ID: 1159589834

View in Genome Browser
Species Human (GRCh38)
Location 18:70321777-70321799
Sequence CAGGTAGGACAGGTTGGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159589829_1159589834 1 Left 1159589829 18:70321753-70321775 CCACTGATGTAAGCAGTAGAATG 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1159589834 18:70321777-70321799 CAGGTAGGACAGGTTGGCATAGG 0: 1
1: 0
2: 2
3: 19
4: 191
1159589828_1159589834 17 Left 1159589828 18:70321737-70321759 CCAGAATGTTTGAGAACCACTGA 0: 1
1: 3
2: 21
3: 119
4: 506
Right 1159589834 18:70321777-70321799 CAGGTAGGACAGGTTGGCATAGG 0: 1
1: 0
2: 2
3: 19
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159589834 Original CRISPR CAGGTAGGACAGGTTGGCAT AGG Intronic
901301042 1:8200345-8200367 CAGCTGGGACAGGTTGGAAAGGG + Intergenic
902082339 1:13829530-13829552 CAGGAAGGATAGGAGGGCATGGG - Intergenic
904673327 1:32181854-32181876 CAGGTAGTACTGGCTGGCACAGG - Intronic
904827272 1:33281691-33281713 CAGGTAGGAGGCGTTGGCAAAGG - Exonic
905003884 1:34694983-34695005 GAGGATGGAAAGGTTGGCATGGG + Intergenic
905256193 1:36687010-36687032 CAGTTATGAGAGGTAGGCATTGG - Intergenic
905662350 1:39737310-39737332 CAGGTGGGAAAGGTAGGCAGAGG - Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
906686773 1:47767959-47767981 CAGCTAGGCCAGGTGGGCAGGGG + Intronic
907716067 1:56927337-56927359 CAGGCAGGACAGTTTGGCTGTGG - Intergenic
908995963 1:70154453-70154475 CAGATAGGACAAGTTTGCTTTGG - Intronic
909134120 1:71775788-71775810 CATGTTGGCCAGGTTGGCCTCGG - Intronic
910361083 1:86414144-86414166 CAGGTGGGACCGGGTGGCACCGG + Intergenic
910849254 1:91635086-91635108 CAGGTAGGGGAAGTTGGTATTGG + Intergenic
912898422 1:113619794-113619816 CAGTTAGGACAGGTTGAAATTGG + Exonic
913165263 1:116179121-116179143 CAGTCAGAACAGGTTGGCACAGG + Intergenic
913983414 1:143544088-143544110 CAGTCAGGACAGGTTGGTTTGGG + Intergenic
914380868 1:147115075-147115097 CAGTCAGTCCAGGTTGGCATGGG + Intergenic
914485978 1:148110139-148110161 CAGTCAGTCCAGGTTGGCATGGG + Intronic
914537393 1:148578835-148578857 CAGTCAGTCCAGGTTGGCATGGG + Intronic
914579815 1:149009505-149009527 TAGTCAGGACAGGTTGGCTTCGG + Intronic
916884485 1:169053753-169053775 GAGGTTGGAGAGGTTGGCAGGGG - Intergenic
919628235 1:199933723-199933745 CATGTAGCCTAGGTTGGCATGGG + Intergenic
920313571 1:205062369-205062391 CAGGGAGGAGGGGTTGGCAGGGG - Intronic
921086655 1:211800236-211800258 CATGTTGGACAGGTTGGTCTTGG + Intronic
921929843 1:220746332-220746354 GAGGCAGGACAGGTGGGCAGAGG - Intergenic
922158776 1:223062352-223062374 CAGGAAAGACAGGATTGCATGGG - Intergenic
924944360 1:248836198-248836220 CTGGAAAGACAGGTTGGAATAGG + Intergenic
1063145245 10:3290058-3290080 GAGGTAGGAGAGGTTGGCGGGGG - Intergenic
1063322396 10:5062561-5062583 CAGGTGGAACAGGATGGCACTGG - Intronic
1065952585 10:30665482-30665504 CAGGTAGGACAGGTATAGATGGG + Intergenic
1065952594 10:30665520-30665542 CAGGTAGGACAGGTATAGATGGG + Intergenic
1066029155 10:31399815-31399837 CAGGCAGGAGTGGTTGGCAGTGG - Intronic
1068433619 10:56963382-56963404 CAGGAAGGGCAGGGTGGCTTAGG - Intergenic
