ID: 1159589301

View in Genome Browser
Species Human (GRCh38)
Location 18:70315321-70315343
Sequence AAGTGATCAAGGAGCTACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159589301_1159589304 12 Left 1159589301 18:70315321-70315343 CCATGGTAGCTCCTTGATCACTT 0: 1
1: 0
2: 0
3: 15
4: 104
Right 1159589304 18:70315356-70315378 TGACAATTATTAGCTTCTTTTGG 0: 1
1: 1
2: 2
3: 29
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159589301 Original CRISPR AAGTGATCAAGGAGCTACCA TGG (reversed) Intronic
903273384 1:22206035-22206057 AAGTAAACAAGGACCTACCAGGG - Intergenic
908465079 1:64385758-64385780 AAGTGAGTAAGGAGCCCCCATGG - Intergenic
908899040 1:68934679-68934701 AAGAGATCATGGTGATACCATGG - Intergenic
915007127 1:152648891-152648913 TGGTGGTCAGGGAGCTACCATGG + Intergenic
915687654 1:157651086-157651108 AAGTGGTCAAGCAGCTTTCAAGG - Intergenic
917008086 1:170437899-170437921 AAGTGATCAAAGAGCACCCCAGG + Intergenic
917818412 1:178735043-178735065 AAGTGATCACGAAGCTGCTATGG - Intronic
918716154 1:187789362-187789384 AAGTGATCGAGGAGGTTCAAAGG + Intergenic
920019722 1:202946279-202946301 CAGTGATCAAGGGTCAACCAAGG + Intronic
920101811 1:203521652-203521674 ATGTGATAAAGGAGATAACATGG + Intergenic
921501370 1:215907757-215907779 AAGTAATTAAAGAGATACCATGG + Intronic
922722178 1:227904753-227904775 GAGTGGTCCAGGAGCTACCAGGG - Intergenic
1063576024 10:7262690-7262712 CAGTGATCAAGCAGCTGCGATGG + Intronic
1064566645 10:16646545-16646567 AAGTGTTCGGGGAGCTACGATGG - Intronic
1068004601 10:51377971-51377993 AAGTGATCAATCAGCTAGCTTGG - Intronic
1069227518 10:65962253-65962275 AAGTGACCAAGGGGCATCCAAGG - Intronic
1071893365 10:90037443-90037465 AAGCAATCAAGTTGCTACCAGGG + Intergenic
1072888980 10:99304588-99304610 AAGGTATCAAAGAGCTACAAAGG + Intergenic
1074659439 10:115636221-115636243 AAGGGATAAAGAGGCTACCAAGG - Intronic
1077904046 11:6515069-6515091 AAGGGATCAATGAGCTAAGAGGG - Intronic
1077917819 11:6622594-6622616 AAGGGTCCAAGGAGCCACCACGG + Exonic
1079334987 11:19563489-19563511 AAGGGCTCAAGTAGCAACCAAGG - Intronic
1081947371 11:47009197-47009219 AAGTCATCAGAGAGCCACCAAGG - Intronic
1087145017 11:94802216-94802238 ATTTGATCAAGGAGCTATAAAGG - Intronic
1087437221 11:98136515-98136537 AAATGATCAAGGAGTTTACAAGG + Intergenic
1088771563 11:113041004-113041026 AAGTGTTCAAGGAAATAGCATGG + Intronic
1091772826 12:3164339-3164361 CATTGATCAGGGAGCCACCATGG + Intronic
1094451381 12:30586221-30586243 AGGTGATGAAGGAGCTACACAGG + Intergenic
1097014758 12:55977774-55977796 AACTGAATAAGGAGCTACCCAGG + Intronic
1098095245 12:66947434-66947456 CAGTGATTAAGGAGAAACCAAGG - Intergenic
1098908700 12:76187726-76187748 AAGTGACCAAGGAACTCCCAAGG + Intergenic
1102380631 12:112463410-112463432 TAGTGTTAAAGAAGCTACCATGG - Intronic
1103795876 12:123502837-123502859 AAGGTATCAAGGTGTTACCAGGG + Intronic
1110587310 13:77209151-77209173 AATTGATCAAGGAGCTGGCAGGG + Intronic
1112632407 13:101177010-101177032 AGGTGATCTAGGAGAGACCAAGG - Intronic
