ID: 1159592731

View in Genome Browser
Species Human (GRCh38)
Location 18:70352621-70352643
Sequence ATGGTTAATCAGCTACAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159592731_1159592738 21 Left 1159592731 18:70352621-70352643 CCATCTTGTAGCTGATTAACCAT 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1159592738 18:70352665-70352687 GAAACATAAAGAAAACACTGGGG No data
1159592731_1159592737 20 Left 1159592731 18:70352621-70352643 CCATCTTGTAGCTGATTAACCAT 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1159592737 18:70352664-70352686 TGAAACATAAAGAAAACACTGGG No data
1159592731_1159592736 19 Left 1159592731 18:70352621-70352643 CCATCTTGTAGCTGATTAACCAT 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1159592736 18:70352663-70352685 CTGAAACATAAAGAAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159592731 Original CRISPR ATGGTTAATCAGCTACAAGA TGG (reversed) Intergenic
902406806 1:16188798-16188820 ATGATAATGCAGCTACAAGAAGG - Intergenic
905448316 1:38041974-38041996 CTGCTTAATCCTCTACAAGAGGG - Intergenic
906756391 1:48320240-48320262 ATTGGTAATCAAGTACAAGAGGG + Intronic
906799142 1:48720981-48721003 AAGGTTAATGATCTAAAAGAGGG + Intronic
909097485 1:71306175-71306197 AAGGTGAATCAGCTATAAGTAGG + Intergenic
911380171 1:97104762-97104784 ATCGTTCATAAGCTACAAGAGGG + Intronic
911666213 1:100556138-100556160 ATGAATATTCAGGTACAAGAAGG - Intergenic
916361990 1:163980642-163980664 ATGTTTCATCAGCAGCAAGATGG + Intergenic
918384582 1:183992930-183992952 ATGGTTTATAAGCTCCATGAGGG + Intronic
921480970 1:215664360-215664382 ATGGTTATTCATCACCAAGATGG - Intronic
921571822 1:216788738-216788760 ATGGTGAATCCTCTACAAAAAGG - Intronic
922285126 1:224164190-224164212 ATGATTAATCAGAAACCAGAGGG - Intergenic
1064454982 10:15478843-15478865 ATGTTCATTCAGCTAAAAGAGGG + Intergenic
1068149991 10:53119649-53119671 ATGGTAATTCAGTTACAAGGAGG - Intergenic
1068634959 10:59338597-59338619 ATGGAGAATTAGCTACAACATGG - Intronic
1079605303 11:22358034-22358056 ATTATTAATCAGCTACAGAAAGG - Intronic
1080344845 11:31312766-31312788 ATGATTAGTCATCTACAAGCTGG - Intronic
1082857692 11:57823628-57823650 ATGGAGAATCAGATGCAAGAAGG + Intergenic
1083820732 11:65170036-65170058 AAGCTTCATCAACTACAAGAGGG - Intergenic
1083871639 11:65491835-65491857 ATGTTTAATCAGCTTCATGCTGG + Intergenic
1086945028 11:92836388-92836410 ATGATTAATCAGCTGAAGGAGGG - Intronic
1087570096 11:99915922-99915944 TTTGTTAATCAGTGACAAGAAGG - Intronic
1087749230 11:101988578-101988600 AATGTTAATCAGCAACAAAAAGG + Intronic
1088751561 11:112846476-112846498 ATGGTTAGACAGCTTCCAGAAGG + Intergenic
1088778586 11:113111104-113111126 ATGGACAATCAGCTACAGCAAGG - Intronic
1089717363 11:120374148-120374170 TTGGTTAACCAGCCACTAGATGG - Intronic
1090931064 11:131298629-131298651 ATGATTTATCATCTACAACAGGG - Intergenic
1093980327 12:25468746-25468768 AAGGTTACTCAGCTACTAAACGG - Intronic
1095136482 12:38610888-38610910 ATGTTTAAAGAGATACAAGAAGG - Intergenic
1095270270 12:40210275-40210297 ATGGATAATCAGTTACAAATAGG + Intronic
1095396682 12:41770001-41770023 ATGAGTAATCAGCTACCAGGTGG - Intergenic
1095632229 12:44391828-44391850 ATGCTTAGGCAGCTACAAGTAGG + Intergenic
1097363338 12:58682283-58682305 AGGGTGAATCACCTACAAGCAGG + Intronic