1070187937 10:74084209-74084231 CAGGTTGGCCAGGTTGGGCTGGG + Intronic
1070604656 10:77890296-77890318 GAGGTAGGACAGGTAGACCTTGG - Intronic
1072458384 10:95597246-95597268 AAGGTAAGACAGGTTGGCTTTGG - Intergenic
1074297214 10:112201437-112201459 CAGGGAGGAGAGGTAGGCAGGGG - Intronic
1074352929 10:112755824-112755846 CAGCTAAGACAGGTTGGCCTAGG + Intronic
1075044216 10:119133342-119133364 CAGGTAGGACAGGTGCAGATGGG - Intronic
1075291960 10:121238415-121238437 AAGGGGAGACAGGTTGGCATTGG - Intergenic
1075438554 10:122462026-122462048 CAGCTGGCACAGGTTGGCGTAGG - Exonic
1076559421 10:131351423-131351445 AAGGCAGGTCAGGTTGGTATCGG - Intergenic
1077455992 11:2681277-2681299 CTGGTAGGACAGGAAGGTATAGG - Intronic
1078093382 11:8281663-8281685 CATGGAGGACAGGATGGCAGGGG - Intergenic
1078627576 11:12971592-12971614 GAGGGAGGGCAGGTGGGCATGGG - Intergenic
1083178632 11:60970464-60970486 CTGGCAGCACAGGTTTGCATGGG - Intergenic
1083528612 11:63396320-63396342 CAGGCAGGAATGGCTGGCATGGG + Intronic
1085422267 11:76372931-76372953 CAGGTAGGACAGGATAAAATAGG - Intronic
1088750928 11:112841661-112841683 CAGGGAGGAATGGATGGCATTGG - Intergenic
1089656078 11:119947907-119947929 CAATGAGGGCAGGTTGGCATAGG + Intergenic
1090094536 11:123730081-123730103 CAGGTGGGACAGGTGGAGATGGG - Intronic
1097455242 12:59792312-59792334 CAGGTAGGGCAGGCTGGCAATGG - Intergenic
1103261457 12:119593009-119593031 CAGGTAGATCAGGCTGGCCTAGG - Intergenic
1103908629 12:124339986-124340008 GAGGTGGGCCAGGTTGGCATGGG - Exonic
1104606292 12:130191461-130191483 CTGGAAGGACAGCATGGCATGGG - Intergenic
1104731735 12:131108944-131108966 CAGGTAGGACAGGATGAGACAGG + Intronic
1109287096 13:60422330-60422352 CTGGTAGGAAAGGGTGACATTGG + Intronic
1111919648 13:94396675-94396697 CCTGTAGGACAGGAAGGCATGGG + Intronic
1115428223 14:33285948-33285970 AGGGTAGGATAGGTTGGGATGGG - Intronic
1115647155 14:35376807-35376829 CAGGTTGGTCAGGCTGGCCTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1117306058 14:54474103-54474125 AAGGTAGGACGGGTTGTCAATGG + Intergenic
1118255949 14:64205947-64205969 CAAGTGGGACAGGATGGTATTGG - Intronic
1118744055 14:68761490-68761512 CAGGTAGGACAGGTGGGATGAGG - Intergenic
1118971846 14:70643437-70643459 AAGGTGGGAGAGGTTGGCAAAGG + Intronic
1121017106 14:90555533-90555555 CTGGGAGGACAGGATGGCATGGG + Intronic
1122121381 14:99555302-99555324 CTGGTAGGACAGGTGGGGACAGG - Intronic
1124627407 15:31316276-31316298 CAGAGAGGACCGGCTGGCATGGG - Intergenic
1125749844 15:42020807-42020829 CAGGGAGGGCTGGTAGGCATTGG - Intronic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1127897767 15:63317590-63317612 CAGGTAGATCATGTTGGAATTGG - Intergenic
1128594226 15:68929996-68930018 CAGGGAGGAGAGGTAGGCAAGGG - Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129193034 15:73948445-73948467 CGTGTAGGCCAGGTTGTCATGGG + Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1131952006 15:97691366-97691388 CACATAGAACAGGTTGGCAGAGG + Intergenic
1131985832 15:98042184-98042206 CAGGAAGGACAGATGGGTATGGG - Intergenic
