ID: 1159586899

View in Genome Browser
Species Human (GRCh38)
Location 18:70289723-70289745
Sequence CTTCAGCCGCAGAGCAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 7, 3: 33, 4: 234}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159586899_1159586910 20 Left 1159586899 18:70289723-70289745 CCGGGGCTGCTCTGCGGCTGAAG 0: 1
1: 0
2: 7
3: 33
4: 234
Right 1159586910 18:70289766-70289788 ACTCACCCGGGTGTAGGGACCGG 0: 1
1: 0
2: 1
3: 9
4: 121
1159586899_1159586909 15 Left 1159586899 18:70289723-70289745 CCGGGGCTGCTCTGCGGCTGAAG 0: 1
1: 0
2: 7
3: 33
4: 234
Right 1159586909 18:70289761-70289783 TGCGCACTCACCCGGGTGTAGGG 0: 1
1: 0
2: 0
3: 2
4: 44
1159586899_1159586913 30 Left 1159586899 18:70289723-70289745 CCGGGGCTGCTCTGCGGCTGAAG 0: 1
1: 0
2: 7
3: 33
4: 234
Right 1159586913 18:70289776-70289798 GTGTAGGGACCGGACGATTGTGG 0: 1
1: 0
2: 0
3: 2
4: 22
1159586899_1159586905 7 Left 1159586899 18:70289723-70289745 CCGGGGCTGCTCTGCGGCTGAAG 0: 1
1: 0
2: 7
3: 33
4: 234
Right 1159586905 18:70289753-70289775 CGGCCGGCTGCGCACTCACCCGG 0: 1
1: 0
2: 1
3: 7
4: 102
1159586899_1159586908 14 Left 1159586899 18:70289723-70289745 CCGGGGCTGCTCTGCGGCTGAAG 0: 1
1: 0
2: 7
3: 33
4: 234
Right 1159586908 18:70289760-70289782 CTGCGCACTCACCCGGGTGTAGG 0: 1
1: 0
2: 0
3: 4
4: 90
1159586899_1159586902 -9 Left 1159586899 18:70289723-70289745 CCGGGGCTGCTCTGCGGCTGAAG 0: 1
1: 0
2: 7
3: 33
4: 234
Right 1159586902 18:70289737-70289759 CGGCTGAAGGTGCCGCCGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 86
1159586899_1159586906 8 Left 1159586899 18:70289723-70289745 CCGGGGCTGCTCTGCGGCTGAAG 0: 1
1: 0
2: 7
3: 33
4: 234
Right 1159586906 18:70289754-70289776 GGCCGGCTGCGCACTCACCCGGG 0: 1
1: 0
2: 1
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159586899 Original CRISPR CTTCAGCCGCAGAGCAGCCC CGG (reversed) Intronic
900928518 1:5720986-5721008 CTTCAGTGACAGCGCAGCCCAGG + Intergenic
901506526 1:9689259-9689281 CCTGAGCCCCAGAGCAGCCGCGG - Intronic
902331286 1:15732291-15732313 CTTCTGGTGCAGACCAGCCCTGG + Intronic
903617823 1:24675017-24675039 TTTCAGCCTCAGAGATGCCCAGG - Intergenic
903882039 1:26517147-26517169 ATACAGCAGCAGAGCAGCCTAGG - Intergenic
903906699 1:26693047-26693069 CTCCAGCGGCAGAGCAGCCAAGG - Intergenic
903914359 1:26752690-26752712 CTTCAGCATGAGAGCAGCCTAGG + Intronic
904213397 1:28900664-28900686 CTTTAGCCTCAGGACAGCCCGGG - Intronic
905003185 1:34689501-34689523 CTTAAGTTGCAGAACAGCCCAGG + Intergenic
905123661 1:35702271-35702293 ATTCAGCCTCACAGCAGCCCCGG + Intergenic
905920168 1:41714043-41714065 GTCCAGCTGCTGAGCAGCCCTGG - Intronic
