Right 1159580988 18:70234626-70234648 AGGAGGAGGAAGGAATCCATAGG No data
1159580983_1159580992 11 Left 1159580983 18:70234612-70234634 CCAGCCCATGAGACAGGAGGAGG No data
Right 1159580992 18:70234646-70234668 AGGGGACTGATTCTAAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159580983 Original CRISPR CCTCCTCCTGTCTCATGGGC TGG (reversed) Intergenic
No off target data available for this crispr