1133028204 16:2997693-2997715 CAGGAAGGGGAGGTTGGCATGGG + Intergenic
1136608579 16:31352816-31352838 CGGGAAGGCCAGGCTGGCATGGG - Intergenic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1142112247 16:88339146-88339168 CAGGGAGGACAGGGTGGCGGGGG + Intergenic
1142517141 17:439592-439614 CAGGTTGGTCAGGTTGGTCTCGG + Intergenic
1142683668 17:1564343-1564365 CAGGCAAGACAGGCTGGCATGGG + Intergenic
1143631570 17:8143193-8143215 CAGGCAGCACAGGGTGGCAGAGG + Intronic
1144877487 17:18408948-18408970 CACATAGGACAGGTTTGGATTGG - Intergenic
1147332506 17:39707116-39707138 CAGGAAGGACAGGCTGGCATTGG - Exonic
1149659612 17:58327473-58327495 AAGAGAGGACAGGTGGGCATTGG + Intronic
1151680463 17:75620184-75620206 CAGGCAGGACAGGGAGGCACAGG + Intergenic
1152244412 17:79177622-79177644 CAGGTGGGACAGGTCGGGATGGG + Intronic
1152560230 17:81074934-81074956 CAGGTTGGAAAGGTTGGGCTGGG + Intronic
1153732586 18:8029402-8029424 CAGGTAGGACAGGTGGGGGAGGG - Intronic
1155354172 18:24935556-24935578 GAGGTAGAACAGGTTGACAAAGG + Intergenic
1156504916 18:37584326-37584348 CAGGAAGGCCAGGCTGACATTGG + Intergenic
1156928771 18:42616054-42616076 CATGTATGAGAGGTTGGGATGGG - Intergenic
1159589834 18:70321777-70321799 CAGGTAGGACAGGTTGGCATAGG + Intronic
1160359837 18:78265005-78265027 CAGGTAAGGCAGCTTGGTATTGG - Intergenic
1162954070 19:14088908-14088930 CAGGTAGGGCTGGTTTGCCTGGG + Exonic
1163425931 19:17241001-17241023 CAGGGAGGGCACATTGGCATGGG + Intronic
1163603854 19:18263830-18263852 CAGGGAGGGCAGGGTGGCCTCGG - Intronic
1164648049 19:29873456-29873478 CAGGAAGGACTGATTGGCTTGGG - Intergenic
1167770377 19:51511145-51511167 CAAATAGGACATGTTGGAATAGG - Intergenic
1168481554 19:56724436-56724458 CAGGTAGGAGCGGGTGGCTTAGG + Intergenic
925380981 2:3426046-3426068 CAAGTAGGACGGGTGGGAATTGG + Intronic
928317998 2:30260584-30260606 CAGGGAGAACAGCTTGGCAAGGG + Intronic
928509342 2:31987354-31987376 TAGGAAGGATAGGTAGGCATAGG + Intronic
929055930 2:37875844-37875866 CGGGGAGGACAGGCTGGCAGAGG - Intergenic
931438651 2:62271119-62271141 CAGCTAGGATACATTGGCATGGG + Intergenic
931833121 2:66072763-66072785 CAGGCAGAACAGGTTGCTATGGG + Intergenic
932420490 2:71598567-71598589 CAGGAAGGAGACGATGGCATAGG - Exonic
936235553 2:110739632-110739654 CTGTTAGGAGAGGGTGGCATGGG - Intronic
936613506 2:114025300-114025322 CAGGTGGCACAGGCTGGAATTGG + Intergenic
939454455 2:142415951-142415973 TGGCTAGGACAGGTTGGCAAAGG - Intergenic
940690006 2:156904678-156904700 CAGGTTGGACAGCTTGGATTGGG + Intergenic
941260671 2:163292748-163292770 CAGGAGGGACAGGCTGGCATGGG + Intergenic
942378825 2:175365523-175365545 CATGTAGGATAGGCTGGTATGGG + Intergenic
942526329 2:176856780-176856802 CAAGAAGGACAAGTTGACATTGG - Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943496594 2:188628748-188628770 GAGGTAGGAAAGGATGGTATTGG - Intergenic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
945293745 2:208150185-208150207 CAAGCAGGATAGGTTGTCATAGG - Intergenic
946412156 2:219520785-219520807 CAGGCAGGTCAGGTTGGGGTGGG + Intronic
946903497 2:224394546-224394568 CAAATAGGACAGGTTGGAAGGGG - Intronic