907300485 1:53483771-53483793 CTGCAGCCTCACAGCAGCCCAGG - Intergenic
907501896 1:54887183-54887205 CTACAGGCGCAGAGCGGGCCAGG - Exonic
907512701 1:54973530-54973552 CAGCAGCCGCAGAATAGCCCTGG + Intergenic
913088281 1:115458870-115458892 CTTTATCCGCATAACAGCCCAGG + Intergenic
913266356 1:117048969-117048991 CTTGAGCCTCAGAGCAGAGCTGG - Intergenic
913484007 1:119316995-119317017 CTTCAGCCGCAGAGAGACTCTGG - Intergenic
915209910 1:154300789-154300811 CTCCATAAGCAGAGCAGCCCCGG - Intergenic
915513909 1:156401820-156401842 CTCCAGCTGCAGGGCAGCCTGGG - Intergenic
915681540 1:157586360-157586382 CTTCAGCCACGGAGCAGACAAGG + Exonic
915713726 1:157925136-157925158 CTTCAGCCACGGAGCAGACAAGG - Intergenic
915859527 1:159429489-159429511 CTTCAACCACGGAGCAGTCCAGG + Intergenic
916092057 1:161314968-161314990 CTGCTGCCCCAGAGCAACCCGGG + Intronic
916470794 1:165120194-165120216 CCTCAGGCTCTGAGCAGCCCGGG - Intergenic
920334907 1:205238525-205238547 CTTCAGCTGCAGGACAGCTCAGG + Intronic
920689144 1:208132346-208132368 CTGCAGCCACAGGGCAGCCAGGG + Intronic
921162639 1:212483985-212484007 GTTCAGCGGCAGGGCAGGCCTGG + Intergenic
923562139 1:235049432-235049454 CACCAGCCCCAGTGCAGCCCTGG - Intergenic
923857109 1:237857195-237857217 CTGCAGCATCAGAGAAGCCCAGG - Intergenic
1063722006 10:8593604-8593626 CTTCAAACGCAGAGTCGCCCAGG + Intergenic
1065952894 10:30668024-30668046 CTTCAGGCTCAGAGCAGTCAGGG - Intergenic
1067090228 10:43262674-43262696 CGGCTGCTGCAGAGCAGCCCCGG + Intronic
1067684297 10:48457721-48457743 CTTTAGCAGAAGAGAAGCCCAGG + Intronic
1069426266 10:68291189-68291211 CTGCAGGGCCAGAGCAGCCCTGG - Intronic
1072634563 10:97169581-97169603 CTTAAGCCCCAGGGCAGCCAGGG + Intronic
1072725709 10:97812097-97812119 CTTCTGCCTGAGAGCACCCCTGG + Intergenic
1073073093 10:100807151-100807173 CTGCAGACACTGAGCAGCCCAGG + Intronic
1073516347 10:104078890-104078912 CTTCAACCTCAGACCAGGCCTGG - Intronic
1075747283 10:124736650-124736672 CTTCAGCCAGAGGGCAGCCTGGG + Intronic
1076658194 10:132037866-132037888 CTACAGCCCCAGAGCAGCCCTGG - Intergenic
1076734963 10:132454711-132454733 CCTCAGAACCAGAGCAGCCCTGG + Intergenic
1076990102 11:268294-268316 CCCCAGCCCCACAGCAGCCCAGG + Intergenic
1077295404 11:1824060-1824082 CTGCAGGCGCTGGGCAGCCCTGG + Intergenic
1078093732 11:8283811-8283833 CTTCAGGAGCAGAGCATCCTGGG + Intergenic
1078598971 11:12714204-12714226 CCTTAGCCAAAGAGCAGCCCTGG - Intronic
1079107235 11:17579362-17579384 CTTCAGTCTCAGAGCATCCATGG + Intronic
1081664003 11:44905904-44905926 CTCCAGCCACAGAACAGACCAGG - Intronic
1084320391 11:68370300-68370322 GTCCAGGCCCAGAGCAGCCCTGG + Intronic
1084804841 11:71571637-71571659 CATCAGCCTCAGAGAAGCCATGG + Intergenic