1102248127 12:111368021-111368043 AGGGTTCATGAGCTAAAAGAAGG + Intronic
1105607889 13:21942271-21942293 ATGGTGGATCAGATCCAAGAGGG + Intergenic
1108972636 13:56396407-56396429 ATGGTTATTCAGTTGCATGACGG + Intergenic
1110094696 13:71502480-71502502 ATGGTTAAACAGCTCCGACAAGG - Intronic
1114405191 14:22449930-22449952 ATGGTTAATCATCTGCAGGTAGG - Intergenic
1114949224 14:27726878-27726900 TTGCTTAAACAGCTACAATAAGG + Intergenic
1115739719 14:36375489-36375511 ATGGTTAACCACTTAGAAGAAGG - Intergenic
1117806089 14:59492355-59492377 ATGGAAAATCAGGTGCAAGAAGG + Intronic
1118430156 14:65710395-65710417 ATGGTAAATCAAGTAAAAGAAGG + Intronic
1122526678 14:102391006-102391028 ATGGTGAATTAGCTACATGTAGG - Intronic
1126693859 15:51309395-51309417 ATGGTTAATCTGCTTTATGAAGG + Intronic
1127121137 15:55773060-55773082 ATGGTTATTCAGATACTATAAGG + Intergenic
1131921892 15:97336965-97336987 ATAGCTAATCAGCTGCAAAAAGG + Intergenic
1135911607 16:26566507-26566529 ATTGATCATCAGCTGCAAGAGGG + Intergenic
1145752727 17:27366996-27367018 ATGGTAAGTCAGCCCCAAGATGG - Intergenic
1146761953 17:35486985-35487007 CTGGTTTATCATCTAGAAGAGGG - Intronic
1158821199 18:61161041-61161063 AGGGTTAATCAGCTTCCATAAGG - Intergenic
1159592731 18:70352621-70352643 ATGGTTAATCAGCTACAAGATGG - Intergenic
928776767 2:34774676-34774698 ATTGATTATCAGCTGCAAGATGG + Intergenic
931086383 2:58835363-58835385 AACATTAATCAGGTACAAGATGG + Intergenic
931827034 2:66011641-66011663 ATGTTTATTCACTTACAAGATGG + Intergenic
933761188 2:85673391-85673413 ATGGTTAATGAGCTAGGAGTTGG + Intergenic
935043734 2:99459968-99459990 ATGGTTAAGAATCAACAAGAAGG + Intronic
937930494 2:127201357-127201379 ATGGTAAATAATCTAGAAGAGGG - Intronic
938848681 2:135238130-135238152 ATGGTTAATTAGCTACAGTTAGG + Intronic
939726737 2:145729939-145729961 ATGTTCAAACAGCTACAAAAAGG + Intergenic
940680431 2:156778303-156778325 TTGGTTAATCATCTAAAAGTTGG + Intergenic
942285675 2:174413465-174413487 ATGCTTAATCAGCAATCAGATGG + Intronic
942821856 2:180124070-180124092 ATTGTTAATAAGTTATAAGAAGG + Intergenic
943105564 2:183542919-183542941 ATAGTTCAAAAGCTACAAGAAGG + Intergenic
945867429 2:215191807-215191829 ATAGTTAAGCAGCTCCAAAATGG + Intergenic
1169920235 20:10727193-10727215 ACAGTTAATCATATACAAGAGGG - Intergenic
1183403090 22:37616248-37616270 AAGGTTACTCAGCTAAGAGAGGG - Intronic
950391150 3:12697759-12697781 CTGGTTTATCAGCTATAAAATGG - Intergenic
951348307 3:21573574-21573596 ATGGTCAAAAAGCTACAGGATGG + Intronic
952149247 3:30568564-30568586 ATGAATATTCAACTACAAGAAGG + Intergenic
953486121 3:43298382-43298404 CTGGTTCTTCAGCTCCAAGAGGG - Intronic
955989683 3:64613132-64613154 AAGGGTAATCAGCTCCAGGAGGG + Intronic
956039620 3:65132294-65132316 AGGGTTAATCAGCTTTAACATGG + Intergenic
958068618 3:88579423-88579445 ATTGATAATCAGTTACATGAAGG + Intergenic
970471634 4:16385041-16385063 ATGGTTAATCAAGAACAAGGAGG - Intergenic
971105191 4:23517092-23517114 ATGGTTAATAAGAGACAAGAAGG - Intergenic
971179636 4:24317142-24317164 ATGGTTACTCAGCTAGGAGTGGG + Intergenic
979104594 4:116667852-116667874 ATGGTTATTCATCTAGAAAAAGG - Intergenic
979646194 4:123072465-123072487 ATGGTTTATCAGAAACAAGGAGG + Intronic
979861237 4:125696268-125696290 CTGGTCACTCAGCTACAAGGGGG + Intergenic