947009148 2:225546832-225546854 CAGGTAGAACAGGTCAGCCTGGG - Intronic
947051550 2:226049420-226049442 CACTTAGGAAAGGTTGGGATGGG + Intergenic
948270140 2:236667776-236667798 CAGGGAGGAGTGGGTGGCATGGG + Intergenic
948816394 2:240512417-240512439 CTGGTGGGACAGGATGGCTTCGG + Intronic
1168821313 20:775418-775440 CAGGTCGGACGTGGTGGCATGGG - Intergenic
1169732579 20:8802171-8802193 CAGGTAGGACTGGATGGGAGGGG + Intronic
1171992190 20:31705072-31705094 CAGGTAGGACAAGTTGGCTTTGG + Intronic
1172670878 20:36633725-36633747 CAGGCAGGACAGGTGGCCACAGG - Intronic
1172844302 20:37920577-37920599 CAGGTGGGCCAGGCTGGCCTTGG + Intronic
1173173635 20:40747307-40747329 CAGGGAGGAAACGTTTGCATGGG + Intergenic
1174548404 20:51343653-51343675 CAGGTGGGAGAGGATGGCAGTGG + Intergenic
1175287786 20:57849416-57849438 AAGGGAGGACAGCCTGGCATAGG - Intergenic
1176257066 20:64158310-64158332 CAGGTGGGGCAGGTGGGGATGGG - Intronic
1176257237 20:64158789-64158811 CAGGTAGGACAGGTGGGGCCAGG - Intronic
1176290581 21:5042406-5042428 CAGGGAGGACAGGCTGGAGTCGG + Intergenic
1177220263 21:18183287-18183309 AAAGCAGGACAGTTTGGCATAGG - Intronic
1178600129 21:33987589-33987611 CAGGCAGGACAGGATGGGAGTGG + Intergenic
1179375551 21:40847122-40847144 CAGGCAGGGAAGGTTGGCAGAGG - Exonic
1179866674 21:44221235-44221257 CAGGGAGGACAGGCTGGAGTCGG - Intergenic
1180667913 22:17529360-17529382 CAGGTAGCCCAGGGTCGCATTGG + Intronic
1180994762 22:19959916-19959938 CAGGTGGGACAGGCGGGCACTGG + Intronic
1183070242 22:35391051-35391073 CAGGTAGGTTAGGGTGGCACAGG - Intronic
1183276076 22:36899037-36899059 CAGGGAGGACAGGTTTGAGTTGG + Intergenic
1184399286 22:44264486-44264508 CAAGGAGGACAGGTTTGCAGGGG - Intronic
1184896513 22:47410223-47410245 CAGGTAGGAAAGGCAGCCATTGG - Intergenic
951685787 3:25342797-25342819 TAGGTAGCACAGCTTGGCCTGGG + Intronic
951838908 3:27012370-27012392 GAGGTAGGACAGGGAGGCAAGGG - Intergenic
952207248 3:31192144-31192166 GAGGTAGCACAGGATGGAATGGG - Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
955324485 3:57999579-57999601 CAGGCAGGACAGGGTGGGACAGG - Intergenic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
956292508 3:67676314-67676336 CAGATAGGACAGGTAGGCTAGGG - Intergenic
956835090 3:73090035-73090057 CAGGTAGGACAAGGTGGCTTTGG - Intergenic
957084370 3:75666580-75666602 CACGTTGGCCAGGTTGGCCTCGG + Exonic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
962911572 3:139855923-139855945 CAGGAAGGGCAGGCTGGCTTAGG + Intergenic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
965371118 3:167863635-167863657 CAGGTTGGACAAGCTTGCATAGG + Intergenic
967887270 3:194341758-194341780 CAGGTTGGACAGGTGGGCAAAGG + Exonic
968581267 4:1396410-1396432 AAGGGAGGACTGGTGGGCATGGG + Intergenic
968844029 4:3029773-3029795 CAGGGAGGACACGTTTGCTTAGG + Intronic
969655797 4:8497859-8497881 CAGGTAGCTCAGGTGGGCAAAGG - Intergenic
971230577 4:24797945-24797967 CAGTTAGTATAGGTTGGAATTGG + Intronic
975733495 4:77359633-77359655 CAGGAAGGACAGGATGGCTGTGG - Intronic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