1084805613 11:71576886-71576908 CATCAGCCTCAGAGAAGCCATGG - Intergenic
1087651190 11:100870419-100870441 CTTCTGCAGCAGGGCAGCCAGGG - Intronic
1090233263 11:125125824-125125846 CTTCTGCCCCAGAACAGCCCTGG + Intergenic
1091201244 11:133782588-133782610 CTTGGGCCGCACAGGAGCCCAGG - Intergenic
1091453061 12:585604-585626 ACTCATCCGCAGAGCAGGCCAGG - Intronic
1093652595 12:21661817-21661839 CTTGAGCCGCACAGGAGCCCAGG - Intronic
1094628653 12:32150641-32150663 CTTGTGCCACACAGCAGCCCTGG - Intronic
1095300863 12:40582089-40582111 GATCAGCAGCAGTGCAGCCCTGG + Intergenic
1100330116 12:93573435-93573457 CTGCAGCCGCAGCTCCGCCCGGG - Intronic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1104860647 12:131921646-131921668 CTCTAGCCCCAGGGCAGCCCCGG + Exonic
1108858916 13:54829571-54829593 CTCCAGCTGCACAGGAGCCCGGG + Intergenic
1110273451 13:73616789-73616811 GTTCACCCGCAGAGCATCCTGGG - Intergenic
1111940514 13:94602011-94602033 CTTCAGCAGCACCGCGGCCCAGG + Exonic
1112379571 13:98875933-98875955 CTTCAGCAGGAGTGCAGCACTGG + Intronic
1113507325 13:110826227-110826249 CTTGGGCAGCAGAGCAGCCATGG - Intergenic
1113950082 13:114066875-114066897 CCTCAGCCCCAGAGCACCCCAGG - Intronic
1113950243 13:114067279-114067301 CCTCAGCCCCAGAGTACCCCAGG - Intronic
1116789132 14:49320831-49320853 CTTCAGGGGCAAAGTAGCCCTGG - Intergenic
1117279192 14:54220606-54220628 CTCCAGCCCCAGCGAAGCCCCGG - Intergenic
1121146367 14:91586322-91586344 CTTTGGCCCAAGAGCAGCCCTGG - Intronic
1121704605 14:95982153-95982175 CATCAGCAGCAGTGCTGCCCTGG + Intergenic
1122052179 14:99067615-99067637 CCTCAGCCCCAGACCAGACCAGG + Intergenic
1122907818 14:104810317-104810339 CTGCATCCCCAGAGCAGACCGGG + Intergenic
1122942168 14:104986278-104986300 CGTCAGCCACTGGGCAGCCCGGG + Exonic
1123105306 14:105838704-105838726 CTTCCTCCTCACAGCAGCCCAGG + Intergenic
1124226987 15:27903132-27903154 CTCCAGCCTCACAGCAGCCCAGG - Intronic
1124700770 15:31909994-31910016 CTCCACCCACTGAGCAGCCCAGG - Intergenic
1126423312 15:48498812-48498834 CTTCAGTGGCAGAGCAGCCGGGG - Intronic
1128250051 15:66157536-66157558 CTTTAGCCCCACAGCAGCCCTGG + Intronic
1129153354 15:73702857-73702879 CCTCAGCCTCAGGGTAGCCCTGG - Exonic
1129153667 15:73704261-73704283 CCTCAGCCTCAGGGTAGCCCCGG - Exonic
1129539241 15:76337766-76337788 CTTCCCCGGCAGAGAAGCCCGGG + Exonic
1130922932 15:88364412-88364434 CTTCAGCCGGAGAGCAGCATAGG + Intergenic
1132601559 16:775228-775250 CTTCATCCGCCGTGCCGCCCAGG - Exonic
1133054922 16:3141110-3141132 CTTCAGCCGCAGCGCCTACCTGG + Exonic
1133754448 16:8752014-8752036 CTTCTGCTGCAGAAGAGCCCGGG + Intronic
