ID: 1159585104

View in Genome Browser
Species Human (GRCh38)
Location 18:70276644-70276666
Sequence TTACCTCCAAGGGTTTCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159585104_1159585108 27 Left 1159585104 18:70276644-70276666 CCCTGAGAAACCCTTGGAGGTAA No data
Right 1159585108 18:70276694-70276716 CTCTCCACCTAACTCTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159585104 Original CRISPR TTACCTCCAAGGGTTTCTCA GGG (reversed) Intergenic