978103098 4:104867310-104867332 AATTTAGGACAGGTTGGCAGTGG - Intergenic
985893872 5:2737957-2737979 CAGGCAGGACAGGTGGGCTGTGG - Intergenic
986165727 5:5270106-5270128 CAGGCAGGAAAGCATGGCATTGG - Intronic
990564164 5:57012238-57012260 CAGGGAGGACAGTCTGGCAGTGG + Intergenic
990664919 5:58061531-58061553 CACCTAGGACAGGTTGGTAAAGG - Intergenic
992412018 5:76514485-76514507 GAGGTAGGACAGGCTGGGAGTGG - Intronic
994030345 5:95134533-95134555 CAGGTGGGGCAGGATGGCCTAGG + Intronic
997189961 5:131922698-131922720 GAGGTAGGAAAGGTGGGGATGGG - Intronic
1003504957 6:6733431-6733453 CAGGTGGGACTGGTTGGCAGTGG - Intergenic
1003515148 6:6811632-6811654 CAGGTGGCACAGGATGGGATGGG + Intergenic
1004667825 6:17764692-17764714 CATGTCAGACAGGGTGGCATTGG + Exonic
1004722584 6:18280364-18280386 CAGTTAGAACATGTTTGCATAGG + Intergenic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1006830437 6:36964809-36964831 CAGGTTGGACAGGTTTTTATTGG - Exonic
1006879541 6:37327118-37327140 CAGGGAGTACATGGTGGCATGGG + Intronic
1009604898 6:65854841-65854863 CAGTAAGGACAGATTGGCAAAGG + Intergenic
1011873945 6:91932929-91932951 CAGGTAGGAAAGGGAGGCACTGG - Intergenic
1013519957 6:110923972-110923994 CAGCCAGGCCAGGTTGGCCTTGG - Intergenic
1014202067 6:118618902-118618924 CAGATAGGACGCGTTGGCAAAGG + Intronic
1014802456 6:125791339-125791361 TGGGGAGGACAGGTTGGCATGGG + Intronic
1017830432 6:158123193-158123215 CAGGGAGGACAGGATGTTATAGG + Intronic
1030123483 7:106133403-106133425 CAGGTGGGACAGGTCTGCCTTGG + Intergenic
1032453497 7:132054297-132054319 CAGGCAGGAGAGGTGGGAATAGG + Intergenic
1033166126 7:139040138-139040160 CAGGTAGGACCAGTGGGCATGGG + Intergenic
1033415641 7:141159093-141159115 CAGGCAGGAGAGGTTGGGAAGGG - Intronic
1035466510 7:159083109-159083131 CAGGTAGGACAGGTGGGACCAGG - Intronic
1036960651 8:13241380-13241402 CAGGTTGGAAATGTTAGCATGGG - Intronic
1042967259 8:74367887-74367909 GAGGGAGGAGAGATTGGCATTGG + Intronic
1045573757 8:103396688-103396710 TAGGTAGGAGAGGTTGGCAAAGG - Intergenic
1047011159 8:120673764-120673786 TGGGGAGGAGAGGTTGGCATGGG - Intronic
1051504380 9:17811648-17811670 CACTTAGGCCAGGTTGGCCTAGG + Intergenic
1054969577 9:71069557-71069579 TAGATAGGACAGGTAGGAATAGG + Intronic
1055841666 9:80512644-80512666 CAGGTTGGACATGTAGGCATTGG + Intergenic
1056006864 9:82281700-82281722 TAGGTAGGACAGGTTGGGCTGGG + Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1058077631 9:100667223-100667245 CAAGGAGGGCAGCTTGGCATGGG + Intergenic
1186535661 X:10344774-10344796 TAGGGAGGACAATTTGGCATAGG + Intergenic
1186720335 X:12296926-12296948 TTGGCAGGACAGGTGGGCATGGG + Intronic
1187785133 X:22876089-22876111 CAGGTTGGAGAGGTTGTCAAAGG + Intergenic
1188327405 X:28822599-28822621 CGGGGAGGACATGTTGCCATGGG + Intronic
1190340568 X:49292457-49292479 CAGGTTGGCCAGGTTGGCTGAGG + Intronic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic
1199210611 X:145205845-145205867 CAGTGAGGAAAGGGTGGCATTGG - Intergenic
1200101627 X:153691481-153691503 GAGGTTGGCCAGGCTGGCATTGG - Exonic
1200312971 X:155098516-155098538 CTTGTAGGCCAGGTTGGCCTGGG + Intronic