1134046535 16:11104937-11104959 GTTCAGCAGCCCAGCAGCCCAGG - Intronic
1135166872 16:20147142-20147164 CATGAGGCACAGAGCAGCCCAGG + Intergenic
1138136782 16:54530285-54530307 CTTCTGCAGAAGAGCAGCACAGG - Intergenic
1140309025 16:73831352-73831374 CTGCAGGGTCAGAGCAGCCCTGG + Intergenic
1141694505 16:85613288-85613310 CTGCCGCCGCCGAGCAGCCCCGG + Exonic
1142345871 16:89553735-89553757 CTGCAGGCGCAGAGCAGTGCTGG - Intronic
1142383080 16:89745028-89745050 CTCCACCGGCAGAGCAGCACAGG + Exonic
1142387583 16:89775754-89775776 CTTCAGCAGCAGAGCAGGCCTGG + Exonic
1143126566 17:4645018-4645040 CTTCAGAAGAAGAGGAGCCCAGG + Intergenic
1144777965 17:17794312-17794334 CTTCTGCGGCACAGCAGCCTTGG - Exonic
1144945049 17:18965524-18965546 CTTCAGCCTCAGACACGCCCTGG + Intronic
1145765436 17:27456046-27456068 CCTCAGCTGCAGCCCAGCCCTGG - Intergenic
1146373582 17:32280247-32280269 GACCAGCCCCAGAGCAGCCCCGG + Intronic
1147320097 17:39640794-39640816 CTGCACCCGCAGAGCCTCCCCGG + Intronic
1147668913 17:42165552-42165574 CTGCAGCAGCTGAGCAGCCGAGG - Exonic
1148018838 17:44540337-44540359 CTTCAGCCTCAGGGCATCCGTGG - Intergenic
1149530620 17:57392039-57392061 CTGCAGATGCAGAGCAGCCTGGG + Intronic
1150715623 17:67570341-67570363 CCTCAGCAGCAGAGCAGGTCAGG + Intronic
1152945141 17:83194037-83194059 CTTCAGAGAAAGAGCAGCCCAGG + Intergenic
1153675223 18:7451103-7451125 CTTCAGCCGCACATCAGCTGTGG - Intergenic
1153688092 18:7566840-7566862 CCGCAGCCGCCGAGCAGCGCAGG + Exonic
1153994535 18:10428860-10428882 CTCCTGCCGCAGAGCAGGACTGG + Intergenic
1154383171 18:13870539-13870561 CTTGGGAAGCAGAGCAGCCCAGG - Intergenic
1155932816 18:31724585-31724607 ATTCAGCTGGAGAGCTGCCCCGG + Intergenic
1157201573 18:45664187-45664209 ATTCATCTGCAGAGCAGCCTGGG + Intronic
1157300276 18:46474222-46474244 CTTCAGGCACAGATCAGCCCTGG + Intergenic
1159394456 18:67838251-67838273 CTTCAGAATCAGAGCAGCACTGG + Intergenic
1159586899 18:70289723-70289745 CTTCAGCCGCAGAGCAGCCCCGG - Intronic
1160989999 19:1856621-1856643 CAAGAGGCGCAGAGCAGCCCTGG + Intronic
1161059433 19:2207698-2207720 CCTCAGCCGCAGGGCCGTCCTGG + Intronic
1161443368 19:4304859-4304881 CCTCAGCCGCAGAGCAGCTGGGG - Intronic
1161496846 19:4591211-4591233 CTGCAGTCGCAGAGCAGGCTGGG - Intergenic
1164208306 19:23075602-23075624 CTGCGGGCGCAGAGCTGCCCAGG - Intronic
1164400179 19:27896668-27896690 CTGCAGCCTCAGAGCAGCCCAGG - Intergenic
1164404995 19:27936665-27936687 CTGCAGGCGCAGTGAAGCCCTGG + Intergenic
1164578116 19:29417887-29417909 CTCCAGCCGCTGACCAGCACAGG + Intergenic
1164633343 19:29775762-29775784 CTTCAGGAGCAGAGAGGCCCGGG - Intergenic
1166111450 19:40625770-40625792 CTTCCCCTGCTGAGCAGCCCAGG - Intronic