980647048 4:135655079-135655101 ATCAATATTCAGCTACAAGATGG + Intergenic
980649342 4:135689798-135689820 ATGGTTCATCTACTACAATATGG - Intergenic
981933229 4:150211949-150211971 ATGTGTCATCAGCTACCAGATGG + Intronic
982477701 4:155873280-155873302 ATGGCTACTCATCTACAAAAAGG + Intronic
982875751 4:160647182-160647204 ATGATGAATGGGCTACAAGAGGG + Intergenic
983467694 4:168115237-168115259 AGGGTTATTCAGCATCAAGATGG - Intronic
986235965 5:5910433-5910455 ATGCTTCTTCAGCTTCAAGAAGG + Intergenic
986467708 5:8043126-8043148 ATTGTTTATCAGCCACAAGGAGG - Intergenic
994106969 5:95960119-95960141 ATAGTTATTCAGCTAAAAGTGGG - Intronic
994493835 5:100484566-100484588 ATGGATAGTCAGATAGAAGATGG - Intergenic
995825188 5:116289180-116289202 ATGTTTAATGAGCTAAAAGAAGG - Intronic
997675013 5:135706424-135706446 ATTGTTAACCAGCTTAAAGATGG - Intergenic
1002369568 5:178740907-178740929 ATTGTTATTTAGCTAAAAGATGG + Intergenic
1004967535 6:20871711-20871733 ATGGTTAATCTTCTAGAAGGGGG - Intronic
1006530776 6:34651530-34651552 ATGGTTAGTCTGCCACAAGATGG + Intronic
1010212108 6:73370112-73370134 ACTGTTAATCAGCTATAAGGTGG - Intronic
1012020342 6:93910057-93910079 ATGGTCAATCCTATACAAGATGG - Intergenic
1014839115 6:126196436-126196458 ATTGTTAATCAGATAGATGAGGG - Intergenic
1016617547 6:146069933-146069955 AAGGTCATTCAGCTATAAGATGG + Intronic
1020337198 7:7071200-7071222 ATGGTTCATAACATACAAGAGGG + Intergenic
1021134672 7:16950854-16950876 ATGTTTACTCAGCTAGAAGTGGG - Intergenic
1022341811 7:29475669-29475691 ATTGTTATTCAGCAACAAAAAGG + Intronic
1024132486 7:46368801-46368823 ATAGTTAAGCAGCTGCATGATGG - Intergenic
1027588064 7:80082822-80082844 ATGGTTAATCAGATACCTGATGG + Intergenic
1030707259 7:112706572-112706594 ATGGTCACCCAGCTAGAAGATGG + Intergenic
1031608633 7:123798811-123798833 AGGATGAAGCAGCTACAAGATGG + Intergenic
1031857316 7:126938065-126938087 ATGTCTAGTTAGCTACAAGAGGG - Intronic
1033684570 7:143626575-143626597 ATGGTTAATCTGCTATACTAAGG - Intronic
1033687746 7:143705794-143705816 ATGGTTAATCTGCTATACTAAGG - Intronic
1033700041 7:143831048-143831070 ATGGTTAATCTGCTATACTAAGG + Intergenic
1036399676 8:8396604-8396626 ATGCTTAATATGCTACAACATGG + Intergenic
1037640165 8:20735068-20735090 GTGGTTAATGAGCTGCAAGGTGG - Intergenic
1039190969 8:34973684-34973706 CTGGTTCATCAGCCACAAGCTGG - Intergenic
1039600297 8:38830906-38830928 ATGGTTAGTCAGCCACAAACAGG - Intronic
1040791913 8:51240646-51240668 ATGGTGTGTCAGCTACTAGAGGG + Intergenic
1043575347 8:81650228-81650250 AAGGTTCATAAGCTAGAAGAAGG + Intergenic
1044012455 8:87011304-87011326 ATGATTAATAAGCTACACGAGGG - Intronic
1045600207 8:103706804-103706826 ATGGATATACAGGTACAAGAAGG - Intronic
1048650579 8:136472015-136472037 ATATTTGATCAGCTGCAAGAAGG + Intergenic
1050188654 9:3001811-3001833 ATGGTTAACCACATACAGGAGGG - Intergenic
1050210366 9:3247400-3247422 ATGATTACTCAGCTAAAAAATGG - Intronic
1052045749 9:23792346-23792368 ATGGTTCAGTGGCTACAAGAAGG - Intronic
1059588209 9:115628959-115628981 ATGCTTATTCTGATACAAGATGG - Intergenic
1186524236 X:10233573-10233595 ATGTTTAATTAGCAACAAGGTGG + Exonic
1189446837 X:41087337-41087359 AAGGGTAATCAGCTCCGAGAGGG - Intronic
1194450997 X:94044682-94044704 ATGTTAAACCAGCTACAAAAAGG + Intergenic
1199533190 X:148872460-148872482 ATGATTATTCAGCTACAAAAAGG - Intronic