1114917569 14:27287259-27287281 AAATGATCAGGCAGGTACCAGGG - Intergenic
1118227051 14:63911353-63911375 AAGTGCTCAAAGAGATACTACGG - Intronic
1120066919 14:80053006-80053028 AAGAGACTAAGAAGCTACCAAGG + Intergenic
1120504661 14:85340009-85340031 AAGTGATCAAGGTGTCAGCAGGG - Intergenic
1121302852 14:92885773-92885795 AAGTGATCAGGGAGGCTCCAGGG - Intergenic
1121837151 14:97102335-97102357 AAGTGTCCTAGGAGCCACCAGGG + Intergenic
1125578571 15:40770644-40770666 AAGTCATCCGGGAGCTACAAGGG + Exonic
1126050619 15:44681675-44681697 AAGGGATCAAGGATCTGCAAAGG + Intronic
1127115883 15:55726514-55726536 GAGAGACAAAGGAGCTACCAAGG + Intronic
1128252518 15:66172992-66173014 GAGTGTTCAAGGTGCTATCAGGG + Intronic
1140093949 16:71859619-71859641 AAGTGATCTAGGAGAAACCTGGG - Intronic
1151268349 17:72973863-72973885 AAGTGATTCAGTAGGTACCATGG + Intronic
1152671888 17:81613293-81613315 AAGTGATCCATGAGATTCCAGGG - Intronic
1153825419 18:8869949-8869971 GAGTGACCAGGGAACTACCAAGG - Intergenic
1158919474 18:62174272-62174294 CAGTGAACTAGGAGCTACCATGG - Intronic
1159589301 18:70315321-70315343 AAGTGATCAAGGAGCTACCATGG - Intronic
1166295737 19:41888400-41888422 AGGTGAGGAAGGAGGTACCAGGG - Intronic
1168692274 19:58384427-58384449 AAGGCATTAAGGAGCTATCACGG + Intergenic
929026040 2:37603232-37603254 AAGTAATCAGAGAGCTACCAAGG - Intergenic
929933128 2:46273999-46274021 GAGGTATCAAGGAGCTACCAGGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
935662358 2:105478005-105478027 AAGTTATCAGAGAGCTGCCAAGG - Intergenic
935685420 2:105678583-105678605 AAGTGATGACCGAGCTAACACGG - Intergenic
938441259 2:131335816-131335838 AGGGGATGAAGGAGCTAGCAGGG - Intronic
941359206 2:164531190-164531212 CAGTGATCACTGAGCTACCAAGG + Intronic
942412865 2:175729733-175729755 AAGTGACCAAGGAAGGACCAAGG + Intergenic
944047525 2:195429950-195429972 AATTTTTCAAGGAGCTTCCAGGG - Intergenic
946634640 2:221711228-221711250 AAGTGAATAAGGATCTAACAGGG - Intergenic
1169092338 20:2868681-2868703 AAGGCATCAAAGAGCTACCAGGG - Intronic
1173207233 20:41004686-41004708 AAGTGATGAGTGAGCCACCAGGG + Intergenic
1173323107 20:42007379-42007401 AAGTGATGATGGAGTTTCCAGGG - Intergenic
1175822215 20:61916301-61916323 AAGTGAGCAAAGAGCTAGCGTGG - Intronic
1176998929 21:15588190-15588212 AAGTGATCAAGTAACCATCAAGG + Intergenic
1179614454 21:42572868-42572890 AAGTGATGAAGGGGCAACCTAGG - Intronic
1182863727 22:33583839-33583861 AAGTGCTAAGGGAGCTTCCAAGG - Intronic
1183344097 22:37297481-37297503 AAGGGAGGAAGGAGCTTCCATGG - Intronic
1183373629 22:37449584-37449606 AAGCGATCAAGGAACAGCCACGG - Intergenic
1184311055 22:43643124-43643146 ATTTGATTGAGGAGCTACCAGGG + Intronic
949254747 3:2032411-2032433 AAGGGATGAAGGAGCTGTCAAGG + Intergenic
949850007 3:8412258-8412280 AAGTGATACAGGGGCTACCGAGG - Intergenic
950761080 3:15227291-15227313 AAGTGATTAATGACTTACCAAGG - Intronic
951112572 3:18822124-18822146 AAGTGTGCAAGTAACTACCATGG + Intergenic
952113893 3:30156877-30156899 AAGAGATGAAGGAGGTATCAAGG - Intergenic