1166253435 19:41586366-41586388 GTTCAGTCCCAGAGTAGCCCTGG + Intronic
1166257938 19:41619475-41619497 GTTCAGCCCCAGAGAAGCCCTGG - Intronic
1166283746 19:41811070-41811092 GTTCAGCCCCAGAGCAGCCCTGG + Intronic
1166410590 19:42553642-42553664 GTTCAGCATCAGAGCAGCCCTGG - Intronic
1166625921 19:44356091-44356113 CTCCAGCTGCAGAGTATCCCTGG - Intronic
1168048414 19:53810551-53810573 TTTCTGCCTCAGAGAAGCCCAGG + Exonic
925040764 2:731784-731806 CATCAACCCCAGAGCACCCCCGG - Intergenic
925062432 2:903601-903623 CTTCAGAGGCAAAGCAGCTCTGG + Intergenic
926452675 2:13024670-13024692 CTTCAGGTGCAGACCAGCCCTGG - Intergenic
926774997 2:16413352-16413374 AGGCAGCCGCAGAACAGCCCAGG + Intergenic
927706102 2:25297394-25297416 CATCAGCCTCTCAGCAGCCCTGG - Intronic
932462399 2:71891431-71891453 CAGCACCCGCAGAGAAGCCCTGG + Intergenic
935351611 2:102155689-102155711 CTTCTGCCCCAGAGCTGCTCTGG - Intronic
938171739 2:129084101-129084123 ATTTAGAAGCAGAGCAGCCCCGG - Intergenic
938547525 2:132348057-132348079 CTCCAGCTGCAGAGTATCCCTGG + Intergenic
941902983 2:170695345-170695367 GGGCAGCTGCAGAGCAGCCCTGG + Intergenic
946470881 2:219959915-219959937 CTCCAGCCACGGAGCAGTCCTGG - Intergenic
946865645 2:224039250-224039272 CTGCAGACGCCGCGCAGCCCGGG + Intronic
947868512 2:233418731-233418753 CTGCAGCCTCAGAGCAGCTTTGG - Intronic
949062765 2:241970596-241970618 CTTCAGCCACACAGCAGCCTAGG - Intergenic
1170513276 20:17101442-17101464 CTTCAGAAGGAGTGCAGCCCTGG + Intergenic
1171876391 20:30580812-30580834 CTCCAGCTGCAGAGTATCCCTGG + Intergenic
1172224686 20:33297459-33297481 ATGCAGCCCCACAGCAGCCCCGG - Intronic
1175210820 20:57353271-57353293 TTTGATCCCCAGAGCAGCCCTGG + Intronic
1175733810 20:61371728-61371750 CATCACGCACAGAGCAGCCCTGG + Intronic
1175782298 20:61690410-61690432 CCTCAGCCCCAGGGTAGCCCAGG + Intronic
1175894268 20:62329151-62329173 CATCAGCCACTGCGCAGCCCAGG - Exonic
1176069086 20:63216668-63216690 CTTCAGCCGCAGCGGAGCCCTGG + Intergenic
1176127864 20:63484014-63484036 CTTCAGCCAGACAGCAGCCCAGG + Intergenic
1179021570 21:37645662-37645684 CCGCAGCCCCAGAGCAGCCTAGG - Intronic
1180848045 22:18995112-18995134 CTTGAGCTACAGCGCAGCCCTGG - Intergenic
1180931782 22:19597037-19597059 CGTCCCCTGCAGAGCAGCCCTGG + Intergenic
1181474670 22:23160898-23160920 CTTCAGCCGCGTAGCCGCCCTGG + Exonic
1181563142 22:23717251-23717273 CAGCAGCCGGAGAGCCGCCCAGG + Intergenic
1181993374 22:26855490-26855512 CTCCAGCCACAGAGGCGCCCTGG - Intergenic
1182993984 22:34796093-34796115 TTTCACCGTCAGAGCAGCCCCGG + Intergenic
1184357577 22:43992766-43992788 TATCAGCAGCAGAGCAGCCCAGG - Intronic
1184556027 22:45233564-45233586 CTTCAGCTGCAGAACAGCCCGGG + Intronic
1184732358 22:46377898-46377920 CTTGAGCCACAGTGCAACCCCGG + Intronic
1184924963 22:47630356-47630378 CTTCAGCCACAGAGGTGGCCAGG + Intergenic
1185117517 22:48946090-48946112 CTTCACCCCCAGACCAGACCTGG + Intergenic
1185136335 22:49075307-49075329 CTTCAGCCCCAGTCCAGCCACGG + Intergenic
1185210902 22:49569993-49570015 CGTCCCCTGCAGAGCAGCCCTGG - Intronic
950406902 3:12810406-12810428 CTTGGGCCGCAGTGCAGCCAGGG + Intronic
950726709 3:14921658-14921680 CTTCATCCCCACAGCAGCCCTGG + Intronic
950966686 3:17151676-17151698 CTCCAGCCCCAGAGCAGCTCAGG + Intergenic
952293253 3:32038655-32038677 CTTCAGCCTCAGACAAGCACTGG - Intronic
953412188 3:42696908-42696930 CATCAGGCGCAGAGCTCCCCAGG + Intronic
953477981 3:43222066-43222088 CTGCAGGCACAGAGCAGCACAGG + Intergenic
953627791 3:44585084-44585106 GGGCAGCCGCAGAGGAGCCCTGG - Intronic
954144840 3:48629374-48629396 CTCCACCTGCAGAGCAGCCGTGG - Intronic
954882791 3:53846773-53846795 CTGCACCCTCAGGGCAGCCCCGG + Intronic
955410811 3:58654265-58654287 CTTCAGGCACAGAGCAGACCTGG + Intronic
958529753 3:95311584-95311606 CCACAGCCTCAGAGCAGCCACGG - Intergenic
961492232 3:127263935-127263957 CAGCAGCAGCAGGGCAGCCCTGG + Intergenic
964762108 3:160144336-160144358 CTTCTGTCCCAGAGAAGCCCTGG - Intergenic
966783439 3:183604305-183604327 CTTCAGCCTCATAGAAGCCTAGG - Intergenic
968643728 4:1728218-1728240 CCACACCCGCAGGGCAGCCCAGG - Exonic
969491853 4:7503995-7504017 CTCCACCCGGAGAGCAGGCCTGG + Intronic
969516195 4:7649440-7649462 CTGCAGCTGCAGAGCACACCTGG - Intronic
970033174 4:11701072-11701094 ATTCACCCGCTGAGTAGCCCAGG - Intergenic
973694506 4:53476823-53476845 CTGCAGCAGCCCAGCAGCCCTGG - Exonic
975320090 4:73000308-73000330 CTTCAGTTGCAGACCAGGCCTGG - Intergenic
982366424 4:154584477-154584499 CTTCAGCCTCAGAGCCTACCCGG + Exonic
984811406 4:183798403-183798425 CTCCAGCCGCGGAGCAGTGCCGG - Intergenic
985546771 5:513895-513917 CTTCAGAGGGAGAGGAGCCCTGG - Intronic
985702329 5:1381068-1381090 CTCCAGCAGCAGAGCAGCCAGGG + Intergenic
987074104 5:14364740-14364762 ATTTAGCCGCAGAGCAGCATCGG + Exonic
990792359 5:59496134-59496156 GTCCAGCCGCTCAGCAGCCCGGG + Intronic
997249887 5:132380368-132380390 CTTCAGCCACAGAGCAGCGGTGG + Intronic
997531471 5:134584068-134584090 CTTCACCCCTAGACCAGCCCAGG - Intergenic
997856378 5:137376510-137376532 CCTCAGCCGTAGAGCTCCCCAGG + Intronic
999127080 5:149253754-149253776 CTCCAGCACCAGAGGAGCCCAGG - Intronic
1000478570 5:161743769-161743791 CCTCAGCCCCAGAGCAGATCTGG + Intergenic
1001125392 5:169014458-169014480 CTTCAGCCAAAGAAAAGCCCTGG - Intronic
1001209154 5:169794090-169794112 CTGCAGCCCGAGGGCAGCCCTGG - Intronic