956130526 3:66049220-66049242 AAGTTGGCAAGGAGCTACCAAGG - Intergenic
957183463 3:76911491-76911513 AAGTGATGAAGAAACTATCAAGG + Intronic
957249051 3:77749619-77749641 AAGTCAGCAAGGAGCTGCCATGG - Intergenic
958975907 3:100667802-100667824 AAGTGTTTCAGGTGCTACCAGGG + Intronic
959010202 3:101066704-101066726 AAGGGATCAAAGAGCAACCGAGG + Intergenic
960416219 3:117388459-117388481 AAGTGAAAAAGAAGCTTCCAAGG - Intergenic
976085986 4:81407651-81407673 AAGTACTTAAGGAGCTACAAAGG - Intergenic
982133653 4:152252101-152252123 GAGTTATCAAGGAGCCAGCATGG - Intergenic
983062118 4:163172468-163172490 AGCTGATTAAGGAGCCACCAGGG + Intergenic
984850594 4:184149289-184149311 AGGTTGTCAAGGACCTACCATGG + Intronic
993453160 5:88097345-88097367 AAGTGCCCAAGGAACTCCCAAGG + Intergenic
995880208 5:116836348-116836370 AAGTGCTCGAGGAGTTAACAAGG - Intergenic
995973324 5:118000391-118000413 AAGTCATCCAGGAGCAAGCATGG + Intergenic
1000041072 5:157485718-157485740 AAGTGATGAAGGAGCTTTCCTGG - Intronic
1002995804 6:2283388-2283410 AAGTAATCAAAGAGCTACAGAGG + Intergenic
1005420277 6:25641422-25641444 AAATGATCAAGGTGCCATCACGG + Intergenic
1005873796 6:29996252-29996274 CAGTGAACCAGGAGCTACAAGGG - Intergenic
1009372264 6:62920497-62920519 ATGGCATCAGGGAGCTACCAAGG - Intergenic
1015407503 6:132854401-132854423 GAGTGATCAAGGGGCTTCTATGG + Intergenic
1017747334 6:157458639-157458661 AAGGGATCAAGGACCTGGCATGG + Intronic
1018340673 6:162847767-162847789 ACCTGAACAAGGAGCTACTAGGG + Intronic
1019758773 7:2793187-2793209 GAAAGATCAAGGAGCTATCATGG + Intronic
1020471762 7:8545082-8545104 ATGTTATCAAGCAGCTACCAGGG + Intronic
1023288653 7:38645828-38645850 AAGGCATCAGAGAGCTACCAAGG - Intergenic
1034015061 7:147573878-147573900 AAAGGATCAAGAAGCTACCAGGG - Intronic
1035139672 7:156745754-156745776 AAGTGAGCAAGGAGCTGCAAAGG - Intronic
1038499957 8:28035586-28035608 AAGTGACCCAAGAGCCACCATGG + Intronic
1039916039 8:41861010-41861032 AAGTGATCAAAATGCTAGCAAGG + Intronic
1043373095 8:79615285-79615307 CTGTGAGCAATGAGCTACCAAGG - Intronic
1047295780 8:123569475-123569497 AAGTGAGCAAGGATCTAAAATGG - Intergenic
1048443000 8:134473817-134473839 AACTGATAAAGGAGCTGCAAGGG - Intergenic
1051371123 9:16360086-16360108 AAGTGGTAAGGGAGCTCCCAAGG + Intergenic
1062286547 9:135775480-135775502 AAGTGACCAAAGAGAAACCAGGG - Intronic
1185956261 X:4494261-4494283 CTGTGATCAAGGAGCAACTAGGG + Intergenic
1186911963 X:14177366-14177388 AAGTCATCAGAGAGCTACCAAGG - Intergenic
1191724620 X:64266760-64266782 AAGAAATCAAGGAGCTATCCTGG + Intergenic
1191725199 X:64271929-64271951 AAATTCTCCAGGAGCTACCAAGG + Intronic
1192253016 X:69429290-69429312 AAGTTTGCAAGGAGCTTCCAGGG + Intergenic
1193218150 X:78889248-78889270 AAGTGATCCAAGAGCTTTCATGG + Intergenic
1197799011 X:130329514-130329536 ATGAGATCAGGGAGGTACCAGGG - Intergenic
1198183813 X:134235516-134235538 AATTTATCAAGGACCTAGCAAGG - Intergenic
1199335495 X:146614759-146614781 AAGTGATTAAGGACCTCCAAAGG - Intergenic