1001953159 5:175830193-175830215 CTGCCGCCACAGAGCTGCCCTGG + Intronic
1002194799 5:177496021-177496043 CTTCAGCCTCACTGCCGCCCAGG - Intronic
1002315286 5:178339404-178339426 CTTAAGCCTCAGAGCAGAGCAGG + Intronic
1002650927 5:180693078-180693100 CTGCAGCCTCAGCACAGCCCTGG + Intergenic
1003571874 6:7261365-7261387 CCTCTGCAGCAGCGCAGCCCGGG + Intergenic
1005920275 6:30395305-30395327 CTTCAACCCCAGAGATGCCCAGG - Intergenic
1006022408 6:31125210-31125232 CTGGAGCCCCAGAGCAGCTCTGG - Intronic
1006084523 6:31586767-31586789 CCTGAGCCGCAGAGCAGCGCGGG - Intronic
1006448071 6:34091003-34091025 CTTCAGCCCCACAGCCCCCCAGG + Intronic
1006513627 6:34534405-34534427 CTTCAGGCTCTGAGGAGCCCAGG - Exonic
1007317553 6:41001582-41001604 CTTCAGCCACAGGGGAGCTCAGG + Intergenic
1010249881 6:73696330-73696352 CCAGAGCCGCAGAGCGGCCCAGG - Intronic
1013178906 6:107701416-107701438 CTAGAGCCCCAGAACAGCCCTGG + Intergenic
1015925772 6:138308909-138308931 CTCCAGCCACAGAGCCACCCTGG - Intronic
1016310136 6:142725224-142725246 CAGCAGCCACAGAGCAGTCCTGG + Intergenic
1016709814 6:147156715-147156737 CCTCAGCTGCAGCTCAGCCCAGG + Intergenic
1017470526 6:154733703-154733725 CCTCAGCGGCAGAGCGGCACCGG - Intronic
1017724865 6:157269760-157269782 CATCAGCCGGAGTGGAGCCCTGG + Intergenic
1017884564 6:158588266-158588288 CTTCAGCCCACTAGCAGCCCTGG - Intronic
1018960199 6:168442000-168442022 CTTCAGCCGGCGAGAGGCCCGGG - Intronic
1019481192 7:1267572-1267594 CTTCGCCCCCAGAGCAGCCCTGG + Intergenic
1019908938 7:4086564-4086586 CTTCATCTTCAGAGCAGCCGGGG + Intronic
1020049405 7:5072134-5072156 GTTCTGCCCCAGAGCTGCCCTGG - Intronic
1020275553 7:6622470-6622492 CTTCAGCCGCAGCACGGACCTGG + Exonic
1023289650 7:38656197-38656219 TCACAGACGCAGAGCAGCCCGGG + Intergenic
1024762486 7:52616466-52616488 CTTCTACCCCAGAGAAGCCCTGG - Intergenic
1025212185 7:57026081-57026103 CTTCAGACTCAGAACAGCCCAGG + Intergenic
1025659769 7:63550747-63550769 CTTCAGACTCAGAACAGCCCAGG - Intergenic
1025815109 7:64903664-64903686 CTGCGGCAGCAGAGCTGCCCAGG - Intronic
1029177523 7:98675325-98675347 CTTCAGCAGCAGGGAAGCCTAGG + Intergenic
1029622602 7:101699310-101699332 CTCCTGCCTCAGCGCAGCCCTGG + Intergenic
1030778376 7:113565339-113565361 CTTCCCCAGCACAGCAGCCCTGG - Intergenic
1031646658 7:124234609-124234631 TTTCAGCCACAGAGCAGCTAAGG - Intergenic
1031647075 7:124239626-124239648 TTTCAGCCACAGAGCAGCTAAGG - Intergenic
1031647497 7:124244645-124244667 TTTCAGCCACAGAGCAGCTGAGG - Intergenic
1031807940 7:126329650-126329672 CTACAGAGGCAGAGCTGCCCAGG + Intergenic
1032143330 7:129354523-129354545 TTTCAGCAGCAGAACAGTCCAGG + Intronic
1034101231 7:148452189-148452211 CATTAGCTGCAGAGAAGCCCTGG - Intergenic
1035401806 7:158570533-158570555 CTTCAGTGGCAGAGCCGGCCGGG - Intronic
1035708585 8:1695771-1695793 CTGCAGCCTCAGGGCAGGCCAGG - Intronic
1036746492 8:11413611-11413633 CTCCATAGGCAGAGCAGCCCGGG - Intronic
1038575878 8:28702431-28702453 CATCAGCAGCCGGGCAGCCCTGG - Intronic
1039478774 8:37856477-37856499 TGACACCCGCAGAGCAGCCCAGG + Intergenic
1039862772 8:41473349-41473371 TTTCATCCTCTGAGCAGCCCAGG + Intergenic
1039884460 8:41647248-41647270 CATCAGCCGCTCAGCTGCCCTGG - Exonic
1040777125 8:51058262-51058284 CTGCAGCTGCAGAGCCGCCTCGG + Intergenic
1041742221 8:61167974-61167996 CTTCATAGACAGAGCAGCCCTGG - Intronic
1042850744 8:73213645-73213667 CTCCAGCCCCACTGCAGCCCAGG + Intergenic
1046311186 8:112440344-112440366 CTACAGAGGCAGAGCTGCCCAGG - Intronic
1048251950 8:132873854-132873876 TTTCTTCTGCAGAGCAGCCCTGG - Intronic
1048369744 8:133767019-133767041 CTTCAGTCCCTGAGCAGGCCAGG - Intergenic
1049289535 8:141794464-141794486 CATCAGCAGCAGTGAAGCCCAGG - Intergenic
1049341199 8:142113544-142113566 CTTCAGCCCCAGGGCAGCCCTGG + Intergenic
1049496665 8:142938870-142938892 CTGCAGCTGCAAAGCAGCCCGGG - Intergenic
1049529278 8:143146378-143146400 CTCCAGCTGCAGCTCAGCCCTGG - Intergenic
1052839562 9:33280316-33280338 CTCCATAGGCAGAGCAGCCCTGG + Intronic
1055731898 9:79287171-79287193 AGGCAGCCGCAGAGCAGGCCAGG + Intergenic
1057299648 9:93870515-93870537 CCCCAGCCGCACTGCAGCCCTGG + Intergenic
1057309676 9:93934119-93934141 TTTCAGCCTGAGAGGAGCCCTGG + Intergenic
1057315944 9:93968595-93968617 CTGCAGCCCCAGACCAGCCCAGG + Intergenic
1057816596 9:98300488-98300510 ATTCAGCCCCAGAGAAGCCTGGG + Intronic
1059804351 9:117782570-117782592 CCTCATACGCAGAGCAGCTCAGG + Intergenic
1060074565 9:120579920-120579942 CTGCAGCCGCTGAGCGTCCCAGG + Exonic
1060793207 9:126499323-126499345 CTGCAGCAGCTGGGCAGCCCGGG - Intronic
1061378113 9:130238078-130238100 CCGCAGCAGCAGCGCAGCCCAGG - Intergenic
1061861789 9:133472166-133472188 CTTCACCCGCAGAGCACCTTCGG - Exonic
1062421983 9:136487048-136487070 CTTCAGCCTCATGTCAGCCCTGG - Intergenic
1186849824 X:13569616-13569638 CTTCATCCGCAGAGGAGCCTCGG + Exonic
1189289403 X:39874623-39874645 CTGCAGTAGCAGAGAAGCCCTGG + Intergenic
1191858308 X:65645197-65645219 CTCCAGGCTCAGAGCAGCCTGGG - Intronic
1197018665 X:121659242-121659264 CTCCAGCCGCTGGCCAGCCCTGG + Intergenic
1197762998 X:130040620-130040642 CTTGAGGCGCAGAGCAGCCTTGG + Intronic
1197968883 X:132094293-132094315 CTTCAGCCCCAAACCAGACCCGG + Intronic
1198104026 X:133445718-133445740 CACCAGCCGCAGGGCTGCCCCGG + Intergenic
1200601234 Y:5208114-5208136 CTGCCTCCGCACAGCAGCCCCGG - Intronic